Full data view for gene AMOT

Information The variants shown are described using the NM_133265.2 transcript reference sequence.

2 entries on 1 page. Showing entries 1 - 2.



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

?/. - c.1511_1537del r.(?) p.(Val504_Pro512del) Unknown - VUS g.112022631_112022657del - AMOT(NM_001113490.1):c.2738_2764del (p.(Val913_Pro921del)) - AMOT_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1511_1537del r.(?) p.(Val504_Pro512del) Unknown - - g.112022618_112022644del - 1511_1537delTTGCTGTTGCTGCTGCTGCTGCTCCAG;V504_A513>A - AMOT_000006 variant and/or predicted effect could not be not confirmed by curators PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 2 Lucy Raymond