Full data view for gene TSC2

The curator’s expert opinion on the classification of a variant, can be found in the
SUMMARY record. Regarding the classification, please note that where there are several
records of the same variant, the classification of that variant may differ depending on the
submitter’s conclusion.

The variants shown are described using the NM_000548.3 transcript reference sequence.

Legend

Please note that a short description of a certain column can be displayed when you move your mouse cursor over the column's header and hold it still. Below, a more detailed description is shown per column.

Effect: The variant's effect on the function of the gene/protein, displayed in the format 'R/C'. R is the value reported by the source (publication, submitter) and this classification may vary between records. C is the value concluded by the curator. Note that in some database the curator uses Summary records to give details on the classification of the variant.Values used: '+' indicating the variant affects function, '+?' probably affects function, '-' does not affect function, '-?' probably does not affect function, '?' effect unknown, '.' effect was not classified.

Exon: number of exon/intron containing variant; 2 = exon 2, 12i = intron 12, 2i_7i = from intron 2 to intron 7, 8i_9 = intron 8/exon 9 boundary, _1 = 5' to exon 1, 18_ = 3' of exon 18, _1_18_ = encompassing the entire 18-exon gene

DNA change (cDNA): description of variant at DNA level, based on a coding DNA reference sequence (following HGVS recommendations); e.g. c.123C>T, c.123_145del, c.123_126dup. For deletions/duplications extending beyond the reference transcript resp. {0}/{2} is used to replace del/dup. Extent of the deletion/duplication should be specified using the genomic description (g.). "-" indicates the variant described on genomic level does not affect the coding DNA reference sequence.

RNA change: description of variant at RNA level (following HGVS recommendations).

r.123c>u
r.? = unknown
r.(?) = RNA not analysed but probably transcribed copy of DNA variant
r.spl? = RNA not analysed but variant probably affects splicing
r.(spl?) = RNA not analysed but variant may affect splicing
r.0? = change expected to abolish transcription

Protein: description of variant at protein level (following HGVS recommendations).

p.(Arg345Pro) = change predicted from DNA (RNA not analysed)
p.Arg345Pro = change derived from RNA analysis
p.? = unknown effect
p.0? = probably no protein produced

P-domain: region/domain protein affected

Predict-BioInf: predicted effect of variant using bioinformatic analysis tools (e.g. AGVGD, CADD, conservation, Grantham, MutationTaster, PolyPhen, REVEL, SIFT, splicing, etc.)

Allele: On which allele is the variant located? Does not necessarily imply inheritance! 'Paternal' (confirmed or inferred), 'Maternal' (confirmed or inferred), 'Parent #1' or #2 for compound heterozygosity without having screened the parents, 'Unknown' for heterozygosity without having screened the parents, 'Both' for homozygozity.

Classification method: The method used for the clinical classification of this variant.
All options:

ACMG
ACGS
EAHAD-CFDB
ENIGMA
IARC
InSiGHT
kConFab
other

Clinical classification: Clinical classification of variant, preferably based on standardised criteria (e.g. ACMG), directed on the clinical consequences as published/submitted, indicated using an enriched system including inheritance: e.g. pathogenic, pathogenic (dominant), pathogenic (recessive), pathogenic (!), pathogenic (maternal), pathogenic (paternal). Standard inheritance is covered by dominant/recessive, imprinting by maternal/paternal. A '!' warns for exceptional circumstances to be explained in the 'Remarks' field (low penetrance, variants pathogenic in heterozygous state only, hypomorphic/hypermorphic variants, protective variants, etc.). Non-disease consequences (e.g. drug metabolism (pharmacogenetics), risk factor, blood group, tasting bitter) are indicated using additions to the benign classification; benign (dominant), benign (recessive), benign (!), etc. The value 'association' is used for variants associated with a phenotype and 'NA' for variants from in vitro/in silico records. NOTE: classification may differ from the opinion of the curator as given in a variant SUMMARY-record or the 'Functional effect concluded'). NOTE: pathogenic/likely pathogenic should go together with "variant (probably) affects function" In ClassFunctional.
All options:

pathogenic
pathogenic (dominant)
pathogenic (recessive)
pathogenic (!)
pathogenic (maternal)
pathogenic (paternal)
likely pathogenic
likely pathogenic (dominant)
likely pathogenic (recessive)
likely pathogenic (!)
likely pathogenic (maternal)
likely pathogenic (paternal)
VUS
VUS (!)
likely benign
likely benign (dominant)
likely benign (recessive)
likely benign (!)
likely benign (maternal)
likely benign (paternal)
benign
benign (dominant)
benign (recessive)
benign (!)
benign (maternal)
benign (paternal)
conflicting
association
NA

DNA change (genomic) (hg19): HGVS description of variant at DNA level, based on the genomic (chromosomal) DNA reference sequence; e.g. g.12345678C>T, g.12345679del, g.12345678_12345890dup

DNA change (hg38): HGVS description of variant at DNA level, based on the hg38 genomic (chromosomal) eference sequence; e.g. g.12345678C>T, g.12345679del, g.12345678_12345890dup

Published as: listed only when different from "DNA change"; variant as reported originally (e.g. 521delT). Variants seen in animal models, tested in vitro, predicted from RNA analysis, etc. are described between brackets like c.(456C>G)

ISCN: description of the variant according to ISCN nomenclature

DB-ID: database ID of variant, grouping multiple observations of the same variant together, starting with the HGNC gene symbol, followed by an underscore (_) and a six digit number (e.g. DMD_012345). _000000 is used for variants where DNA was not analysed (change predicted from RNA analysis), variants seen in animal models or variants not seen in humans but functionally tested in vitro

Variant remarks: remarks regarding variant described, e.g. germline mosaicism in mother, 345 kb deletion, muscle RNA analysed, not in 200 control chromosomes tested, on founder haplotype, etc.

Reference: publication describing the variant submitted, incl. links to OMIM, PubMed or other source, e.g. "den Dunnen ASHG2003 P2346"

ClinVar ID: ID of variant in ClinVar database

dbSNP ID: the dbSNP ID

Origin: Origin of variant/record: Germline = in all cells, De novo = in all cells, but not in either parent, Germline/De novo (untested) = in all cells, parents not tested (use only when De novo is likely, e.g. isolated/sporadic cases with dominant disease), Somatic = present in a subset of cells, but not in either parent, Uniparental disomy = from parental disomy (maternal or paternal), CLASSIFICATION record = submitter only sharing variant classification (note another report may share Individual data), SUMMARY record = master summary record from curator (may link to another database), In vitro (cloned) = data resulting from in vitro functional assays, animal model = data from animal model, Artefact = false positive variant call, DUPLICATE record = variant already described on another chromosome (e.g. unbalanced translocation, duplicating transposition, 2nd fusion transcript, etc.)
All options:

Germline
De novo
Germline/De novo (untested)
Somatic
Uniparental disomy
Uniparental disomy, maternal allele
Uniparental disomy, paternal allele
CLASSIFICATION record
SUMMARY record
In vitro (cloned)
In silico
animal model
Artefact
DUPLICATE record
Unknown
Not applicable

Segregation: Indicates whether the variant segregates with the phenotype (yes), does not segregate with the phenotype (no) or segregation is unknown (?)
All options:

? = unknown
yes = segregates with phenotype
no = does not segregate with phenotype
- = not applicable

Frequency: frequency in which the variant was found; e.g 5/760 chromosomes (in 5 of 760 chromosomes tested), 1/33 patients (in 1 of 33 patients analysed in study), 0.05 controls (in 5% of control cases tested)

Re-site: restriction enzyme recognition site created (+) or destroyed (-); e.g. BglII+;BamHI-

VIP: variant VIP-status was requested for matchmaking - need collaboration(s) to crack the case - please contact the submitter/curator. NOTE: to get VIP status ask the curator.

Methylation: result of methylation test; GOM (gain of methylation), LOM (loss of methylation), 30% (30% methylated). NOTE: when several tests were done mention the method as well (e.g. MS-PCR 75%)

Template: Template(s) used to detect the sequence variant; DNA (genomic DNA), RNA (cDNA) or protein
All options:

DNA
RNA = RNA (cDNA)
protein
? = unknown

Technique: technique(s) used to identify the sequence variant.
All options:

? = unknown
ARMS = amplification refractory mutation system
arrayCGH = array for Comparative Genomic Hybridisation
arrayMET = array for methylation analysis
arraySEQ = array for resequencing
arraySNP = array for SNP typing
arrayCNV = array for Copy Number Variation (SNP and CNV probes)
ASO = allele-specific oligo hybridisation
BESS = Base Excision Sequence Scanning
CMC = Chemical Mismatch Cleavage
COBRA = Combined Bisulfite Restriction Analysis
CSCE = Conformation Sensitive Capillary Electrophoresis
CSGE = Conformation Sensitive Gel Electrophoresis
ddF = dideoxy Fingerprinting
DGGE = Denaturing-Gradient Gel-Electrophoresis
DHPLC = Denaturing High-Performance Liquid Chromatography
DOVAM = Detection Of Virtually All Mutations (SSCA variant)
DSCA = Double-Strand DNA Conformation Analysis
DSDI = Detection Small Deletions and Insertions
EMC = Enzymatic Mismatch Cleavage
expr = expression analysis
FISH = Fluorescent In-Situ Hybridisation
FISHf = fiberFISH
HD = HeteroDuplex analysis
HPLC = High-Performance Liquid Chromatography
IEF = IsoElectric Focussing
IHC = Immuno-Histo-Chemistry
Invader = Invader assay
MAPH = Multiplex Amplifiable Probe Hybridisation
MAQ = Multiplex Amplicon Quantification
MCA = Melting Curve Analysis, high-resolution (HRMA)
microscope = microscopic analysis (karyotype)
microsat = microsatellite genotyping
minigene = expression minigene construct
MIP = Molecular Inversion Probe amplification
MIPsm = single molecule Molecular Inversion Probe amplification
MLPA = Multiplex Ligation-dependent Probe Amplification
MLPA-ms = Multiplex Ligation-dependent Probe Amplification, methylation specific
MS = mass spectrometry
Northern = Northern blotting
NUC = nuclease digestion (RNAseT1, S1)
OM = optical mapping
PAGE = Poly-Acrylamide Gel-Electrophoresis
PCR = Polymerase Chain Reaction
PCRdd = PCR, digital droplet
PCRdig = PCR + restriction enzyme digestion
PCRh = PCR, haloplex
PCRlr = PCR, long-range
PCRm = PCR, multiplex
PCRms = PCR, methylation sensitive
PCRq = PCR, quantitative (qPCR)
PCRrp = PCR, repeat-primed (RP-PCR)
PCRsqd = PCR, semi-quantitative duplex
PE = primer extension (APEX, SNaPshot)
PEms = primer extension, methylation-sensitive single-nucleotide
PFGE = Pulsed-Field Gel-Electrophoresis (+Southern)
PTT = Protein Truncation Test
RFLP = Restriction Fragment Length Polymorphisms
RT-PCR = Reverse Transcription and PCR
RT-PCRq = Reverse Transcription and PCR, quantitative
SBE = Single Base Extension
SEQ = SEQuencing (Sanger)
SEQb = bisulfite SEQuencing
SEQp = pyroSequencing
SEQms = sequencing, methylation specific
SEQ-ON = next-generation sequencing - Oxford Nanopore
SEQ-NG = next-generation sequencing
SEQ-NG-RNA = next-generation sequencing RNA
SEQ-NG-H = next-generation sequencing - Helicos
SEQ-NG-I = next-generation sequencing - Illumina/Solexa
SEQ-NG-IT = next-generation sequencing - Ion Torrent
SEQ-NG-R = next-generation sequencing - Roche/454
SEQ-NG-S = next-generation sequencing - SOLiD
SEQ-PB = next-generation sequencing - Pacific Biosciences
SNPlex = SNPlex
Southern = Southern blotting
SSCA = Single-Strand DNA Conformation polymorphism Analysis (SSCP)
SSCAf = fluorescent SSCA (SSCP)
STR = Short Tandem Repeat
TaqMan = TaqMan assay
Western = Western blotting
- = not applicable

Tissue: tissue type used for analysis

Remarks: remarks regarding the screening like WGS (whole genome sequencing), WES (whole exome sequencing, gene panel (incl. a list of genes analysed), etc.

ID_report: ID of the individual that can be publically shared, e.g. as listed in a publication

Reference: reference to publication describing the individual/family, possibly giving more phenotypic details than listed in this database entry, incl. link to PubMed or other source, e.g. "den Dunnen ASHG2003 P2346"

Remarks: remarks about the individual

Gender: gender individual
All options:

? = unknown
- = not applicable
F = female
M = male
rF = raised as female
rM = raised as male

Consanguinity: indicates whether the parents are related (consanguineous), not related (non-consanguineous) or whether consanguinity is not known (unknown)
All options:

no = non-consanguineous parents
yes = consanguineous parents
likely = consanguinity likely
? = unknown
- = not applicable

Country: where (country) does the individual live/recently came from. Give additional details (population, specific sub-group) and when parents come from different countries in "Population". Belgium = individual lives in/recently came from Belgium, (France) = reported by laboratory in France, individual's country of origin not sure
All options:

? (unknown)
- (not applicable)
Afghanistan
(Afghanistan)
Albania
(Albania)
Algeria
(Algeria)
American Samoa
(American Samoa)
Andorra
(Andorra)
Angola
(Angola)
Anguilla
(Anguilla)
Antarctica
(Antarctica)
Antigua and Barbuda
(Antigua and Barbuda)
Argentina
(Argentina)
Armenia
(Armenia)
Aruba
(Aruba)
Australia
(Australia)
Austria
(Austria)
Azerbaijan
(Azerbaijan)
Bahamas
(Bahamas)
Bahrain
(Bahrain)
Bangladesh
(Bangladesh)
Barbados
(Barbados)
Belarus
(Belarus)
Belgium
(Belgium)
Belize
(Belize)
Benin
(Benin)
Bermuda
(Bermuda)
Bhutan
(Bhutan)
Bolivia
(Bolivia)
Bosnia and Herzegovina
(Bosnia and Herzegovina)
Botswana
(Botswana)
Bouvet Island
(Bouvet Island)
Brazil
(Brazil)
British Indian Ocean Territory
(British Indian Ocean Territory)
Brunei Darussalam
(Brunei Darussalam)
Bulgaria
(Bulgaria)
Burkina Faso
(Burkina Faso)
Burundi
(Burundi)
Cambodia
(Cambodia)
Cameroon
(Cameroon)
Canada
(Canada)
Cape Verde
(Cape Verde)
Cayman Islands
(Cayman Islands)
Central African Republic
(Central African Republic)
Central Europe
Chad
(Chad)
Chile
(Chile)
China
(China)
Christmas Island
(Christmas Island)
Cocos (Keeling Islands)
(Cocos (Keeling Islands))
Colombia
(Colombia)
Comoros
(Comoros)
Congo
(Congo)
Cook Islands
(Cook Islands)
Costa Rica
(Costa Rica)
Cote D'Ivoire (Ivory Coast)
(Cote D'Ivoire (Ivory Coast))
Croatia (Hrvatska)
(Croatia (Hrvatska))
Cuba
(Cuba)
Cyprus
(Cyprus)
Czech Republic
(Czech Republic)
Denmark
(Denmark)
Djibouti
(Djibouti)
Dominica
(Dominica)
Dominican Republic
(Dominican Republic)
East Timor
(East Timor)
Ecuador
(Ecuador)
Egypt
(Egypt)
El Salvador
(El Salvador)
England
(England)
Equatorial Guinea
(Equatorial Guinea)
Eritrea
(Eritrea)
Estonia
(Estonia)
Ethiopia
(Ethiopia)
Falkland Islands (Malvinas)
(Falkland Islands (Malvinas))
Faroe Islands
(Faroe Islands)
Fiji
(Fiji)
Finland
(Finland)
France
(France)
Gabon
(Gabon)
Gambia
(Gambia)
Georgia
(Georgia)
Germany
(Germany)
Ghana
(Ghana)
Gibraltar
(Gibraltar)
Greece
(Greece)
Greenland
(Greenland)
Grenada
(Grenada)
Guadeloupe
(Guadeloupe)
Guam
(Guam)
Guatemala
(Guatemala)
Guiana, French
(Guiana, French)
Guinea
(Guinea)
Guinea-Bissau
(Guinea-Bissau)
Guyana
(Guyana)
Haiti
(Haiti)
Heard and McDonald Islands
(Heard and McDonald Islands)
Honduras
(Honduras)
Hong Kong
(Hong Kong)
Hungary
(Hungary)
Iceland
(Iceland)
India
(India)
Indonesia
(Indonesia)
Iran
(Iran)
Iraq
(Iraq)
Ireland
(Ireland)
Israel
(Israel)
Italy
(Italy)
Jamaica
(Jamaica)
Japan
(Japan)
Jordan
(Jordan)
Kazakhstan
(Kazakhstan)
Kenya
(Kenya)
Kiribati
(Kiribati)
Korea
(Korea)
Korea, North (People's Republic)
(Korea, North (People's Republic))
Korea, South (Republic)
(Korea, South (Republic))
Kosovo
(Kosovo)
Kuwait
(Kuwait)
Kyrgyzstan (Kyrgyz Republic)
(Kyrgyzstan (Kyrgyz Republic))
Laos
(Laos)
Latvia
(Latvia)
Lebanon
(Lebanon)
Lesotho
(Lesotho)
Liberia
(Liberia)
Libya
(Libya)
Liechtenstein
(Liechtenstein)
Lithuania
(Lithuania)
Luxembourg
(Luxembourg)
Macau
(Macau)
Macedonia
(Macedonia)
Madagascar
(Madagascar)
Malawi
(Malawi)
Malaysia
(Malaysia)
Maldives
(Maldives)
Mali
(Mali)
Mallorca
(Mallorca)
Malta
(Malta)
Marshall Islands
(Marshall Islands)
Martinique
(Martinique)
Mauritania
(Mauritania)
Mauritius
(Mauritius)
Mayotte
(Mayotte)
Mexico
(Mexico)
Micronesia
(Micronesia)
Moldova
(Moldova)
Monaco
(Monaco)
Mongolia
(Mongolia)
Montserrat
(Montserrat)
Morocco
(Morocco)
Mozambique
(Mozambique)
Myanmar
(Myanmar)
Namibia
(Namibia)
Nauru
(Nauru)
Nepal
(Nepal)
Netherlands
(Netherlands)
Netherlands Antilles
(Netherlands Antilles)
Neutral Zone (Saudia Arabia/Iraq)
(Neutral Zone (Saudia Arabia/Iraq))
New Caledonia
(New Caledonia)
New Zealand
(New Zealand)
Nicaragua
(Nicaragua)
Niger
(Niger)
Nigeria
(Nigeria)
Niue
(Niue)
Norfolk Island
(Norfolk Island)
Northern Ireland
(Northern Ireland)
Northern Mariana Islands
(Northern Mariana Islands)
Norway
(Norway)
Oman
(Oman)
Pakistan
(Pakistan)
Palau
(Palau)
Palestine
(Palestine)
Panama
(Panama)
Papua New Guinea
(Papua New Guinea)
Paraguay
(Paraguay)
Peru
(Peru)
Philippines
(Philippines)
Pitcairn
(Pitcairn)
Poland
(Poland)
Polynesia, French
(Polynesia, French)
Portugal
(Portugal)
Puerto Rico
(Puerto Rico)
Qatar
(Qatar)
Reunion
(Reunion)
Romania
(Romania)
Russia
(Russia)
Russian Federation
(Russian Federation)
Rwanda
(Rwanda)
S. Georgia and S. Sandwich Isls.
(S. Georgia and S. Sandwich Isls.)
Saint Kitts and Nevis
(Saint Kitts and Nevis)
Saint Lucia
(Saint Lucia)
Saint Vincent and The Grenadines
(Saint Vincent and The Grenadines)
Samoa
(Samoa)
San Marino
(San Marino)
Sao Tome and Principe
(Sao Tome and Principe)
Saudi Arabia
(Saudi Arabia)
Scotland
(Scotland)
Senegal
(Senegal)
Serbia
(Serbia)
Seychelles
(Seychelles)
Sierra Leone
(Sierra Leone)
Singapore
(Singapore)
Slovakia (Slovak Republic)
(Slovakia (Slovak Republic))
Slovenia
(Slovenia)
Solomon Islands
(Solomon Islands)
Somalia
(Somalia)
South Africa
(South Africa)
Southern Territories, French
(Southern Territories, French)
Soviet Union (former)
(Soviet Union (former))
Spain
(Spain)
Sri Lanka
(Sri Lanka)
St. Helena, Ascension and Tristan da
Cunha
(St. Helena, Ascension and Tristan da
Cunha)
St. Pierre and Miquelon
(St. Pierre and Miquelon)
Sudan
(Sudan)
Sudan, South
(Sudan, South)
Suriname
(Suriname)
Svalbard and Jan Mayen Islands
(Svalbard and Jan Mayen Islands)
Swaziland
(Swaziland)
Sweden
(Sweden)
Switzerland
(Switzerland)
Syria
(Syria)
Taiwan
(Taiwan)
Tajikistan
(Tajikistan)
Tanzania
(Tanzania)
Thailand
(Thailand)
Togo
(Togo)
Tokelau
(Tokelau)
Tonga
(Tonga)
Trinidad and Tobago
(Trinidad and Tobago)
Tunisia
(Tunisia)
Turkey
(Turkey)
Turkmenistan
(Turkmenistan)
Turks and Caicos Islands
(Turks and Caicos Islands)
Tuvalu
(Tuvalu)
Uganda
(Uganda)
Ukraine
(Ukraine)
United Arab Emirates
(United Arab Emirates)
United Kingdom (Great Britain)
(United Kingdom (Great Britain))
United States
(United States)
Uruguay
(Uruguay)
US Minor Outlying Islands
(US Minor Outlying Islands)
Uzbekistan
(Uzbekistan)
Vanuatu
(Vanuatu)
Vatican City State (Holy See)
(Vatican City State (Holy See))
Venezuela
(Venezuela)
Viet Nam
(Viet Nam)
Virgin Islands (British)
(Virgin Islands (British))
Virgin Islands (US)
(Virgin Islands (US))
Wales
(Wales)
Wallis and Futuna Islands
(Wallis and Futuna Islands)
Western Sahara
(Western Sahara)
Yemen
(Yemen)
Yugoslavia
(Yugoslavia)
Zaire
(Zaire)
Zambia
(Zambia)
Zimbabwe
(Zimbabwe)

Population: population the individual (or ancestors) belongs to; e.g. white, gypsy, Jewish-Ashkenazi, Africa-N, Sardinia, etc.

Age at death: age at which the individual deceased (when applicable):

35y = 35 years
>43y = still alive at 43y
04y08m = 4 years and 8 months
00y00m01d12h = 1 day and 12 hours
18y? = around 18 years
30y-40y = between 30 and 40 years
>54y = older than 54
? = unknown

VIP: individual/phenotype VIP-status was requested for matchmaking - need collaboration(s) to crack the case - please contact the submitter/curator. NOTE: to get VIP status ask the curator.

Data_av: are additional data available upon request: e.g. pedigree (yes/no/?)

Treatment: treatment of patient

How to query this table

All list views have search fields which can be used to search data. You can search for a complete word or you can search for a part of a search term. If you enclose two or more words in double quotes, LOVD will search for the combination of those words only exactly in the order you specify. Note that search terms are case-insensitive and that wildcards such as * are treated as normal text! For all options, like "and", "or", and "not" searches, or searching for prefixes or suffixes, see the table below.

Operator	Column type	Example	Matches
	Text	Arg	all entries containing 'Arg'
space	Text	Arg Ser	all entries containing 'Arg' and 'Ser'
\|	Text	Arg\|Ser	all entries containing 'Arg' or 'Ser'
!	Text	!fs	all entries not containing 'fs'
^	Text	^p.(Arg	all entries beginning with 'p.(Arg'
$	Text	Ser)$	all entries ending with 'Ser)'
=""	Text	=""	all entries with this field empty
=""	Text	="p.0"	all entries exactly matching 'p.0'
!=""	Text	!=""	all entries with this field not empty
!=""	Text	!="p.0"	all entries not exactly matching 'p.0?'
combination	Text	*\|Ter !fs	all entries containing '*' or 'Ter' but not containing 'fs'
	Date	2020	all entries matching the year 2020
\|	Date	2020-03\|2020-04	all entries matching March or April, 2020
!	Date	!2020-03	all entries not matching March, 2020
<	Date	<2020	all entries before the year 2020
<=	Date	<=2020-06	all entries in or before June, 2020
>	Date	>2020-06	all entries after June, 2020
>=	Date	>=2020-06-15	all entries on or after June 15th, 2020
combination	Date	2019\|2020 <2020-03	all entries in 2019 or 2020, and before March, 2020
	Numeric	23	all entries exactly matching 23
\|	Numeric	23\|24	all entries exactly matching 23 or 24
!	Numeric	!23	all entries not exactly matching 23
<	Numeric	<23	all entries lower than 23
<=	Numeric	<=23	all entries lower than, or equal to, 23
>	Numeric	>23	all entries higher than 23
>=	Numeric	>=23	all entries higher than, or equal to, 23
combination	Numeric	>=20 <30 !23	all entries with values from 20 to 29, but not equal to 23

Some more advanced examples:

Example	Matches
Asian	all entries containing 'Asian', 'asian', including 'Caucasian', 'caucasian', etc.
Asian !Caucasian	all entries containing 'Asian' but not containing 'Caucasian'
Asian\|African !Caucasian	all entries containing 'Asian' or 'African', but not containing 'Caucasian'
"South Asian"	all entries containing 'South Asian', but not containing 'South East Asian'

To sort on a certain column, click on the column header or on the arrows. If that column is already selected to sort on, the sort order will be swapped. The column currently sorted on has a darker blue background color than the other columns. The up and down arrows next to the column name indicate the current sorting direction. When sorting on any field other than the default, LOVD will sort secondarily on the default sort column.

30 entries on 1 page. Showing entries 1 - 30.

Legend

How to query

Effect	Exon	DNA change (cDNA)	RNA change	Protein	P-domain	Predict-BioInf	Allele	Classification method	Clinical classification	DNA change (genomic) (hg19)	DNA change (hg38)	Published as	ISCN	DB-ID	Variant remarks	Reference	ClinVar ID	dbSNP ID	Origin	Segregation	Frequency	Re-site	VIP	Methylation	Template	Technique	Tissue	Remarks	Disease	ID_report	Reference	Remarks	Gender	Consanguinity	Country	Population	Age at death	VIP	Data_av	Treatment	Panel size	Owner
-?/.	-	c.5068+27_5069-47del	r.?	p.?	-	-	Unknown	-	likely benign	g.2137969_2138002del	g.2087968_2088001del	PKD1(NM_001009944.3):c.1770_1803del, TSC2(NM_000548.3):c.5051_5068+16del, TSC2(NM_000548.3):c.5068+27_5069-47del (p.(=)), TSC2(NM_000548.5):c.505...	-	TSC2_000144	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	-	c.5068+27_5069-47del	r.?	p.?	-	-	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	PKD1(NM_001009944.3):c.1770_1803del, TSC2(NM_000548.3):c.5051_5068+16del, TSC2(NM_000548.3):c.5068+27_5069-47del (p.(=)), TSC2(NM_000548.5):c.505...	-	TSC2_000144	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	-	c.5068+27_5069-47del	r.?	p.?	-	-	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	PKD1(NM_001009944.3):c.1770_1803del, TSC2(NM_000548.3):c.5051_5068+16del, TSC2(NM_000548.3):c.5068+27_5069-47del (p.(=)), TSC2(NM_000548.5):c.505...	-	TSC2_000144	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-?/.	-	c.5068+27_5069-47del	r.?	p.?	-	-	Unknown	-	likely benign	g.2137969_2138002del	g.2087968_2088001del	PKD1(NM_001009944.3):c.1770_1803del, TSC2(NM_000548.3):c.5051_5068+16del, TSC2(NM_000548.3):c.5068+27_5069-47del (p.(=)), TSC2(NM_000548.5):c.505...	-	TSC2_000144	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	39i	c.5068+27_5069-47del	r.spl	p.?	-	-	Unknown	-	pathogenic	g.2137969_2138002del	g.2087968_2088001del	NM_000548.3:c.5051_c.5084+16delCCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG	-	TSC2_000144	34bp intronic deletion [caggaaaggtagggccgggtggggccctgcagtg]; found with a somatic TP53 variant reported as p.Ala88Thr	PubMed: Wu 2019	-	-	Germline	?	-	-	-	-	DNA	SEQ, SEQ-NG-I	Blood	23 renal cancer predisposition genes screened, variant confirmed by Sanger SEQ	RCC	-	PubMed: Wu 2019	positive family history of cancers; grandfather with lung cancer, father with gastric cancer; patient deceased 13 months after diagnosis	M	?	China	-	-	-	-	-	1	Rosemary Ekong
-/-	39i	c.5068+27_5069-47del	r.[5068_5069insGTAGGGCCGGGTGGGGCCCTGCAGTGTGGCGCCAAGAGCCCTGGGCCTGGCGTGACCACCAAGTCTCCCCAG];[=]	p.Lys1689_Asp1690insGlyArgAlaGlyTrpGlyProAlaValTrpArgGlnGluProTrpAlaTrpArgAspHisGlnValSerPro	GAP domain	unlikely to affect splicing	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	-	-	TSC2_000144	34bp intronic deletion [caggaaaggtagggccgggtggggccctgcagtg] causes abnormal splicing and the retention of 72bp from intron 39, resulting in the in-frame insertion of 24 new amino acids; variant seen in affected and unaffected individuals	-	-	rs137854209	SUMMARY record	-	593/285634 alleles, 1 homozygote	BsgI-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Paternal (confirmed)	-	benign	g.2137969_2138002del	g.2087968_2088001del	-	-	TSC2_000144	rare variant; affects splicing (see Roberts, 2003); 34bp deletion of intronic sequence (caggaaaggtagggccgggtggggccctgcagtg); found with TSC1 frameshift c.2672del , TSC2 c.5161-28_5161-25del and TSC2 3'UTR c.*71C>T	unpublished	-	-	Germline	-	-	-BsgI	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	2 affected individuals (parent and child) in 2 generations; proband has TSC1 frameshift c.2672del , TSC2 c.5068+27_5069-47del, TSC2 c.5161-28_5161-25del and TSC2 3'UTR c.71C>T; affected parent has TSC1 frameshift c.2672del and is a mosaic; proband has inherited TSC2 c.5068+27_5069-47del from the other parent; parents not tested for TSC2 c.71C>T	?	-	-	-	-	-	-	-	2	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	c.5068+27_5068+60del34	-	TSC2_000144	34bp intronic deletion (caggaaaggtagggccgggtggggccctgcagtg); found with TSC1 nonsense variant c.1525C>T	PubMed: Sancak, 2005, PubMed: Jansen, 2008	-	-	Germline	-	-	-BsgI	-	-	DNA	SEQ	Blood	-	TSC	-	PubMed: Sancak, 2005; PubMed: Jansen, 2008	diagnosed with definite TSC; patient has TSC1 nonsense variant c.1525C>T and TSC2 intronic variant c.5068+27_5069-47del	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	5086+26del34bp	-	TSC2_000144	splice variant; 34bp intronic deletion [caggaaaggtagggccgggtggggccctgcagtg]	unpublished	-	-	Germline	-	-	-BsgI	-	-	DNA	DHPLC	Blood	-	TSC	-	unpublished	2 cases; different patients from those in Jones, 1999	?	-	-	-	-	-	-	-	2	Rosemary Ekong
+/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	pathogenic	g.2137969_2138002del	g.2087968_2088001del	34bp deletion, exon 38/intron 38	-	TSC2_000144	rare variants; affects splicing (see Roberts, 2003) described as disease-causing; 34bp intronic deletion [caggaaaggtagggccgggtggggccctgcagtg]	PubMed: Jones, 1999	-	-	Germline	-	-	-BsgI	-	-	DNA	HD, SSCA	Blood	-	TSC	112	PubMed: Jones, 1999	variant also seen in a different patient by Beauchamp et.al. 1998	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Maternal (confirmed)	-	benign	g.2137969_2138002del	g.2087968_2088001del	5068+27_5068+60del34	-	TSC2_000144	splice variant; 34bp deletion of intronic sequence (caggaaaggtagggccgggtggggccctgcagtg)	unpublished	-	-	Germline	-	-	-BsgI	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	definite disease-causing variant not seen in proband; variant inherited from one of the parents	?	-	-	-	-	-	-	-	2	Rosemary Ekong
?/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	VUS	g.2137969_2138002del	g.2087968_2088001del	-	-	TSC2_000144	34bp intronic deletion (caggaaaggtagggccgggtggggccctgcagtg)	unpublished	-	-	Germline	-	-	-BsgI	-	-	DNA	DHPLC, SEQ	Blood	-	TSC	-	unpublished	No other family member tested	M	-	-	-	-	-	-	-	1	Rosemary Ekong
?/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Paternal (confirmed)	-	VUS	g.2137969_2138002del	g.2087968_2088001del	-	-	TSC2_000144	34bp intronic deletion (caggaaaggtagggccgggtggggccctgcagtg)	unpublished	-	-	Germline	-	-	-BsgI	-	-	DNA	DHPLC, SEQ	Blood	-	TSC	-	unpublished	variant is present in one parent and absent in the other parent	F	-	-	-	-	-	-	-	1	Rosemary Ekong
+/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Maternal (confirmed)	-	pathogenic	g.2137969_2138002del	g.2087968_2088001del	-	-	TSC2_000144	rare variant (see Roberts, 2003) described as disease-causing; 34bp intronic deletion [caggaaaggtagggccgggtggggccctgcagtg]; reported insertion of 24aa (wrong in table as 34aa); variant reported absent in 100 CEPH chrs; no other TSC variant found	PubMed: Niida, 1999	-	-	Germline	-	-	-BsgI	-	-	DNA	SSCA	Blood	-	TSC	Family 280	PubMed: Niida, 1999	unaffected mother has TSC2 c.c.5068+27_5069-47del and PCR results of mutant allele shows bands of equal intensity in affected child and unaffected mother	?	-	-	-	-	-	-	-	2	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	c.5051_5068+16del34 CCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG	-	TSC2_000144	34bp deletion [caggaaaggtagggccgggtggggccctgcagtg] reported as non-pathogenic; affects splicing; deleted allele produces less TSC2 mRNA compared to wild type; variant proposed to have modifier effect on severity of TSC	PubMed: Roberts, 2003	-	-	Germline	-	-	-BsgI	-	-	DNA, RNA	DHPLC, RT-PCR	Blood	-	TSC	Patient 4	PubMed: Roberts, 2003	2yr old; originally thought to be sporadic; same DNA change, without mosaicism, found in one unaffected parent; 3rd patient reported here without pathogenic variant found; low level mosaicism in TSC1 or TSC2 considered likely	?	-	-	-	-	-	-	-	2	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	c.5051_5068+16del34 [CCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG]	-	TSC2_000144	34bp deletion [caggaaaggtagggccgggtggggccctgcagtg] reported as non-pathogenic; affects splicing; deleted allele produces less TSC2 mRNA compared to wild type; variant proposed to have modifier effect on severity of TSC	PubMed: Roberts, 2003	-	-	Germline	-	-	-BsgI	-	-	DNA, RNA	DHPLC, RT-PCR	Blood	-	TSC	Patient 6	PubMed: Roberts, 2003	14yr old; originally thought to be sporadic; same DNA change, without mosaicism, found in one unaffected parent (not specified); 4th patient reported here where no pathogenic variant found; low level mosaicism in TSC1 or TSC2 considered likely	?	-	-	-	-	-	-	-	2	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	c.5051_5068+16del34 [CCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG]	-	TSC2_000144	34bp deletion [caggaaaggtagggccgggtggggccctgcagtg] reported as non-pathogenic; affects splicing; deleted allele produces less TSC2 mRNA compared to wild type; variant proposed to have modifier effect on severity of TSC phenotype	PubMed: Roberts, 2003	-	-	Germline	-	-	-BsgI	-	-	DNA, RNA	DHPLC, RT-PCR	Blood	-	TSC	Patient 3	PubMed: Roberts, 2003	6yr old; originally thought to be sporadic; same DNA change, without mosaicism, found in one unaffected parent (not specified); no pathogenic variant found in this patient possibly due to low level mosaicism in TSC1 or TSC2	?	-	-	-	-	-	-	-	2	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	c.5051_5068+16del34 [CCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG]	-	TSC2_000144	34bp deletion [caggaaaggtagggccgggtggggccctgcagtg] reported as non-pathogenic; affects splicing; deleted allele produces 50% less TSC2 mRNA; variant proposed to have modifier effect on TSC disease severity	PubMed: Roberts, 2003	-	-	Germline	-	-	-BsgI	-	-	DNA, RNA	DHPLC, RT-PCR	Blood	-	TSC	Patient 2	PubMed: Roberts, 2003	3yr old; originally thought to be sporadic; same DNA change and no mosaicism in unaffected parent (not specified); no pathogenic variant found in this patient possibly due to low level mosaicism in TSC1 or TSC2	?	-	-	-	-	-	-	-	2	Rosemary Ekong
+/.	39i	c.5068+27_5069-47del	r.[=, 5068_5069insGTAGGGCCGGGTGGGGCCCTGCAGTGTGGCGCCAAGAGCCCTGGGCCTGGCGTGACCACCAAGTCTCCCCAG]	p.Lys1689_Asp1690insGlyArgAlaGlyTrpGlyProAlaValTrpArgGlnGluProTrpAlaTrpArgAspHisGlnValSerPro	GAP domain	-	Unknown	-	pathogenic	g.2137969_2138002del	g.2087968_2088001del	IVS38+16del34bp	-	TSC2_000144	rare variant; affects splicing (see Roberts, 2003); reported as disease-causing; a normally duplicated 34bp tandem repeat deleted in intron 39; aberrant splicing said to cause retention of the remaining 72bp of intron 39 and insertion of novel 24aa	PubMed: Mayer, 1999	-	-	Germline	-	-	-	-	-	DNA, RNA	PTT	Blood	-	TSC	T87	PubMed: Mayer, 1999	22yr old patient	?	-	-	-	-	-	-	-	1	Rosemary Ekong
?/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	VUS	g.2137969_2138002del	g.2087968_2088001del	-	-	TSC2_000144	34bp intronic deletion (caggaaaggtagggccgggtggggccctgcagtg)	unpublished	-	-	Germline	-	-	-BsgI	-	-	DNA	DHPLC, SEQ	Blood	-	TSC	-	unpublished	both parents reported negative for the variant	F	-	-	-	-	-	-	-	1	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Maternal (confirmed)	-	benign	g.2137969_2138002del	g.2087968_2088001del	5068+27_5068+60del34	-	TSC2_000144	splice variant; 34bp deletion of intronic sequence (caggaaaggtagggccgggtggggccctgcagtg)	unpublished	-	-	Germline	-	-	-BsgI	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	proband reported to have a TSC1 mutation (not specified); variant inherited from one parent	?	-	-	-	-	-	-	-	2	Rosemary Ekong
-?/.	39i	c.5068+27_5069-47del	r.(?)	p.(=)	-	-	Unknown	-	likely benign	g.2137969_2138002del	-	c.5068+27_5069-47del34bp, intron 38	-	TSC2_000144	34bp intronic deletion of CAGGAAAGGTAGGGCCGGGTGGGGCCCTGCAGTG; found with TSC2 missense c.5094C>A and TSC2 missense c.4859A>G	unpublished	-	-	Germline	?	-	-	-	-	DNA	DHPLC, SEQ	Blood	Diagnostic testing	TSC	-	unpublished	No other family member tested	M	?	-	-	-	-	-	-	1	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.(?)	p.(=)	-	-	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	exon 38	-	TSC2_000144	34bp deletion of CAGGAAAGGTAGGGCCGGGTGGGGCCCTGCAGTG	unpublished	-	-	Germline	?	-	-	-	-	DNA	MCA, SEQ	Lung	-	-	-	unpublished	referral due to poorly differentiated squamous cell carcinoma; parents not tested	M	?	-	-	-	-	-	-	1	Rosemary Ekong
+/.	39i	c.5068+27_5069-47del	r.[=, 5068_5069insGTAGGGCCGGGTGGGGCCCTGCAGTGTGGCGCCAAGAGCCCTGGGCCTGGCGTGACCACCAAGTCTCCCCAG]	p.Lys1689_Asp1690insGlyArgAlaGlyTrpGlyProAlaValTrpArgGlnGluProTrpAlaTrpArgAspHisGlnValSerPro	GAP domain	-	Maternal (confirmed)	-	pathogenic	g.2137969_2138002del	g.2087968_2088001del	IVS38+16del34bp	-	TSC2_000144	rare variant; affects splicing (see Roberts, 2003); reported as disease-causing; a normally duplicated 34bp tandem repeat deleted in intron 39; aberrant splicing said to cause retention of the remaining 72bp of intron 39 and insertion of novel 24aa	PubMed: Mayer, 1999	-	-	Germline	-	-	-	-	-	DNA, RNA	PTT	Blood	-	TSC	T65	PubMed: Mayer, 1999	5 yr old patient with clinically confirmed TSC but no features indicated; patient and mildly affected mother have the same variant	?	-	-	-	-	-	-	-	2	Rosemary Ekong
+/.	39i	c.5068+27_5069-47del	r.[=, 5068_5069insGTAGGGCCGGGTGGGGCCCTGCAGTGTGGCGCCAAGAGCCCTGGGCCTGGCGTGACCACCAAGTCTCCCCAG]	p.Lys1689_Asp1690insGlyArgAlaGlyTrpGlyProAlaValTrpArgGlnGluProTrpAlaTrpArgAspHisGlnValSerPro	GAP domain	-	Unknown	-	pathogenic	g.2137969_2138002del	g.2087968_2088001del	IVS38+16del34bp	-	TSC2_000144	rare variant; affects splicing (see Roberts, 2003); reported as disease-causing; a normally duplicated 34bp tandem repeat deleted in intron 39; aberrant splicing said to cause retention of the remaining 72bp of intron 39 and insertion of novel 24aa	PubMed: Mayer, 1999	-	-	Germline	-	-	-BsgI	-	-	DNA, RNA	PTT	Blood	-	TSC	T33	PubMed: Mayer, 1999	3yr old patient	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Paternal (confirmed)	-	benign	g.2137969_2138002del	g.2087968_2088001del	34bp del; 5051-5068+16delCCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG	-	TSC2_000144	rare variants; affects splicing; normal 34bp tandem repeat [caggaaaggtagggccgggtggggccctgcagtg] deleted in intron 39; 72bp intronic seq added resulting in novel 24aa insertion; less TSC2 mRNA produced; variant suggested to modify severity of TSC	PubMed: Beauchamp, 1998, PubMed: Roberts, 2003	-	-	Germline	-	-	-	-	-	DNA	DHPLC	Blood	-	TSC	S12-01/Pat. 5	PubMed: Beauchamp, 1998, PubMed: Roberts, 2003	6yr old; same patient reported in both papers; patient has TSC2 intronic variant c.5068+27_5069-47del and TSC2 pathogenic missense c.2086T>C found later; TSC2 c.5068+27_5069-47del, without mosaicism, also found in unaffected father; TSC2 c.2086T>C absent in both parents	M	-	-	-	-	-	-	-	1	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	benign	g.2137969_2138002del	g.2087968_2088001del	c.5051_5068+16del34 [CCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG]	-	TSC2_000144	34bp del [caggaaaggtagggccgggtggggccctgcagtg] non-pathogenic splice variant initially reported pathogenic; seen with TSC2 c.2713C>T; aberrant cDNA retains intron 39; deleted allele produces 50% less TSC2 mRNA; variant proposed to modify TSC severity	PubMed: Dabora, 2001, PubMed: Franz, 2001, PubMed: Roberts, 2003	-	-	Germline	-	-	-	-	-	DNA	DHPLC	Blood	-	TSC	BHM6101/P1	PubMed: Dabora, 2001, PubMed: Franz, 2001, PubMed: Roberts, 2003	21-22yr old patient with clinical diagnosis of TS and asymptomatic lung disease; no FH of TS; no active pulmonary symptoms or suspected diagnosis of LAM on initial presentation; patient had not received specific therapy for LAM; patient has TSC2 intronic variant c.5068+27_5069-47del and TSC2 pathogenic missense c.2713C>T found later; one unaffected parent (not specified) has TSC2 c.5068+27_5069-47del and no evidence of mosaicism; TSC2 c.2713C>T absent in both parents	F	-	-	-	-	-	-	-	1	Rosemary Ekong
-/.	39i	c.5068+27_5069-47del	r.[=, 5068_5069insGTAGGGCCGGGTGGGGCCCTGCAGTGTGGCGCCAAGAGCCCTGGGCCTGGCGTGACCACCAAGTCTCCCCAG]	p.Lys1689_Asp1690insGlyArgAlaGlyTrpGlyProAlaValTrpArgGlnGluProTrpAlaTrpArgAspHisGlnValSerPro	GAP domain	-	Maternal (confirmed)	-	benign	g.2137969_2138002del	g.2087968_2088001del	5068+27_5068+60del34, p.Lys1689_Met1690ins24	-	TSC2_000144	splice variant; 34bp deletion of intronic sequence (caggaaaggtagggccgggtggggccctgcagtg); RNA evidence with 50% abnormal splicing and 50% normal splicing; retention of 72bp of intron 39 seen in cDNA resulting in in-frame insertion of 24 new aa	unpublished	-	-	Germline	-	-	-	-	-	DNA, RNA	SEQ	Blood	-	Healthy/Control	-	unpublished	variant found in an unaffected parent and inherited by an affected child (sibling of the proband); this affected child (sibling of the proband) has also inherited TSC2 c.1853_1946+59dup from the affected parent; TSC2 c.5068+27_5069-47del is absent in the proband of this family; splicing also seen in the healthy parent; RNA from 6/6 families tested	?	-	-	-	-	-	-	-	2	Rosemary Ekong
?/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Unknown	-	VUS	g.2137969_2138002del	g.2087968_2088001del	IVS38+27_IVS38+60 34bp deletion	-	TSC2_000144	splice variant; 34bp deletion of intronic sequence (caggaaaggtagggccgggtggggccctgcagtg); no variants detected in TSC1 & TSC2 MLPA	unpublished	-	-	Germline	-	-	-	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	index has no family history of TS; reported to have possible cortical tuber or focal cortical dysplasia on brain MRI, possible Shagreen patch, ?angiofibroma on one side of nose and 1 hypomelanotic macule; this patient has normal renal MRI, no cardiac findings, no neuro-opthamologic findings, no history of seizures and no developmental delay; no other family members have been tested	M	-	-	-	-	-	-	-	1	Rosemary Ekong
?/.	39i	c.5068+27_5069-47del	r.spl	p.?	GAP domain	-	Maternal (confirmed)	-	VUS	g.2137969_2138002del	g.2087968_2088001del	-	-	TSC2_000144	34bp intronic deletion (caggaaaggtagggccgggtggggccctgcagtg); found with TSC2 in-frame deletion c.1283_1285del	unpublished	-	-	Germline	-	-	-BsgI	-	-	DNA	DHPLC, SEQ	Blood	-	TSC	-	unpublished	proband has TSC2 in-frame deletion c.1283_1285del and TSC2 intronic deletion c.5068+27_5069-47del; one parent, a grandparent and another relative all have these 2 variants and are affected; the other parent has an affected distant relative who has a different apparently de novo TSC1 variant (not specified); inheritance of TSC2 c.5068+27_5069-47del not indicated	M	-	-	-	-	-	-	-	4	Rosemary Ekong

Legend

How to query

Assessment of functional consequences - Our conclusions on the functional consequences of variants are based on the type of variant, results of in vitro functional tests (doi: 10.1002/humu.21451; doi: 10.1002/humu.22202; doi: 10.1002/humu.23963), population frequencies, output from in silico splice site prediction algorithms, and any clinical/family data available to us. We also have output from protein prediction programs in this database for comparison purposes and they are not considered in our assessment of pathogenicity. PolyPhen Predictions - Note that these results are from PolyPhen-2 and only the HumDiv classification is shown.

Global Variome shared LOVD

TSC2 (tuberous sclerosis 2)