growth factor, augmenter of liver regeneration (GFER) - coding DNA reference sequence

(used for variant description)

(last modified June 17, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_005262.2 in the GFER gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016288.1, covering GFER transcript NM_005262.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5010
                                                   gctggcctgg       c.-61

 .         .         .         .         .         .                g.5070
 aggctgacctggaggctcatctggaggccgagctgacccggcaggccttgcgcgggcaac       c.-1

          .         .         .         .         .         .       g.5130
 ATGGCGGCGCCCGGCGAGCGGGGCCGCTTCCACGGCGGGAACCTCTTCTTCCTGCCGGGG       c.60
 M  A  A  P  G  E  R  G  R  F  H  G  G  N  L  F  F  L  P  G         p.20

          .         .         .         .         .         .       g.5190
 GGCGCGCGCTCCGAGATGATGGACGACCTGGCGACCGACGCGCGGGGCCGGGGCGCGGGG       c.120
 G  A  R  S  E  M  M  D  D  L  A  T  D  A  R  G  R  G  A  G         p.40

          .         .         .         .         .         .       g.5250
 CGGAGAGACGCGGCCGCCTCGGCCTCGACGCCAGCCCAGGCGCCGACCTCCGATTCTCCT       c.180
 R  R  D  A  A  A  S  A  S  T  P  A  Q  A  P  T  S  D  S  P         p.60

          .         .         .         .         .         .       g.5310
 GTCGCCGAGGACGCCTCCCGGAGGCGGCCGTGCCGGGCCTGCGTCGACTTCAAGACGTGG       c.240
 V  A  E  D  A  S  R  R  R  P  C  R  A  C  V  D  F  K  T  W         p.80

          .         | 02         .         .         .         .    g.5640
 ATGCGGACGCAGCAGAAG | CGGGACACCAAGTTTAGGGAGGACTGCCCGCCGGATCGCGAG    c.300
 M  R  T  Q  Q  K   | R  D  T  K  F  R  E  D  C  P  P  D  R  E      p.100

          .         .         .         .         .         .       g.5700
 GAACTGGGCCGCCACAGCTGGGCTGTCCTCCACACCCTGGCCGCCTACTACCCCGACCTG       c.360
 E  L  G  R  H  S  W  A  V  L  H  T  L  A  A  Y  Y  P  D  L         p.120

          .         .         .         .         .         .       g.5760
 CCCACCCCAGAACAGCAGCAAGACATGGCCCAGTTCATACATTTATTTTCTAAGTTTTAC       c.420
 P  T  P  E  Q  Q  Q  D  M  A  Q  F  I  H  L  F  S  K  F  Y         p.140

          .         .         .      | 03  .         .         .    g.6742
 CCCTGTGAGGAGTGTGCTGAAGACCTAAGAAAAAG | GCTGTGCAGGAACCACCCAGACACC    c.480
 P  C  E  E  C  A  E  D  L  R  K  R  |  L  C  R  N  H  P  D  T      p.160

          .         .         .         .         .         .       g.6802
 CGCACCCGGGCATGCTTCACACAGTGGCTGTGCCACCTGCACAATGAAGTGAACCGCAAG       c.540
 R  T  R  A  C  F  T  Q  W  L  C  H  L  H  N  E  V  N  R  K         p.180

          .         .         .         .         .         .       g.6862
 CTGGGCAAGCCTGACTTCGACTGCTCAAAAGTGGATGAGCGCTGGCGCGACGGCTGGAAG       c.600
 L  G  K  P  D  F  D  C  S  K  V  D  E  R  W  R  D  G  W  K         p.200

          .                                                         g.6880
 GATGGCTCCTGTGACTAG                                                 c.618
 D  G  S  C  D  X                                                   p.205

          .         .         .         .         .         .       g.6940
 agggtggtcagccagagctcatgggacagctagccaggcatggttggataggggcagggc       c.*60

          .         .         .         .         .         .       g.7000
 actcattaaagtgcatcacagccagagcctgttgtgtctcagttgggtggtccccaggac       c.*120

          .         .         .         .         .         .       g.7060
 actgcctgtggggacctgccctgcccctcttaggtttggagcagaagtggaggtgcccac       c.*180

          .         .         .         .         .         .       g.7120
 agcaggtacccactggccccctcctcagtggagaccccaaggagctgcagctgaactgca       c.*240

          .         .         .         .         .         .       g.7180
 ggggagggaaggaggagcagcctgggctgccccttgacattcaggatgtagcttcctgcc       c.*300

          .         .         .         .         .         .       g.7240
 caccgcataccctggcgcctcactcctcacacgggaagacagcgggcctggctgggcatc       c.*360

          .         .         .         .         .         .       g.7300
 cctgtgcctgtccctggcggccaggccattgccttcccactatgcagccagggatgcccc       c.*420

          .         .         .         .         .         .       g.7360
 tgccccccatggctctgtgctgctcactttagggggctcaattctccactctgctcagtc       c.*480

          .         .         .         .         .         .       g.7420
 cctacagggaaagctcaggtcgggtctttctgagggtccaccagccatcctaccctctcc       c.*540

          .         .         .         .         .         .       g.7480
 ctgcctggcacatgcctgccagcgttgtgtcatgcctgtccacaggggattcgtggggct       c.*600

          .         .         .         .         .         .       g.7540
 cacttcatcagagtttgaagcccaaatgaaacgctgaagtgactgagaacctggcttcag       c.*660

          .         .         .         .         .         .       g.7600
 tatattttctgctggggcttaataaagcagtagacagggcttgttccatccctctgtgct       c.*720

          .         .         .         .         .         .       g.7660
 cagctgcatttcctgctggggtcctggttcctcaggagagagagaccacagggtgagagt       c.*780

          .         .         .         .         .         .       g.7720
 gagccaggaacagcaaggacgttgattggttggggcaggggggccagagtagctgatgta       c.*840

          .         .         .         .         .         .       g.7780
 ggagtactgggaggccagacggcacgaggtctccaaggccccagcaaagccatggcttct       c.*900

          .         .         .         .         .         .       g.7840
 acccctagttcccctgacaggaagttcttggcgggtttggagccaggggatggcatggag       c.*960

          .         .         .         .         .         .       g.7900
 tgatgtggctttgaagggtcctctggctgctgagctgggatgaggcaggtaagggtggaa       c.*1020

          .         .         .         .         .         .       g.7960
 caggaggggtggggaggaagccggggcagtcaccgagtgaccaccaagaggaagacccac       c.*1080

          .         .         .         .         .         .       g.8020
 cccacggcggggacagatgcggggtacgttaaagggagagccagagaactcatggggtga       c.*1140

          .         .         .         .         .         .       g.8080
 ggatggagtccgaggagactgctgggagccgccgtgtgggtcagagatggagaaggctga       c.*1200

          .         .         .         .         .         .       g.8140
 gtgcagcaaggtggggggtgactgggacccagcctttgggcctccccagccagagcagcc       c.*1260

          .         .         .         .         .         .       g.8200
 cagcaacagtgtgtcctgtggtcataaaactccagggacctctatcctccaggagtctca       c.*1320

          .         .         .         .         .         .       g.8260
 gcctttccctgggcgcaggcccaccttggcatggccgcctcaggcctccatggagggagc       c.*1380

          .         .         .         .         .         .       g.8320
 tgctatgtccccaccagattggccccgtgcggctgctggcttctgtagaggctgcccaga       c.*1440

          .         .         .         .         .         .       g.8380
 ggggccaggtggcacaaataagagaggggagatggggggcagccaggagaggaggtgtcc       c.*1500

          .         .         .         .         .         .       g.8440
 cttcctcgcccagacacagcgcgcttctctctggcctttcccgaggcctgtgagtgcctc       c.*1560

          .         .         .         .         .         .       g.8500
 aggaagcagctgggccctctgggaaggctgtgttcagcttaggaacataccgcctgtatc       c.*1620

          .         .         .         .         .         .       g.8560
 tgctgtccctcccctgcccccctgccccccccaccgccttccctttttccctgtcttcct       c.*1680

          .         .         .         .                           g.8601
 taaagtttcactcctgaataaaacttcactttgccttagaa                          c.*1721

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Growth factor, augmenter of liver regeneration protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.