leucine rich repeat and sterile alpha motif containing 1 (LRSAM1) - coding DNA reference sequence

(used for variant description)

(last modified January 23, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_138361.5 in the LRSAM1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032008.1, covering LRSAM1 transcript NM_138361.5.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5031
                              agagacgcccttgtcgccatgtttgttgtgg       c.-601

 .         .         .         .         .         .                g.5091
 gcaggcgcctgaggctgacggctggcaagcagggcaccgcggtgcgctgaagctagagat       c.-541

 .         .         .         .         .         .                g.5151
 tccgaaagggggttcgggtagttcgctccggagaagtctgagaagggtggctccggtgat       c.-481

 .         .         .         .         .         .                g.5211
 cccagccctagctgtttcccatattcctttatcgtgagtgtcaccccggtccccgtcacc       c.-421

 .         .         .         .         .         .                g.5271
 caatcccagagccccgcccctcccctgaggggtccgtagtcccattccgagaccccagta       c.-361

 .         .         .         .         .         .                g.5331
 ccgcggcgacccctgctccctcgagcacttgttgtgtgcactttagttatcaaaacagtc       c.-301

 .         .         .         .         .         .                g.5391
 tatgtggaaatccagtcccgctcttcattcggagagtccgcgattcctagagcctcagac       c.-241

 .         .         .         .         .         .                g.5451
 ttcgtcatcccggtctgcgtgactttatgagattctgagtttctgttcccagcacctgcc       c.-181

 .         .         .         .         .         .                g.5511
 tttgaaggagaccagactccggctccgcccggcccgtgccgggtggtctgcggccccgag       c.-121

 .         .         .         .         .         .                g.5571
 tccgtgaccaagccctccgagtgatcggcctgccctcgggtgcacccgcgggtcccaacg       c.-61

 .         .         .        | 02.         .         .             g.8042
 tgggggatccctccatccgcaaagccag | ggtcctaaagatcgctctgggaaaagggaagg    c.-1

          .         .         .         .         .         .       g.8102
 ATGCCGCTCTTCTTCCGGAAGCGGAAACCCAGTGAGGAGGCTCGGAAACGCCTGGAGTAC       c.60
 M  P  L  F  F  R  K  R  K  P  S  E  E  A  R  K  R  L  E  Y         p.20

          .   | 03     .         .         .         .         .    g.8560
 CAGATGTGTTTG | GCAAAAGAAGCTGGGGCAGATGACATTCTCGACATCTCTAAATGTGAG    c.120
 Q  M  C  L   | A  K  E  A  G  A  D  D  I  L  D  I  S  K  C  E      p.40

           | 04        .         .         .         .     | 05   . g.10836
 CTCTCAGAG | ATTCCATTTGGAGCTTTTGCAACATGCAAAGTTCTGCAGAAGAAG | GTGCTG c.180
 L  S  E   | I  P  F  G  A  F  A  T  C  K  V  L  Q  K  K   | V  L   p.60

          .         .         .         .         .         .       g.10896
 ATCGTCCACACGAATCACCTCACTTCCCTGCTTCCCAAATCCTGCAGCCTCCTGAGTCTG       c.240
 I  V  H  T  N  H  L  T  S  L  L  P  K  S  C  S  L  L  S  L         p.80

          .   | 06     .         .         .         .         .    g.12565
 GCAACCATCAAG | GTTCTAGATCTCCACGATAATCAGCTGACAGCCCTTCCTGACGATCTG    c.300
 A  T  I  K   | V  L  D  L  H  D  N  Q  L  T  A  L  P  D  D  L      p.100

          .         .  | 07      .         .         .         .    g.14726
 GGGCAGCTGACTGCCCTCCAG | GTCTTAAACGTGGAAAGGAATCAACTGATGCAGCTCCCA    c.360
 G  Q  L  T  A  L  Q   | V  L  N  V  E  R  N  Q  L  M  Q  L  P      p.120

          .         .         .         .       | 08 .         .    g.15780
 CGTTCCATTGGGAACCTGACCCAGCTCCAGACTCTCAATGTTAAAG | ACAACAAGCTGAAG    c.420
 R  S  I  G  N  L  T  Q  L  Q  T  L  N  V  K  D |   N  K  L  K      p.140

          .         .         .         .         .         .       g.15840
 GAGCTTCCAGACACCGTGGGGGAGCTTCGAAGCCTGCGTACCCTCAACATCAGTGGAAAC       c.480
 E  L  P  D  T  V  G  E  L  R  S  L  R  T  L  N  I  S  G  N         p.160

          .         .         .         .         | 09         .    g.21266
 GAGATCCAGAGATTGCCGCAGATGCTGGCTCACGTTCGAACCCTGGAG | ATGCTGAGCCTT    c.540
 E  I  Q  R  L  P  Q  M  L  A  H  V  R  T  L  E   | M  L  S  L      p.180

          .         .         .         .         .         .       g.21326
 GACGCCTCGGCCATGGTCTACCCGCCGCGGGAGGTGTGTGGTGCCGGCACTGCGGCCATC       c.600
 D  A  S  A  M  V  Y  P  P  R  E  V  C  G  A  G  T  A  A  I         p.200

          .          | 10        .         .         .         .    g.27356
 TTGCAGTTCCTCTGCAAAG | AGTCAGGGCTGGAATACTACCCCCCTTCTCAGTACTTGCTG    c.660
 L  Q  F  L  C  K  E |   S  G  L  E  Y  Y  P  P  S  Q  Y  L  L      p.220

          .         .         .         .         .         .       g.27416
 CCAATTCTGGAGCAAGATGGAATCGAGAACTCTCGGGACAGCCCTGATGGGCCCACGGAC       c.720
 P  I  L  E  Q  D  G  I  E  N  S  R  D  S  P  D  G  P  T  D         p.240

          .         .         . | 11       .         .         .    g.32478
 AGATTCTCAAGGGAGGAGTTAGAGTGGCAG | AACAGGTTCTCAGACTATGAGAAGAGGAAG    c.780
 R  F  S  R  E  E  L  E  W  Q   | N  R  F  S  D  Y  E  K  R  K      p.260

  | 12       .         .         .         .         .         .    g.32957
  | GAACAGAAGATGCTGGAGAAACTCGAGTTTGAACGGCGCCTGGAACTGGGGCAGCGGGAG    c.840
  | E  Q  K  M  L  E  K  L  E  F  E  R  R  L  E  L  G  Q  R  E      p.280

          .         .         .         .         .         .       g.33017
 CACACCCAGCTCCTTCAGCAGAGCAGCAGCCAGAAGGATGAGATCCTTCAGACGGTCAAG       c.900
 H  T  Q  L  L  Q  Q  S  S  S  Q  K  D  E  I  L  Q  T  V  K         p.300

     | 13    .         .         .         .         .         .    g.33410
 GAG | GAGCAGTCCCGGCTGGAGCAGGGCCTGAGTGAGCACCAGCGCCACCTCAACGCAGAG    c.960
 E   | E  Q  S  R  L  E  Q  G  L  S  E  H  Q  R  H  L  N  A  E      p.320

          .         .         .         .         .         .       g.33470
 CGGCAGCGGCTGCAGGAGCAGCTGAAGCAGACGGAACAGAACATTTCCAGCCGGATCCAG       c.1020
 R  Q  R  L  Q  E  Q  L  K  Q  T  E  Q  N  I  S  S  R  I  Q         p.340

          .         .    | 14    .         .         .         .    g.34734
 AAGCTGCTGCAGGACAATCAGAG | ACAAAAGAAAAGCTCCGAGATTTTGAAATCGCTGGAA    c.1080
 K  L  L  Q  D  N  Q  R  |  Q  K  K  S  S  E  I  L  K  S  L  E      p.360

          | 15         .         .         .         .         .    g.36516
 AATGAAAG | AATAAGAATGGAACAGTTGATGTCCATAACCCAGGAGGAGACTGAGAGCCTG    c.1140
 N  E  R  |  I  R  M  E  Q  L  M  S  I  T  Q  E  E  T  E  S  L      p.380

          .          | 16        .         .         .         .    g.39291
 CGGCGACGTGACGTTGCCT | CCGCCATGCAGCAGATGCTGACTGAGAGCTGTAAGAACCGG    c.1200
 R  R  R  D  V  A  S |   A  M  Q  Q  M  L  T  E  S  C  K  N  R      p.400

          .         .         .         .         .          | 17    g.41191
 CTCATCCAGATGGCCTACGAATCTCAGAGGCAGAACTTGGTCCAGCAGGCCTGTTCCAG | C    c.1260
 L  I  Q  M  A  Y  E  S  Q  R  Q  N  L  V  Q  Q  A  C  S  S  |      p.420

          .         .         .         .         .         .       g.41251
 ATGGCCGAAATGGATGAACGATTCCAGCAGATTCTGTCGTGGCAGCAAATGGATCAGAAC       c.1320
 M  A  E  M  D  E  R  F  Q  Q  I  L  S  W  Q  Q  M  D  Q  N         p.440

          .         .        | 18.         .         .         .    g.42991
 AAAGCCATCAGCCAGATCCTGCAGGAG | AGCGCGATGCAGAAGGCTGCGTTCGAGGCACTC    c.1380
 K  A  I  S  Q  I  L  Q  E   | S  A  M  Q  K  A  A  F  E  A  L      p.460

          .         .         .         .   | 19     .         .    g.44747
 CAGGTGAAGAAAGACCTGATGCATCGGCAGATCAGGAGCCAG | ATTAAGTTAATAGAAACT    c.1440
 Q  V  K  K  D  L  M  H  R  Q  I  R  S  Q   | I  K  L  I  E  T      p.480

          .         .         .         .         .         .       g.44807
 GAGTTATTGCAGCTGACACAGCTGGAGTTAAAGAGGAAGTCCCTGGACACAGAGTCACTC       c.1500
 E  L  L  Q  L  T  Q  L  E  L  K  R  K  S  L  D  T  E  S  L         p.500

     | 20    .         .         .         .         .         .    g.46373
 CAG | GAGATGATCTCGGAGCAGCGCTGGGCCCTCAGCTCCCTGCTCCAGCAGCTGCTCAAA    c.1560
 Q   | E  M  I  S  E  Q  R  W  A  L  S  S  L  L  Q  Q  L  L  K      p.520

          .         .         .          | 21        .         .    g.48855
 GAGAAGCAGCAGCGAGAGGAAGAGCTCCGGGAAATCCTG | ACGGAGTTAGAAGCCAAAAGT    c.1620
 E  K  Q  Q  R  E  E  E  L  R  E  I  L   | T  E  L  E  A  K  S      p.540

          .         .         .         .         .         .       g.48915
 GAAACCAGGCAGGAAAATTACTGGCTGATTCAGTATCAACGGCTTTTGAACCAGAAGCCC       c.1680
 E  T  R  Q  E  N  Y  W  L  I  Q  Y  Q  R  L  L  N  Q  K  P         p.560

          .         | 22         .         .         .         .    g.49520
 TTGTCCTTGAAGCTGCAA | GAAGAGGGGATGGAGCGCCAGCTGGTGGCCCTCCTGGAGGAG    c.1740
 L  S  L  K  L  Q   | E  E  G  M  E  R  Q  L  V  A  L  L  E  E      p.580

          .         .         .         .         .         .       g.49580
 CTGTCGGCTGAGCACTACCTGCCCATCTTTGCGCACCACCGCCTCTCACTGGACCTGCTG       c.1800
 L  S  A  E  H  Y  L  P  I  F  A  H  H  R  L  S  L  D  L  L         p.600

          .         .         . | 23       .         .         .    g.50797
 AGCCAAATGAGCCCAGGGGACCTGGCCAAG | GTGGGCGTCTCAGAAGCTGGCCTGCAGCAC    c.1860
 S  Q  M  S  P  G  D  L  A  K   | V  G  V  S  E  A  G  L  Q  H      p.620

          .         .         .         .         .   | 24     .    g.54532
 GAGATCCTCCGGAGAGTCCAGGAACTGCTGGATGCAGCCAGGATCCAGCCAG | AGCTGAAA    c.1920
 E  I  L  R  R  V  Q  E  L  L  D  A  A  R  I  Q  P  E |   L  K      p.640

          .         .         .         .         .         .       g.54592
 CCACCAATGGGTGAGGTCGTCACCCCTACGGCCCCCCAGGAGCCTCCTGAGTCTGTGAGG       c.1980
 P  P  M  G  E  V  V  T  P  T  A  P  Q  E  P  P  E  S  V  R         p.660

          .         .         .         .         .         .       g.54652
 CCATCCGCTCCCCCTGCAGAGCTGGAGGTGCAGGCCTCAGAGTGTGTCGTGTGCCTGGAA       c.2040
 P  S  A  P  P  A  E  L  E  V  Q  A  S  E  C  V  V  C  L  E         p.680

        | 25 .         .         .         .         .         .    g.56342
 CGGGAG | GCCCAGATGATCTTCCTCAACTGTGGCCACGTCTGCTGCTGCCAGCAGTGCTGC    c.2100
 R  E   | A  Q  M  I  F  L  N  C  G  H  V  C  C  C  Q  Q  C  C      p.700

          .         .         .         .         .         .       g.56402
 CAGCCACTGCGCACCTGCCCGCTGTGCCGCCAGGACATCGCCCAGCGCCTCCGCATCTAC       c.2160
 Q  P  L  R  T  C  P  L  C  R  Q  D  I  A  Q  R  L  R  I  Y         p.720

          .                                                         g.56414
 CACAGCAGCTGA                                                       c.2172
 H  S  S  X                                                         p.723

          .         .         .         .         .         .       g.56474
 gtgctgcccgcccacctgggcctggtcctagccctgcctcggccactgtgagccccgggc       c.*60

          .         .         .         .         .         .       g.56534
 tcctgctcagccttgtgccagccagactcgtatgaggctcccccctgccctgggcccctt       c.*120

          .         .         .         .         .         .       g.56594
 ccccactgcccaggagcccccatcctaagctccaagcatgtctgggccaggcagaggtgc       c.*180

          .         .         .         .         .         .       g.56654
 tcctcatccatgacaccaccagtctgaatggtcctgggggctggggctggagaggccgct       c.*240

          .         .         .         .         .         .       g.56714
 gcaccaccacccgagcctgggagccagcgtcccagcctaatcacggatctgctgcctccc       c.*300

          .         .         .         .         .         .       g.56774
 agctgtcttgactgaaggccaccgcccctgcaggagcttgggtcctcatctgggggccat       c.*360

          .         .         .         .         .         .       g.56834
 gcacaggcccgtcccaccctgcatgtgggaagggagcaggagggcctggctgggtgaggg       c.*420

          .         .         .         .         .         .       g.56894
 gaggccttcctgggaaggcgtgtggtgcaggcctgtgctcacagtggcaccagcaaccct       c.*480

          .         .         .         .         .         .       g.56954
 gggtctccctctctgctgctccccagaaccccggggccctcctgctctccacaactgtcc       c.*540

          .         .         .         .         .         .       g.57014
 ctccttaccccatgtagctcgatccgaagcaggagtgtcaataaacctgtcttcagtgcg       c.*600

                                                                    g.57016
 ct                                                                 c.*602

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Leucine rich repeat and sterile alpha motif containing 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21b
©2004-2019 Leiden University Medical Center