major intrinsic protein of lens fiber (MIP) - coding DNA reference sequence

(used for variant description)

(last modified April 16, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_012064.3 in the MIP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_021397.1, covering MIP transcript NM_012064.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5038
                       gtagcagggacccaggcactgtgaccatcccccctgcc       c.-1

          .         .         .         .         .         .       g.5098
 ATGTGGGAACTGCGATCAGCCTCCTTTTGGAGGGCCATATTCGCTGAGTTCTTTGCCACC       c.60
 M  W  E  L  R  S  A  S  F  W  R  A  I  F  A  E  F  F  A  T         p.20

          .         .         .         .         .         .       g.5158
 CTCTTCTATGTCTTCTTTGGGCTGGGGTCCTCACTGCGCTGGGCTCCTGGACCCCTGCAT       c.120
 L  F  Y  V  F  F  G  L  G  S  S  L  R  W  A  P  G  P  L  H         p.40

          .         .         .         .         .         .       g.5218
 GTTCTGCAGGTGGCTATGGCATTTGGCTTGGCCCTGGCTACACTGGTGCAGTCTGTGGGC       c.180
 V  L  Q  V  A  M  A  F  G  L  A  L  A  T  L  V  Q  S  V  G         p.60

          .         .         .         .         .         .       g.5278
 CACATCAGTGGAGCCCACGTCAATCCTGCAGTCACTTTTGCTTTCCTTGTGGGCTCCCAG       c.240
 H  I  S  G  A  H  V  N  P  A  V  T  F  A  F  L  V  G  S  Q         p.80

          .         .         .         .         .         .       g.5338
 ATGTCCCTGCTCCGTGCCTTCTGCTATATGGCAGCCCAGCTCCTGGGAGCTGTGGCTGGG       c.300
 M  S  L  L  R  A  F  C  Y  M  A  A  Q  L  L  G  A  V  A  G         p.100

          .         .         .         .         .         .       g.5398
 GCCGCTGTGCTGTATAGCGTTACCCCACCTGCTGTCCGAGGAAACCTAGCACTCAACACG       c.360
 A  A  V  L  Y  S  V  T  P  P  A  V  R  G  N  L  A  L  N  T         p.120

  | 02       .         .         .         .         .         .    g.5956
  | TTGCACCCTGCGGTGAGCGTGGGCCAGGCAACCACAGTGGAGATCTTCCTGACGCTCCAG    c.420
  | L  H  P  A  V  S  V  G  Q  A  T  T  V  E  I  F  L  T  L  Q      p.140

          .         .         .         .         .         .       g.6016
 TTCGTGCTCTGCATCTTTGCCACATACGACGAGAGGCGGAATGGCCAACTGGGCTCCGTG       c.480
 F  V  L  C  I  F  A  T  Y  D  E  R  R  N  G  Q  L  G  S  V         p.160

          .         .         .         .      | 03  .         .    g.6514
 GCCCTGGCCGTTGGCTTCTCCCTTGCCCTGGGGCACCTCTTTGGG | ATGTATTATACTGGT    c.540
 A  L  A  V  G  F  S  L  A  L  G  H  L  F  G   | M  Y  Y  T  G      p.180

          .         .         .         .         .         .       g.6574
 GCAGGCATGAATCCTGCCCGCTCCTTTGCTCCTGCCATTCTCACTGGGAACTTCACTAAC       c.600
 A  G  M  N  P  A  R  S  F  A  P  A  I  L  T  G  N  F  T  N         p.200

        | 04 .         .         .         .         .         .    g.8240
 CACTGG | GTGTACTGGGTAGGCCCAATCATTGGAGGGGGTCTGGGCAGCCTCCTGTACGAC    c.660
 H  W   | V  Y  W  V  G  P  I  I  G  G  G  L  G  S  L  L  Y  D      p.220

          .         .         .         .         .         .       g.8300
 TTTCTTCTCTTCCCCCGGCTCAAGAGTATTTCTGAGAGACTGTCTGTCCTCAAGGGTGCC       c.720
 F  L  L  F  P  R  L  K  S  I  S  E  R  L  S  V  L  K  G  A         p.240

          .         .         .         .         .         .       g.8360
 AAACCCGATGTCTCCAATGGACAACCAGAGGTCACAGGGGAACCTGTTGAACTGAACACC       c.780
 K  P  D  V  S  N  G  Q  P  E  V  T  G  E  P  V  E  L  N  T         p.260

          .                                                         g.8372
 CAGGCCCTGTAG                                                       c.792
 Q  A  L  X                                                         p.263

          .         .         .         .         .         .       g.8432
 aagctccagctgaatagagggagtagaaagcttctgagtttacgtggaggggtttagcca       c.*60

          .         .         .         .         .         .       g.8492
 gcccctagatgaagaaagagactgtggggagggtcatgtacttctttattttttaactta       c.*120

          .         .         .         .         .         .       g.8552
 tgtatgtggttgttttttttttttttttccttttgctgtgtgaaatctttcaagttgcat       c.*180

          .         .         .         .         .         .       g.8612
 tcatgagctggttggtgcaaacttcccttcctccccatcccaccacccttcgccgtgtgt       c.*240

          .         .         .         .         .         .       g.8672
 gctgattgtgcatatgaatgtgagtgtggctgtgtctgagttttggggcatgagagctaa       c.*300

          .         .         .         .         .         .       g.8732
 ggaagcaaaaagaggtgccatcctatacctcccttcctcgacccagtatggtgagtactg       c.*360

          .         .         .         .         .         .       g.8792
 ggtaaccgacaccttaagtttctggcctttaccctgctgccagtcaagtgtgtggctctt       c.*420

          .         .         .         .         .         .       g.8852
 gatttctgagggaacagagaagcagggagttactcctcacacgaggcagatggagagaag       c.*480

          .         .         .         .         .         .       g.8912
 tggaggagacaaggcttccaagggttaggagaagggactcaagggaggtgggtggtgaaa       c.*540

          .         .         .         .         .         .       g.8972
 acggagtattagccccagatcaggatgtaggtgtaccgaagaattggggggaagttaatg       c.*600

          .         .         .         .         .         .       g.9032
 ggaatatatagcctacttatcttagggatgcttgccccagggacttgggtggggaagtag       c.*660

          .         .         .         .         .         .       g.9092
 ctctgagaaaagtgaacactaggatttagctgttctgtaaagccacgtaaacctgtctac       c.*720

          .         .         .         .         .         .       g.9152
 atccgctggctggttgtgttcattctgacataatggatctcttcagaggtcctgggccaa       c.*780

          .         .         .         .         .         .       g.9212
 agagcttccaacctaaatagagcttgggcaagcctagaatctagaaaaattaagcagctt       c.*840

          .         .         .         .         .         .       g.9272
 aactggtcagcctgacatccactgttgtggctgcctggcagatggtatttaagccccaca       c.*900

          .         .         .         .         .         .       g.9332
 attgttccctaaggccaacacaggaaatctgattcctggagcaaataaatgaacgggtgg       c.*960

          .         .         .         .         .         .       g.9392
 tagtagggggcatgaggggagaggctttgactctgttctaatttatttagagcaaatcaa       c.*1020

          .         .         .         .         .         .       g.9452
 aacactcctcaaatggcatctttctgcttttatcactagttccgtgttttttttcttgtt       c.*1080

          .         .         .         .         .         .       g.9512
 ttgtgtctgtgtattttcatttctctgtcatccgtcctttcatcttgaagcaaatctctt       c.*1140

          .         .         .         .         .         .       g.9572
 ctaactccctcataccccagaaattgattccttctattcaaatgcttaataattcaggag       c.*1200

          .         .         .         .         .         .       g.9632
 attattatttgtttgagccctatcttctttttttttttgagagggggtcttactatgttg       c.*1260

          .         .         .         .         .         .       g.9692
 accaggttggagtgcaatggatattcacaggcacgatcatcgcacactacagtctagaaa       c.*1320

          .         .         .         .         .         .       g.9752
 tcctgggctcaagcgatcttcctgcttcagcctccccagtagctgggattacagggggcc       c.*1380

          .         .         .         .         .         .       g.9812
 agagcacagccctattttcttttccttttggcaagatcatctcagcagaggccagaagag       c.*1440

          .         .         .         .         .         .       g.9872
 accctcaactgttcaatgaatatttacggttgctttcttccttttatgagcctcttgcat       c.*1500

          .         .         .         .         .         .       g.9932
 actttgaaagctttaaatttatacctataatacaacggacatcccctatcccagaagacc       c.*1560

          .         .         .         .         .         .       g.9992
 attcctccctgtacttcagctctttacttcctcccaaataaaacctaacttttctaacta       c.*1620

          .         .         .         .         .         .       g.10052
 actatttaagacttggaatagtccgcttgactagaagaaggggaagaatgtttgtaaatt       c.*1680

          .         .         .         .         .         .       g.10112
 cacctctaatcggactttgattctactataattcagcagaaaattcatagcgctgtgatt       c.*1740

          .         .         .                                     g.10150
 tttagatcgacctcacataaaacagtccctgcactcgc                             c.*1778

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Major intrinsic protein of lens fiber protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.