Niemann-Pick disease, type C2 (NPC2) - coding DNA reference sequence

(used for variant description)

(last modified June 11, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_006432.3 in the NPC2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007117.1, covering NPC2 transcript NM_006432.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5047
              gacaggtcgcctgactgggctcctccccgggcccgccccgacaggtt       c.-61

 .         .         .         .         .         .                g.5107
 tgtcttgtgaccgcgggcggccgctgcttctttcccgagcttggaacttcgttatccgcg       c.-1

          .         .         .         .         .         .       g.5167
 ATGCGTTTCCTGGCAGCTACATTCCTGCTCCTGGCGCTCAGCACCGCTGCCCAGGCCGAA       c.60
 M  R  F  L  A  A  T  F  L  L  L  A  L  S  T  A  A  Q  A  E         p.20

          .         .   | 02     .         .         .         .    g.11983
 CCGGTGCAGTTCAAGGACTGCG | GTTCTGTGGATGGAGTTATAAAGGAAGTGAATGTGAGC    c.120
 P  V  Q  F  K  D  C  G |   S  V  D  G  V  I  K  E  V  N  V  S      p.40

          .         .         .         .         .         .       g.12043
 CCATGCCCCACCCAACCCTGCCAGCTGAGCAAAGGACAGTCTTACAGCGTCAATGTCACC       c.180
 P  C  P  T  Q  P  C  Q  L  S  K  G  Q  S  Y  S  V  N  V  T         p.60

          . | 03       .         .         .         .         .    g.13844
 TTCACCAGCA | ATATTCAGTCTAAAAGCAGCAAGGCCGTGGTGCATGGCATCCTGATGGGC    c.240
 F  T  S  N |   I  Q  S  K  S  S  K  A  V  V  H  G  I  L  M  G      p.80

          .         .         .         .         .         .       g.13904
 GTCCCAGTTCCCTTTCCCATTCCTGAGCCTGATGGTTGTAAGAGTGGAATTAACTGCCCT       c.300
 V  P  V  P  F  P  I  P  E  P  D  G  C  K  S  G  I  N  C  P         p.100

          .         .         .         .         .         .       g.13964
 ATCCAAAAAGACAAGACCTATAGCTACCTGAATAAACTACCAGTGAAAAGCGAATATCCC       c.360
 I  Q  K  D  K  T  Y  S  Y  L  N  K  L  P  V  K  S  E  Y  P         p.120

     | 04    .         .         .         .         .         .    g.17659
 TCT | ATAAAACTGGTGGTGGAGTGGCAACTTCAGGATGACAAAAACCAAAGTCTCTTCTGC    c.420
 S   | I  K  L  V  V  E  W  Q  L  Q  D  D  K  N  Q  S  L  F  C      p.140

          .         .  | 05      .                                  g.18132
 TGGGAAATCCCAGTACAGATC | GTTTCTCATCTCTAA                            c.456
 W  E  I  P  V  Q  I   | V  S  H  L  X                              p.151

          .         .         .         .         .         .       g.18192
 gtgcctcattgagttcggtgcatctggccaatgagtctgctgagactcttgacagcacct       c.*60

          .         .         .         .         .         .       g.18252
 ccagctctgctgcttcaacaacagtgacttgctctccaatggtatccagtgattcgttga       c.*120

          .         .         .         .         .         .       g.18312
 agaggaggtgctctgtagcagaaactgagctccgggtggctggttctcagtggttgtctc       c.*180

          .         .         .         .         .         .       g.18372
 atgtctctttttctgtcttaggtggtttcattaaatgcagcacttggttagcagatgttt       c.*240

          .         .         .         .         .         .       g.18432
 aattttttttttaacaacattaacttgtggcctctttctacacctggaaatttactcttg       c.*300

          .         .         .                                     g.18466
 aataaataaaaactcgtttgtcttgtcttctgca                                 c.*334

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Niemann-Pick disease, type C2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.