All variants in the ACTB gene

Information The variants shown are described using the NM_001101.3 transcript reference sequence.

114 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »



AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







-?/. - c.-6-4G>T r.spl? p.? - likely benign g.5569298C>A g.5529667C>A ACTB(NM_001101.3):c.-6-4G>T - ACTB_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. - c.34A>C r.(?) p.(Asn12His) - pathogenic (dominant) g.5569255T>G g.5529624T>G - - ACTB_000071 - PubMed: Verloes 2015 ClinVar-SCV000148633 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. 2 c.34A>G r.(?) p.(Asn12Asp) - pathogenic (dominant) g.5569255T>C g.5529624T>C - - ACTB_000001 submitted through SIB; ExPASy_067810; PubMed: Rivière 2012 - - De novo - - - 0 - SIB - Livia Famiglietti
-?/. - c.93C>T r.(?) p.(Phe31=) - likely benign g.5569196G>A g.5529565G>A ACTB(NM_001101.3):c.93C>T (p.F31=) - ACTB_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.94C>T r.(?) p.(Pro32Ser) - VUS g.5569195G>A g.5529564G>A - - ACTB_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
-?/. - c.123+8dup r.(=) p.(=) - likely benign g.5569158dup g.5529527dup ACTB(NM_001101.3):c.123+8dupA - ACTB_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.124-7T>A r.(=) p.(=) - likely benign g.5569038A>T g.5529407A>T ACTB(NM_001101.3):c.124-7T>A (p.(=)) - ACTB_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. - c.173C>T r.(?) p.(Ala58Val) - likely pathogenic g.5568982G>A - - - ACTB_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. - c.176A>G r.(?) p.(Gln59Arg) - pathogenic (dominant) g.5568979T>C g.5529348T>C - - ACTB_000070 - PubMed: Verloes 2015, PubMed: Ramer 1995 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. 3 c.193C>G r.(?) p.(Leu65Val) - pathogenic (dominant) g.5568962G>C g.5529331G>C - - ACTB_000002 submitted through SIB; ExPASy_067811; PubMed: Rivière 2012 - - De novo - - - 0 - SIB - Livia Famiglietti
+/. - c.193C>T r.(?) p.(Leu65Phe) - pathogenic (dominant) g.5568962G>A g.5529331G>A - - ACTB_000069 - PubMed: Verloes 2015 ClinVar-SCV000148634 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
-?/. - c.199C>T r.(?) p.(Leu67=) - likely benign g.5568956G>A g.5529325G>A ACTB(NM_001101.3):c.199C>T (p.L67=) - ACTB_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+?/. - c.209C>T r.(?) p.(Pro70Leu) - likely pathogenic g.5568946G>A g.5529315G>A - - ACTB_000010 - - - - Unknown - - - 0 - IMGAG
+/. - c.209C>T r.(?) p.(Pro70Leu) - pathogenic (dominant) g.5568946G>A g.5529315G>A - - ACTB_000010 - PubMed: Verloes 2015, PubMed: Bitton 2012 ClinVar-SCV000148635 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
?/. - c.215_226del r.(?) p.(Glu72_Ile75del) - VUS g.5568934_5568945del g.5529303_5529314del ACTB(NM_001101.3):c.215_226delAGCACGGCATCG (p.E72_I75del) - ACTB_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. - c.217C>G r.(?) p.(His73Asp) - likely pathogenic (dominant) g.5568938G>C g.5529307G>C NM_001101.3:c.217C>G:p.(His73Asp) - ACTB_000079 - PubMed: Maddirevula 2018 - - De novo - - - 0 - LOVD
+?/. - c.217C>G r.(?) p.(His73Asp) ACMG likely pathogenic g.5568938G>C g.5529307G>C - - ACTB_000079 ACMG PS2, PM2, PP3 PubMed: Anazi 2017 - - De novo - - - 0 - Johan den Dunnen
+/. - c.220G>A r.(?) p.(Gly74Ser) - pathogenic (dominant) g.5568935C>T g.5529304C>T - - ACTB_000063 father not available PubMed: Di Donato 2014 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. - c.220G>A r.(?) p.(Gly74Ser) - pathogenic (dominant) g.5568935C>T g.5529304C>T - - ACTB_000063 - PubMed: Verloes 2015 ClinVar-SCV000148636 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. - c.224T>C r.(?) p.(Ile75Thr) - pathogenic (dominant) g.5568931A>G g.5529300A>G - - ACTB_000068 - PubMed: Verloes 2015 ClinVar-SCV000148637 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
?/. - c.256T>C r.(?) p.(Trp86Arg) - VUS g.5568899A>G - - - ACTB_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.269_271del r.(?) p.(Phe90del) - VUS g.5568886_5568888del g.5529255_5529257del - - ACTB_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.270C>T r.(?) p.(Phe90=) - likely benign g.5568885G>A g.5529254G>A ACTB(NM_001101.3):c.270C>T (p.F90=) - ACTB_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - c.272A>C r.(?) p.(Tyr91Ser) - likely pathogenic g.5568883T>G g.5529252T>G - - ACTB_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+?/. - c.275A>G r.(?) p.(Asn92Ser) - likely pathogenic g.5568880T>C - - - ACTB_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.280C>T r.(?) p.(Leu94=) - likely benign g.5568875G>A g.5529244G>A ACTB(NM_001101.3):c.280C>T (p.L94=) - ACTB_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.297G>A r.(?) p.(Glu99=) - likely benign g.5568858C>T - ACTB(NM_001101.3):c.297G>A (p.E99=) - ACTB_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.307G>C r.(?) p.(Val103Leu) - pathogenic (dominant) g.5568848C>G g.5529217C>G - - ACTB_000067 - PubMed: Verloes 2015 ClinVar-SCV000148638 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
-?/. - c.310C>T r.(?) p.(Leu104=) - likely benign g.5568845G>A g.5529214G>A ACTB(NM_001101.3):c.310C>T (p.L104=) - ACTB_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - c.311T>G r.(?) p.(Leu104Arg) ACMG likely pathogenic g.5568844A>C - - - ACTB_000077 ACMG grading: PS2,PM2,PP2,PP3 de novo confirmed, PS2 counted as "moderate" evidence according to ACMG - - - Germline - - - 0 - Andreas Laner
-?/. - c.324C>T r.(?) p.(Ala108=) - likely benign g.5568831G>A g.5529200G>A ACTB(NM_001101.3):c.324C>T (p.A108=) - ACTB_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.345C>T r.(?) p.(Asn115=) - likely benign g.5568810G>A g.5529179G>A ACTB(NM_001101.3):c.345C>T (p.N115=) - ACTB_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. ? c.349G>A r.(?) p.(Glu117Lys) - pathogenic (dominant) g.5568806C>T g.5529175C>T - - ACTB_000040 - PubMed: Johnston 2013 - - De novo - - - 0 - Jennifer Johnston
+/. - c.351G>T r.(?) p.(Glu117Asp) ACMG pathogenic g.5568804C>A g.5529173C>A - - ACTB_000009 - - - - De novo yes - - 0 - Bernt Popp
+/. - c.356T>C r.(?) p.(Met119Thr) - pathogenic (dominant) g.5568799A>G g.5529168A>G - - ACTB_000066 - PubMed: Verloes 2015 ClinVar-SCV000148640 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. - c.359C>T r.(?) p.(Thr120Ile) - pathogenic (dominant) g.5568796G>A g.5529165G>A - - ACTB_000062 father not available PubMed: Di Donato 2014 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. - c.359C>T r.(?) p.(Thr120Ile) - pathogenic (dominant) g.5568796G>A g.5529165G>A - - ACTB_000062 - PubMed: Verloes 2015, PubMed: Guion-Almeida 1992, PubMed: Guion-Almeida 2001 ClinVar-SCV000148640 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
-/. - c.363+16C>T r.(=) p.(=) - benign g.5568776G>A g.5529145G>A ACTB(NM_001101.3):c.363+16C>T - ACTB_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.364-143T>C r.(=) p.(=) - VUS g.5568493A>G g.5528862A>G - - ACTB_000008 - - - - Germline - - - - - Yu Sun
?/. - c.364-143T>C r.(=) p.(=) - VUS g.5568493A>G g.5528862A>G - - ACTB_000008 - - - - Germline - - - - - Yu Sun
?/. - c.364-16T>C r.(=) p.(=) - VUS g.5568366A>G g.5528735A>G - - ACTB_000007 - - - - Germline - - - - - Yu Sun
-/. - c.364-16T>C r.(=) p.(=) - benign g.5568366A>G g.5528735A>G ACTB(NM_001101.3):c.364-16T>C - ACTB_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.364-16T>C r.(=) p.(=) - benign g.5568366A>G g.5528735A>G ACTB(NM_001101.3):c.364-16T>C - ACTB_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.364-16T>C r.(=) p.(=) - benign g.5568366A>G g.5528735A>G ACTB(NM_001101.3):c.364-16T>C - ACTB_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
?/. - c.418C>G r.(?) p.(Leu140Val) ACMG VUS g.5568296G>C g.5528665G>C - - ACTB_000061 ACMG: PM2,PP3; Delayed development, agenesis of corpus callosum, mother: learning disability - - - Germline - - - 0 - Andreas Laner
-?/. - c.426G>T r.(?) p.(Leu142=) - likely benign g.5568288C>A g.5528657C>A ACTB(NM_001101.3):c.426G>T (p.L142=, p.(Leu142=)) - ACTB_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.426G>T r.(?) p.(Leu142=) - benign g.5568288C>A - ACTB(NM_001101.3):c.426G>T (p.L142=, p.(Leu142=)) - ACTB_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.426G>T r.(?) p.(Leu142=) - likely benign g.5568288C>A - ACTB(NM_001101.3):c.426G>T (p.L142=, p.(Leu142=)) - ACTB_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.429C>T r.(?) p.(Tyr143=) - likely benign g.5568285G>A - ACTB(NM_001101.3):c.429C>T (p.Y143=) - ACTB_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.430G>A r.(?) p.(Ala144Thr) - VUS g.5568284C>T - ACTB(NM_001101.3):c.430G>A (p.A144T) - ACTB_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.446C>T r.(?) p.(Thr149Ile) - pathogenic (dominant) g.5568268G>A g.5528637G>A - - ACTB_000065 - PubMed: Verloes 2015 ClinVar-SCV000148642 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
-?/. - c.447T>C r.(?) p.(Thr149=) - likely benign g.5568267A>G g.5528636A>G ACTB(NM_001101.3):c.447T>C (p.T149=) - ACTB_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.465C>T r.(?) p.(Ser155=) - likely benign g.5568249G>A g.5528618G>A ACTB(NM_001101.3):c.465C>T (p.S155=) - ACTB_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. - c.484A>G r.(?) p.(Thr162Ala) - pathogenic g.5568230T>C g.5528599T>C - - ACTB_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. - c.521C>T r.(?) p.(Ala174Val) - likely pathogenic g.5568193G>A g.5528562G>A - - ACTB_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.532C>T r.(?) p.(Leu178=) - likely benign g.5568182G>A - ACTB(NM_001101.3):c.532C>T (p.L178=) - ACTB_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - c.537C>G r.(?) p.(Asp179Glu) ACMG likely pathogenic (dominant) g.5568177G>C g.5528546G>C - - ACTB_000073 - PubMed: Helbig 2016 - - De novo - - - 0 - Johan den Dunnen
+/. - c.547C>T r.(?) p.(Arg183Trp) - pathogenic g.5568167G>A g.5528536G>A - - ACTB_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+/? 4 c.547C>T r.(?) p.(Arg183Trp) - pathogenic g.5568167G>A g.5528536G>A - - ACTB_000005 submitted through SIB; ExPASy_030026; {dbSNP104894003} PubMed: Procaccio et al (2006) - - Unknown - - - 0 - SIB - Livia Famiglietti
+/. - c.547C>T r.(?) p.(Arg183Trp) - pathogenic (dominant) g.5568167G>A g.5528536G>A - - ACTB_000005 - PubMed: Verloes 2015, PubMed: Gearing 2002, PubMed: Procaccio 2006 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. - c.547C>T r.(?) p.(Arg183Trp) - pathogenic (dominant) g.5568167G>A g.5528536G>A - - ACTB_000005 - PubMed: Verloes 2015, PubMed: Gearing 2002, PubMed: Procaccio 2006 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
?/. 4 c.547C>T r.(?) p.(Arg183Trp) ACMG VUS g.5568167G>A g.5528536G>A - - ACTB_000005 - PubMed: Squeo 2020 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+?/. - c.583G>A r.(?) p.(Glu195Lys) - likely pathogenic g.5568131C>T - - - ACTB_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 4 c.586C>T r.(?) p.(Arg196Cys) - pathogenic (dominant) g.5568128G>A g.5528497G>A - - ACTB_000003 submitted through SIB; ExPASy_067812; parents not available PubMed: Rivière 2012 - - Germline/De novo (untested) - - - 0 - SIB - Livia Famiglietti
+/. - c.586C>T r.(?) p.(Arg196Cys) - pathogenic (dominant) g.5568128G>A g.5528497G>A - - ACTB_000003 - PubMed: Di Donato 2014 - - De novo - - - 0 - Johan den Dunnen
+/. - c.586C>T r.(?) p.(Arg196Cys) - pathogenic (dominant) g.5568128G>A g.5528497G>A - - ACTB_000003 - PubMed: Verloes 2015 ClinVar-SCV000148643 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. - c.586C>T r.(?) p.(Arg196Cys) - pathogenic (dominant) g.5568128G>A g.5528497G>A - - ACTB_000003 - PubMed: Verloes 2015 ClinVar-SCV000148643 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. - c.586C>T r.(?) p.(Arg196Cys) - pathogenic (dominant) g.5568128G>A g.5528497G>A - - ACTB_000003 - PubMed: Verloes 2015 ClinVar-SCV000148643 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. - c.586C>T r.(?) p.(Arg196Cys) - pathogenic (dominant) g.5568128G>A g.5528497G>A {PMID:Eker 2014:24211661} - ACTB_000003 - - ClinVar-SCV000148643 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+?/. - c.587G>A r.(?) p.(Arg196His) - likely pathogenic g.5568127C>T g.5528496C>T ACTB(NM_001101.3):c.587G>A (p.R196H) - ACTB_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. 4 c.587G>A r.(?) p.(Arg196His) - pathogenic (dominant) g.5568127C>T g.5528496C>T - - ACTB_000004 submitted through SIB; ExPASy_067813 PubMed: Rivière 2012 - - De novo - - - 0 - SIB - Livia Famiglietti
+/. 4 c.587G>A r.(?) p.(Arg196His) - pathogenic (dominant) g.5568127C>T g.5528496C>T - - ACTB_000004 - PubMed: Rivière 2012 - - De novo - - - 0 - Johan den Dunnen
+/. 4 c.587G>A r.(?) p.(Arg196His) - pathogenic (dominant) g.5568127C>T g.5528496C>T - - ACTB_000004 parents not available PubMed: Rivière 2012 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. 4 c.587G>A r.(?) p.(Arg196His) - pathogenic (dominant) g.5568127C>T g.5528496C>T - - ACTB_000004 parents not available PubMed: Rivière 2012 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. 4 c.587G>A r.(?) p.(Arg196His) - pathogenic (dominant) g.5568127C>T g.5528496C>T - - ACTB_000004 parents not available PubMed: Rivière 2012 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. 4 c.587G>A r.(?) p.(Arg196His) - pathogenic (dominant) g.5568127C>T g.5528496C>T - - ACTB_000004 parents not available PubMed: Rivière 2012 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. 4 c.587G>A r.(?) p.(Arg196His) - pathogenic (dominant) g.5568127C>T g.5528496C>T - - ACTB_000004 parents not available PubMed: Rivière 2012 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. - c.587G>A r.(?) p.(Arg196His) - pathogenic (dominant) g.5568127C>T g.5528496C>T 586C>A (Arg196His) - ACTB_000004 - PubMed: Verloes 2015 ClinVar-SCV000148644 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
?/. 4 c.587G>A r.(?) p.(Arg196His) ACMG VUS g.5568127C>T g.5528496C>T - - ACTB_000004 - PubMed: Squeo 2020 - - Germline/De novo (untested) - - - 0 - Johan den Dunnen
?/. - c.589G>A r.(?) p.(Gly197Ser) - VUS g.5568125C>T g.5528494C>T ACTB(NM_001101.3):c.589G>A (p.G197S) - ACTB_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+?/. - c.589G>A r.(?) p.(Gly197Ser) - likely pathogenic g.5568125C>T - ACTB(NM_001101.3):c.589G>A (p.G197S) - ACTB_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. - c.611C>G r.(?) p.(Ala204Gly) - pathogenic (dominant) g.5568103G>C g.5528472G>C - - ACTB_000064 - PubMed: Verloes 2015 ClinVar-SCV000148645 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
+/. - c.625G>A r.(?) p.(Val209Met) - pathogenic g.5568089C>T g.5528458C>T ACTB(NM_001101.3):c.625G>A (p.V209M) - ACTB_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. - c.625G>A r.(?) p.(Val209Met) - pathogenic (dominant) g.5568089C>T g.5528458C>T - - ACTB_000018 - PubMed: Verloes 2015 ClinVar-SCV000148646 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
-?/. - c.646C>T r.(?) p.(Leu216=) - likely benign g.5568068G>A g.5528437G>A ACTB(NM_001101.3):c.646C>T (p.L216=) - ACTB_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - c.752G>A r.(?) p.(Gly251Asp) - likely pathogenic g.5567962C>T g.5528331C>T ACTB(NM_001101.3):c.752G>A (p.(Gly251Asp)) - ACTB_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.761G>A r.(?) p.(Arg254Gln) - VUS g.5567953C>T g.5528322C>T ACTB(NM_001101.3):c.761G>A (p.R254Q) - ACTB_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.770G>T r.(?) p.(Cys257Phe) - VUS g.5567944C>A g.5528313C>A - - ACTB_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
?/. - c.791C>G r.(?) p.(Pro264Arg) - VUS g.5567923G>C g.5528292G>C ACTB(NM_001101.3):c.791C>G (p.P264R) - ACTB_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.859G>A r.(?) p.(Val287Met) - VUS g.5567760C>T g.5528129C>T - - ACTB_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+?/. 5 c.890_891del r.(?) p.(Thr297Serfs*37) - likely pathogenic g.5567731_5567732del g.5528100_5528101del 890_891delCA - ACTB_000042 - - ClinVar-432794 rs1554329182 Germline/De novo (untested) - - - 0 - Andreas Janecke
+?/. 5 c.905G>C r.(?) p.(Gly302Ala) - likely pathogenic g.5567714C>G g.5528083C>G - - ACTB_000041 - - - - De novo yes - - 0 - Andreas Janecke
+?/. - c.930_*52del r.(?) p.(?) - likely pathogenic g.5567327_5567689del - - - ACTB_000074 - - - - Unknown - - - 0 - IMGAG
+?/. - c.931G>A r.(?) p.(Asp311Asn) - likely pathogenic g.5567688C>T g.5528057C>T - - ACTB_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+?/. - c.931_957del r.(?) p.(Asp311_Ala319del) - likely pathogenic g.5567666_5567692del g.5528035_5528061del ACTB(NM_001101.3):c.931_957delGACAGGATGCAGAAGGAGATCACTGCC (p.D311_A319del) - ACTB_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-/. - c.942G>A r.(?) p.(Gln314=) - benign g.5567677C>T g.5528046C>T ACTB(NM_001101.3):c.942G>A (p.Q314=, p.(Gln314=)) - ACTB_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.942G>A r.(?) p.(Gln314=) - benign g.5567677C>T g.5528046C>T ACTB(NM_001101.3):c.942G>A (p.Q314=, p.(Gln314=)) - ACTB_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.942G>A r.(?) p.(Gln314=) - benign g.5567677C>T g.5528046C>T ACTB(NM_001101.3):c.942G>A (p.Q314=, p.(Gln314=)) - ACTB_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
-/. - c.942G>A r.(?) p.(Gln314=) - benign g.5567677C>T - ACTB(NM_001101.3):c.942G>A (p.Q314=, p.(Gln314=)) - ACTB_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - c.951C>T r.(?) p.(Ile317=) - benign g.5567668G>A g.5528037G>A ACTB(NM_001101.3):c.951C>T (p.I317=) - ACTB_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
Legend   How to query   « First ‹ Prev     1 2     Next › Last »