Unique variants in the APOE gene

Information The variants shown are described using the NM_000041.2 transcript reference sequence.

92 entries on 1 page. Showing entries 1 - 92.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Haplotype     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 1 - c.-24+15C>T r.(=) p.(=) - - likely benign g.45409113C>T g.44905856C>T APOE(NM_001302688.2):c.-13C>T - APOE_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.-24+20G>A r.(=) p.(=) - - likely benign g.45409118G>A g.44905861G>A APOE(NM_001302688.2):c.-8G>A - APOE_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.-24+38G>A r.(=) p.(=) - - VUS g.45409136G>A g.44905879G>A APOE(NM_001302688.2):c.11G>A (p.G4E) - APOE_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 3 - c.-24+69C>G r.(=) p.(=) - - benign g.45409167C>G g.44905910C>G APOE(NM_000041.4):c.-24+69C>G, APOE(NM_001302688.2):c.42C>G (p.N14K) - APOE_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_VUmc, VKGL-NL_AMC
?/. 1 - c.-24+82G>A r.(=) p.(=) - - VUS g.45409180G>A g.44905923G>A APOE(NM_001302688.2):c.55G>A (p.D19N) - APOE_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.-24+319C>A r.(=) p.(=) - - likely benign g.45409417C>A - APOE(NM_001302688.2):c.55+237C>A - APOE_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.-24+335dup r.(=) p.(=) - - likely benign g.45409433dup - APOE(NM_001302688.2):c.55+253dupA - APOE_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.-23-280C>T r.(=) p.(=) - - benign g.45409579C>T g.44906322C>T APOE(NM_001302688.2):c.56-280C>T - APOE_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.-23-57G>A r.(=) p.(=) - - likely benign g.45409802G>A - APOE(NM_001302688.2):c.56-57G>A - APOE_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.35T>A r.(?) p.(Phe12Tyr) - - VUS g.45409916T>A g.44906659T>A APOE(NM_001302688.2):c.113T>A (p.F38Y) - APOE_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.36C>A r.(?) p.(Phe12Leu) - - VUS g.45409917C>A g.44906660C>A APOE(NM_001302688.2):c.114C>A (p.F38L) - APOE_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.43+69C>T r.(=) p.(=) - - VUS g.45409993C>T - APOE(NM_001302688.2):c.121+69C>T - APOE_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.43+78G>A r.(=) p.(=) - - benign g.45410002G>A g.44906745G>A APOE(NM_001302688.2):c.121+78G>A - APOE_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.43+349G>A r.(=) p.(=) - - likely benign g.45410273G>A - APOE(NM_001302688.2):c.121+349G>A - APOE_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.43+520G>A r.(=) p.(=) - - benign g.45410444G>A - APOE(NM_001302688.2):c.121+520G>A - APOE_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.44-106T>G r.(=) p.(=) - - likely benign g.45410911T>G g.44907654T>G APOE(NM_001302688.2):c.122-106T>G - APOE_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 2 - c.69G>A r.(?) p.(Ala23=) - - likely benign g.45411042G>A g.44907785G>A APOE(NM_001302688.2):c.147G>A (p.A49=) - APOE_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
-?/. 1 - c.84G>A r.(?) p.(Pro28=) - - likely benign g.45411057G>A g.44907800G>A APOE(NM_001302688.2):c.162G>A (p.P54=) - APOE_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.88C>A r.(?) p.(Pro30Thr) - - VUS g.45411061C>A g.44907804C>A APOE(NM_001302688.2):c.166C>A (p.P56T) - APOE_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 2 - c.90C>G r.(?) p.(Pro30=) - - likely benign g.45411063C>G g.44907806C>G APOE(NM_001302688.2):c.168C>G (p.P56=) - APOE_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
?/. 1 - c.91G>A r.(?) p.(Glu31Lys) - - VUS g.45411064G>A g.44907807G>A APOE(NM_001302688.2):c.169G>A (p.E57K) - APOE_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/., ?/. 2 - c.104A>C r.(?) p.(Gln35Pro) - - likely benign, VUS g.45411077A>C g.44907820A>C APOE(NM_001302688.2):c.182A>C (p.Q61P) - APOE_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
-/. 1 - c.120C>T r.(?) p.(Ser40=) - - benign g.45411093C>T g.44907836C>T APOE(NM_001302688.2):c.198C>T (p.S66=) - APOE_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/., ?/. 2 - c.137T>C r.(?) p.(Leu46Pro) - - likely pathogenic, VUS g.45411110T>C g.44907853T>C APOE(NM_001302688.2):c.215T>C (p.L72P) - APOE_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
?/. 1 - c.149G>C r.(?) p.(Arg50Pro) - - VUS g.45411122G>C - APOE(NM_001302688.2):c.227G>C (p.R76P) - APOE_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.165G>C r.(?) p.(Leu55=) - - likely benign g.45411138G>C g.44907881G>C APOE(NM_001302688.2):c.243G>C (p.L81=) - APOE_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.192G>C r.(?) p.(Gln64His) - - VUS g.45411165G>C g.44907908G>C APOE(NM_001302688.2):c.270G>C (p.Q90H) - APOE_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.192G>T r.(?) p.(Gln64His) - - VUS g.45411165G>T g.44907908G>T APOE(NM_001302688.2):c.270G>T (p.Q90H) - APOE_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.198G>A r.(?) p.(Gln66=) - - likely benign g.45411171G>A g.44907914G>A APOE(NM_001302688.2):c.276G>A (p.Q92=) - APOE_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.206T>C r.(?) p.(Leu69Pro) - - VUS g.45411179T>C g.44907922T>C APOE(NM_001302688.2):c.284T>C (p.L95P) - APOE_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.236+12del r.(=) p.(=) - - likely benign g.45411221del g.44907964del APOE(NM_001302688.2):c.314+12delC - APOE_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.236+219G>A r.(=) p.(=) - - likely benign g.45411428G>A - APOE(NM_001302688.2):c.314+219G>A - APOE_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/., -?/. 2 - c.237-16_237-13del r.(=) p.(=) - - benign, likely benign g.45411774_45411777del g.44908517_44908520del APOE(NM_001302688.2):c.315-16_315-13delGCCC - APOE_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
-?/. 1 - c.240G>A r.(?) p.(Ala80=) - - likely benign g.45411793G>A g.44908536G>A APOE(NM_001302688.2):c.318G>A (p.A106=) - APOE_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.279A>C r.(?) p.(Lys93Asn) - - VUS g.45411832A>C g.44908575A>C APOE(NM_001302688.2):c.357A>C (p.K119N) - APOE_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.287T>C r.(?) p.(Leu96Pro) - - VUS g.45411840T>C g.44908583T>C APOE(NM_001302688.2):c.365T>C (p.L122P) - APOE_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.305C>G r.(?) p.(Pro102Arg) - - VUS g.45411858C>G - APOE(NM_001302688.2):c.383C>G (p.P128R) - APOE_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.305C>T r.(?) p.(Pro102Leu) - - VUS g.45411858C>T - APOE(NM_001302688.2):c.383C>T (p.P128L) - APOE_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.331C>T r.(?) p.(Leu111=) - - likely benign g.45411884C>T - APOE(NM_001302688.2):c.409C>T (p.L137=) - APOE_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.340dup r.(?) p.(Glu114Glyfs*51) - - VUS g.45411893dup - APOE(NM_001302688.2):c.418dupG (p.E140Gfs*51) - APOE_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.349G>A r.(?) p.(Ala117Thr) - - VUS g.45411902G>A g.44908645G>A - - APOE_000070 no interpretation available; 1 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs28931577 Germline - 1/2795 individuals - - - Mohammed Faruq
-?/. 1 - c.381G>A r.(?) p.(Glu127=) - - likely benign g.45411934G>A g.44908677G>A APOE(NM_001302688.2):c.459G>A (p.E153=) - APOE_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/-, -/. 28 4 c.388T= r.(=) p.(Cys130=), p.Cys130= E3, E3;E3 - benign g.45411941= g.44908684= - - APOE_000000 reference haplotype apoE3 Journal: Holstege 2017 - rs429358 Germline - - - - - Johan den Dunnen, Henne Holstege
+?/., ?/., ?/? 72 4 c.388T>C r.(?), r.388u>c p.(Cys130Arg), p.Cys130Arg E3;E4, E4, E4;E4 - likely pathogenic, VUS g.45411941T>C g.44908684T>C apoE4, Cys112Arg - APOE_000001 reference haplotype apoE4, risk factor; 1 heterozygous, no homozygous; Clinindb (India) Reference Haplotype; OMIM:var0016, Journal: Holstege 2017, PubMed: Fitzky et al. 1998, 7 more items - rs429358 Germline, Unknown -, no 1/2794 individuals - - - Johan den Dunnen, Division of Human Genetics, Innsbruck, Henne Holstege, Mohammed Faruq
?/. 1 - c.395G>A r.(?) p.(Arg132His) - - VUS g.45411948G>A g.44908691G>A APOE(NM_001302688.2):c.473G>A (p.R158H) - APOE_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.399G>A r.(?) p.(Leu133=) - - likely benign g.45411952G>A g.44908695G>A APOE(NM_001302688.2):c.477G>A (p.L159=) - APOE_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.410G>A r.(?) p.(Arg137His) - - pathogenic g.45411963G>A g.44908706G>A APOE(NM_001302688.2):c.488G>A (p.R163H) - APOE_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.415_435dup r.(?) p.(Glu139_Gly145dup) - - pathogenic g.45411968_45411988dup g.44908711_44908731dup APOE(NM_001302688.2):c.493_513dupGAGGTGCAGGCCATGCTCGGC (p.E165_G171dup) - APOE_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 2 - c.434G>A r.(?) p.(Gly145Asp) - - VUS g.45411987G>A g.44908730G>A APOE(NM_001302688.2):c.512G>A (p.G171D) - APOE_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
?/. 1 - c.447G>C r.(?) p.(Glu149Asp) - - VUS g.45412000G>C g.44908743G>C APOE(NM_001302688.2):c.525G>C (p.E175D) - APOE_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.451C>A r.(?) p.(Leu151Met) - - VUS g.45412004C>A g.44908747C>A APOE(NM_001302688.2):c.529C>A (p.L177M) - APOE_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.455G>A r.(?) p.(Arg152Gln) - - VUS g.45412008G>A g.44908751G>A APOE(NM_001302688.2):c.533G>A (p.R178Q) - APOE_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.460C>A r.(?) p.(Arg154Ser) - - pathogenic g.45412013C>A g.44908756C>A APOE(NM_001302688.2):c.538C>A (p.R180S) - APOE_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.460C>T r.(?) p.(Arg154Cys) - - pathogenic g.45412013C>T g.44908756C>T APOE(NM_001302688.2):c.538C>T (p.R180C) - APOE_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.461G>A r.(?) p.(Arg154His) - - pathogenic g.45412014G>A g.44908757G>A APOE(NM_000041.3):c.461G>A (p.R154H) - APOE_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.463C>G r.(?) p.(Leu155Val) - - likely benign g.45412016C>G g.44908759C>G APOE(NM_001302688.2):c.541C>G (p.L181V) - APOE_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.479G>A r.(?) p.(Arg160His) - - VUS g.45412032G>A g.44908775G>A APOE(NM_001302688.2):c.557G>A (p.R186H) - APOE_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.490A>C r.(?) p.(Lys164Gln) - - pathogenic g.45412043A>C g.44908786A>C APOE(NM_001302688.2):c.568A>C (p.K190Q) - APOE_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/., +/? 2 4 c.500_502del r.(?) p.(Leu167del) - - pathogenic g.45412053_45412055del g.44908796_44908798del 500_502delTCC, APOE(NM_001302688.2):c.578_580delTCC (p.L193del) - APOE_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - VKGL-NL_AMC, Mathilde Varret
-?/. 1 - c.507T>C r.(?) p.(Asp169=) - - likely benign g.45412060T>C g.44908803T>C APOE(NM_001302688.2):c.585T>C (p.D195=) - APOE_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/- 1 4 c.526C= r.(=) p.Arg176= E3 - benign g.45412079= g.44908822= - - APOE_000000 reference haplotype apoE3 - - rs7412 Germline - - - - - Johan den Dunnen
-?/., ?/., ?/? 39 4 c.526C>T r.(?), r.526c>u p.(Arg176Cys), p.Arg176Cys E2, E2;E2, E2;E3 - likely benign, VUS g.45412079C>T g.44908822C>T APOE(NM_000041.4):c.526C>T (p.R176C), apoE2, Arg158Cys - APOE_000002 drug response; 195 heterozygous; Clinindb (India), drug response; 4 homozygous; Clinindb (India), 2 more items Reference Haplotype; OMIM:var0001, Journal: Holstege 2017, PubMed: Fitzky et al. 1998, 6 more items - rs7412 CLASSIFICATION record, Germline, Unknown -, no 195/2780 individuals, 4/2780 individuals - - - Johan den Dunnen, Division of Human Genetics, Innsbruck, Henne Holstege, VKGL-NL_Utrecht, Mohammed Faruq
-/. 1 - c.555C>T r.(?) p.(Arg185=) - - benign g.45412108C>T g.44908851C>T APOE(NM_001302688.2):c.633C>T (p.R211=) - APOE_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.576C>T r.(?) p.(Leu192=) - - likely benign g.45412129C>T g.44908872C>T APOE(NM_001302688.2):c.654C>T (p.L218=) - APOE_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.592C>T r.(?) p.(Arg198Cys) - - VUS g.45412145C>T - APOE(NM_001302688.2):c.670C>T (p.R224C) - APOE_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.605T>C r.(?) p.(Leu202Pro) - - VUS g.45412158T>C g.44908901T>C APOE(NM_001302688.2):c.683T>C (p.L228P) - APOE_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 1 - c.613C>T r.(?) p.(Gln205Ter) - - likely pathogenic g.45412166C>T g.44908909C>T APOE(NM_001302688.2):c.691C>T (p.Q231*) - APOE_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.627G>A r.(?) p.(Arg209=) - - likely benign g.45412180G>A g.44908923G>A APOE(NM_001302688.2):c.705G>A (p.R235=) - APOE_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.628G>T r.(?) p.(Ala210Ser) - - VUS g.45412181G>T - APOE(NM_001302688.2):c.706G>T (p.A236S) - APOE_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.651C>T r.(?) p.(Ala217=) - - benign g.45412204C>T g.44908947C>T APOE(NM_001302688.2):c.729C>T (p.A243=) - APOE_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.691C>T r.(?) p.(Arg231Trp) - - VUS g.45412244C>T g.44908987C>T APOE(NM_001302688.2):c.769C>T (p.R257W) - APOE_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.699C>T r.(?) p.(Arg233=) - - likely benign g.45412252C>T g.44908995C>T APOE(NM_001302688.2):c.777C>T (p.R259=) - APOE_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.719G>A r.(?) p.(Gly240Asp) - - VUS g.45412272G>A g.44909015G>A APOE(NM_001302688.2):c.797G>A (p.G266D) - APOE_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.745G>A r.(?) p.(Glu249Lys) - - VUS g.45412298G>A g.44909041G>A APOE(NM_001302688.2):c.823G>A (p.E275K) - APOE_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.747G>A r.(?) p.(Glu249=) - - likely benign g.45412300G>A - APOE(NM_001302688.2):c.825G>A (p.E275=) - APOE_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/., -?/. 2 - c.761T>A r.(?) p.(Val254Glu) - - benign, likely benign g.45412314T>A g.44909057T>A APOE(NM_001302688.2):c.839T>A (p.V280E) - APOE_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
-?/. 2 - c.786G>A r.(?) p.(Glu262=) - - likely benign g.45412339G>A g.44909082G>A APOE(NM_001302688.2):c.864G>A (p.E288=) - APOE_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
+?/. 1 - c.805C>G r.(?) p.(Arg269Gly) - - likely pathogenic g.45412358C>G g.44909101C>G APOE(NM_001302688.2):c.883C>G (p.R295G) - APOE_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.807C>G r.(?) p.(Arg269=) - - likely benign g.45412360C>G g.44909103C>G APOE(NM_001302688.2):c.885C>G (p.R295=) - APOE_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.823T>G r.(?) p.(Phe275Val) - - VUS g.45412376T>G g.44909119T>G APOE(NM_001302688.2):c.901T>G (p.F301V) - APOE_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.849C>G r.(?) p.(Phe283Leu) - - VUS g.45412402C>G g.44909145C>G APOE(NM_001302688.2):c.927C>G (p.F309L) - APOE_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.855C>G r.(?) p.(Pro285=) - - benign g.45412408C>G g.44909151C>G APOE(NM_001302688.2):c.933C>G (p.P311=) - APOE_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.856C>T r.(?) p.(Leu286=) - - likely benign g.45412409C>T g.44909152C>T APOE(NM_001302688.2):c.934C>T (p.L312=) - APOE_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.875G>A r.(?) p.(Arg292His) - - VUS g.45412428G>A g.44909171G>A APOE(NM_001302688.2):c.953G>A (p.R318H) - APOE_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.882G>T r.(?) p.(Trp294Cys) - - VUS g.45412435G>T g.44909178G>T APOE(NM_001302688.2):c.960G>T (p.W320C) - APOE_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.883G>A r.(?) p.(Ala295Thr) - - VUS g.45412436G>A g.44909179G>A APOE(NM_001302688.2):c.961G>A (p.A321T) - APOE_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.886G>T r.(?) p.(Gly296Trp) - - VUS g.45412439G>T g.44909182G>T APOE(NM_001302688.2):c.964G>T (p.G322W) - APOE_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.924C>T r.(?) p.(Ser308=) - - benign g.45412477C>T g.44909220C>T APOE(NM_001302688.2):c.1002C>T (p.S334=) - APOE_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 2 - c.942C>T r.(?) p.(Ser314=) - - likely benign g.45412495C>T - APOE(NM_001302688.2):c.1020C>T (p.S340=) - APOE_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
-?/. 1 - c.*2C>T r.(=) p.(=) - - likely benign g.45412509C>T g.44909252C>T APOE(NM_001302688.2):c.*2C>T - APOE_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.*13G>A r.(=) p.(=) - - likely benign g.45412520G>A g.44909263G>A APOE(NM_001302688.2):c.*13G>A - APOC1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.*25C>T r.(=) p.(=) - - likely benign g.45412532C>T g.44909275C>T APOE(NM_001302688.2):c.*25C>T - APOC1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
Legend   How to query