All variants in the ARSD gene

Information The variants shown are described using the NM_001669.3 transcript reference sequence.

33 entries on 1 page. Showing entries 1 - 33.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. - c.278G>A r.(?) p.(Arg93Gln) - VUS g.2839982C>T g.2921941C>T ARSD(NM_001669.3):c.278G>A (p.(Arg93Gln)) - ARSD_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.439+234dup r.(=) p.(=) - VUS g.2838422dup g.2920381dup - - ARSD_000067 - - - - Germline - - - - - Yu Sun
./. - c.440-151A>C r.(=) p.(=) - VUS g.2836419T>G g.2918378T>G - - ARSD_000068 - - - - Germline - - - - - Yu Sun
?/. 5 c.470C>T r.(?) p.(Ser157Phe) - VUS g.2836238G>A g.2918197G>A S157F - ARSD_000002 recurrent, found 14 times PubMed: Tarpey 2009 - - Germline - 14/208 cases - 0 - Lucy Raymond
?/. 5 c.497T>A r.(?) p.(Leu166Gln) - VUS g.2836211A>T g.2918170A>T L166Q - ARSD_000003 recurrent, found 16 times PubMed: Tarpey 2009 - - Germline - 16/208 cases - 0 - Lucy Raymond
?/. 5 c.524G>A r.(?) p.(Gly175Asp) - VUS g.2836184C>T g.2918143C>T G175D - ARSD_000004 recurrent, found 45 times PubMed: Tarpey 2009 - - Germline - 45/208 cases - 0 - Lucy Raymond
?/. 5 c.527T>A r.(?) p.(Met176Lys) - VUS g.2836181A>T g.2918140A>T M176K - ARSD_000005 recurrent, found 16 times PubMed: Tarpey 2009 - - Germline - 16/208 cases - 0 - Lucy Raymond
?/. 5 c.570C>T r.(?) p.(=) - VUS g.2836138G>A g.2918097G>A P190P - ARSD_000006 recurrent, found 15 times PubMed: Tarpey 2009 - - Germline - 15/208 cases - 0 - Lucy Raymond
?/. 5 c.624G>C r.(?) p.(=) - VUS g.2836084C>G g.2918043C>G A208A - ARSD_000007 recurrent, found 17 times PubMed: Tarpey 2009 - - Germline - 17/208 cases - 0 - Lucy Raymond
?/. 5 c.648C>T r.(?) p.(=) - VUS g.2836060G>A g.2918019G>A A216A - ARSD_000008 recurrent, found 18 times PubMed: Tarpey 2009 - - Germline - 18/208 cases - 0 - Lucy Raymond
?/. 5 c.661G>A r.(?) p.(Gly221Ser) - VUS g.2836047C>T g.2918006C>T G221S - ARSD_000009 recurrent, found 14 times PubMed: Tarpey 2009 - - Germline - 14/208 cases - 0 - Lucy Raymond
?/. 5 c.667T>A r.(?) p.(Phe223Ile) - VUS g.2836041A>T g.2918000A>T F223I - ARSD_000010 recurrent, found 13 times PubMed: Tarpey 2009 - - Germline - 13/208 cases - 0 - Lucy Raymond
?/. 5 c.667T>C r.(?) p.(Phe223Leu) - VUS g.2836041A>G g.2918000A>G F223L - ARSD_000011 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - Lucy Raymond
?/. 5 c.671C>G r.(?) p.(Ser224Cys) - VUS g.2836037G>C g.2917996G>C S224C - ARSD_000012 recurrent, found 94 times PubMed: Tarpey 2009 - - Germline - 94/208 cases - 0 - Lucy Raymond
?/. 5 c.693C>T r.(?) p.(=) - VUS g.2836015G>A g.2917974G>A T231T - ARSD_000013 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - Lucy Raymond
-?/. - c.693C>T r.(?) p.(Thr231=) - likely benign g.2836015G>A g.2917974G>A ARSD(NM_001669.3):c.693C>T (p.T231=) - ARSD_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 5 c.701_730del r.(?) p.(Ala234_Trp244delinsGly) - VUS g.2835978_2836007del g.2917937_2917966del c.701_730delCCGGCGTGGGCTGCCTGTTTTTCATCTCTT - ARSD_000014 recurrent, found 6 times PubMed: Tarpey 2009 - - Germline - 6/208 cases - 0 - Lucy Raymond
-?/. - c.789C>T r.(?) p.(Asp263=) - likely benign g.2835919G>A g.2917878G>A ARSD(NM_001669.3):c.789C>T (p.D263=) - ARSD_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1000+389_1000+390insTTA r.(=) p.(=) - VUS g.2833208_2833209insAAT g.2915167_2915168insAAT - - ARSD_000066 - - - - Germline - - - - - Yu Sun
?/. - c.1000+390_1000+391insCA r.(=) p.(=) - VUS g.2833207_2833208insGT g.2915166_2915167insGT - - ARSD_000065 - - - - Germline - - - - - Yu Sun
?/. - c.1000+675_1000+676dup r.(=) p.(=) - VUS g.2832922_2832923dup g.2914881_2914882dup - - ARSD_000064 - - - - Germline - - - - - Yu Sun
?/. - c.1000+675_1000+676dup r.(=) p.(=) - VUS g.2832922_2832923dup g.2914881_2914882dup - - ARSD_000064 - - - - Germline - - - - - Yu Sun
?/. - c.1000+715_1000+716dup r.(=) p.(=) - VUS g.2832881_2832882dup g.2914840_2914841dup - - ARSD_000063 - - - - Germline - - - - - Yu Sun
?/. - c.1000+715_1000+716dup r.(=) p.(=) - VUS g.2832881_2832882dup g.2914840_2914841dup - - ARSD_000063 - - - - Germline - - - - - Yu Sun
?/. - c.1000+825C>T r.(=) p.(=) - VUS g.2832772G>A - ARSD(NM_009589.3):c.1043C>T (p.A348V) - ARSD_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1000+989_1000+990insGGGATTAGT r.(=) p.(=) - VUS g.2832610_2832611insAATCCCACT g.2914569_2914570insAATCCCACT - - ARSD_000062 - - - - Germline - - - - - Yu Sun
?/. - c.1136-338_1136-337insTTA r.(=) p.(=) - VUS g.2828359_2828360insATA g.2910318_2910319insATA - - ARSD_000061 - - - - Germline - - - - - Yu Sun
?/. - c.1136-338_1136-337insTTA r.(=) p.(=) - VUS g.2828359_2828360insATA g.2910318_2910319insATA - - ARSD_000061 - - - - Germline - - - - - Yu Sun
-?/. - c.1209G>A r.(?) p.(Pro403=) - likely benign g.2827947C>T - ARSD(NM_001669.3):c.1209G>A (p.P403=) - ARSD_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1600G>A r.(?) p.(Glu534Lys) - likely benign g.2825494C>T g.2907453C>T ARSD(NM_001669.3):c.1600G>A (p.(Glu534Lys)) - ARSD_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.1655G>A r.(?) p.(Arg552Gln) - likely benign g.2825439C>T g.2907398C>T ARSD(NM_001669.3):c.1655G>A (p.R552Q) - ARSD_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 10 c.1691T>C r.(?) p.(Met564Thr) - VUS g.2825403A>G g.2907362A>G M564T - ARSD_000001 recurrent, found 7 times PubMed: Tarpey 2009 - - Germline - 7/208 cases - 0 - Lucy Raymond
-?/. - c.1745T>C r.(?) p.(Phe582Ser) - likely benign g.2825349A>G g.2907308A>G ARSD(NM_001669.3):c.1745T>C (p.(Phe582Ser)) - ARSD_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
Legend   How to query