Full data view for gene ARSD

Information The variants shown are described using the NM_001669.3 transcript reference sequence.

35 entries on 1 page. Showing entries 1 - 35.
Legend   How to query  



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

?/. - c.278G>A r.(?) p.(Arg93Gln) Unknown - VUS g.2839982C>T g.2921941C>T ARSD(NM_001669.3):c.278G>A (p.(Arg93Gln)) - ARSD_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.439+234dup r.(=) p.(=) Unknown - VUS g.2838422dup g.2920381dup - - ARSD_000067 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
./. - c.440-151A>C r.(=) p.(=) Unknown - VUS g.2836419T>G g.2918378T>G - - ARSD_000068 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. 5 c.470C>T r.(?) p.(Ser157Phe) Parent #1 - VUS g.2836238G>A g.2918197G>A S157F - ARSD_000002 recurrent, found 14 times PubMed: Tarpey 2009 - - Germline - 14/208 cases - 0 - DNA SEQ - - MRX;IDX 19377249-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 14 Lucy Raymond
?/. 5 c.497T>A r.(?) p.(Leu166Gln) Parent #1 - VUS g.2836211A>T g.2918170A>T L166Q - ARSD_000003 recurrent, found 16 times PubMed: Tarpey 2009 - - Germline - 16/208 cases - 0 - DNA SEQ - - MRX;IDX 19377250-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 16 Lucy Raymond
?/. 5 c.524G>A r.(?) p.(Gly175Asp) Parent #1 - VUS g.2836184C>T g.2918143C>T G175D - ARSD_000004 recurrent, found 45 times PubMed: Tarpey 2009 - - Germline - 45/208 cases - 0 - DNA SEQ - - MRX;IDX 19377251-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 45 Lucy Raymond
?/. 5 c.527T>A r.(?) p.(Met176Lys) Parent #1 - VUS g.2836181A>T g.2918140A>T M176K - ARSD_000005 recurrent, found 16 times PubMed: Tarpey 2009 - - Germline - 16/208 cases - 0 - DNA SEQ - - MRX;IDX 19377252-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 16 Lucy Raymond
-?/. - c.568C>T r.(?) p.(Pro190Ser) Unknown - likely benign g.2836140G>A - ARSD(NM_001669.3):c.568C>T (p.P190S) - ARSD_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 5 c.570C>T r.(?) p.(=) Parent #1 - VUS g.2836138G>A g.2918097G>A P190P - ARSD_000006 recurrent, found 15 times PubMed: Tarpey 2009 - - Germline - 15/208 cases - 0 - DNA SEQ - - MRX;IDX 19377253-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 15 Lucy Raymond
?/. 5 c.624G>C r.(?) p.(=) Parent #1 - VUS g.2836084C>G g.2918043C>G A208A - ARSD_000007 recurrent, found 17 times PubMed: Tarpey 2009 - - Germline - 17/208 cases - 0 - DNA SEQ - - MRX;IDX 19377254-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 17 Lucy Raymond
?/. 5 c.648C>T r.(?) p.(=) Parent #1 - VUS g.2836060G>A g.2918019G>A A216A - ARSD_000008 recurrent, found 18 times PubMed: Tarpey 2009 - - Germline - 18/208 cases - 0 - DNA SEQ - - MRX;IDX 19377255-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 18 Lucy Raymond
?/. 5 c.661G>A r.(?) p.(Gly221Ser) Parent #1 - VUS g.2836047C>T g.2918006C>T G221S - ARSD_000009 recurrent, found 14 times PubMed: Tarpey 2009 - - Germline - 14/208 cases - 0 - DNA SEQ - - MRX;IDX 19377256-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 14 Lucy Raymond
?/. 5 c.667T>A r.(?) p.(Phe223Ile) Parent #1 - VUS g.2836041A>T g.2918000A>T F223I - ARSD_000010 recurrent, found 13 times PubMed: Tarpey 2009 - - Germline - 13/208 cases - 0 - DNA SEQ - - MRX;IDX 19377257-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 13 Lucy Raymond
?/. 5 c.667T>C r.(?) p.(Phe223Leu) Parent #1 - VUS g.2836041A>G g.2918000A>G F223L - ARSD_000011 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - DNA SEQ - - MRX;IDX 19377258-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 2 Lucy Raymond
?/. 5 c.671C>G r.(?) p.(Ser224Cys) Parent #1 - VUS g.2836037G>C g.2917996G>C S224C - ARSD_000012 recurrent, found 94 times PubMed: Tarpey 2009 - - Germline - 94/208 cases - 0 - DNA SEQ - - MRX;IDX 19377259-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 94 Lucy Raymond
?/. 5 c.693C>T r.(?) p.(=) Parent #1 - VUS g.2836015G>A g.2917974G>A T231T - ARSD_000013 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - DNA SEQ - - MRX;IDX 19377247-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 2 Lucy Raymond
-?/. - c.693C>T r.(?) p.(Thr231=) Unknown - likely benign g.2836015G>A g.2917974G>A ARSD(NM_001669.3):c.693C>T (p.T231=) - ARSD_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 5 c.701_730del r.(?) p.(Ala234_Trp244delinsGly) Parent #1 - VUS g.2835978_2836007del g.2917937_2917966del c.701_730delCCGGCGTGGGCTGCCTGTTTTTCATCTCTT - ARSD_000014 recurrent, found 6 times PubMed: Tarpey 2009 - - Germline - 6/208 cases - 0 - DNA SEQ - - MRX;IDX 19377248-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 6 Lucy Raymond
-?/. - c.789C>T r.(?) p.(Asp263=) Unknown - likely benign g.2835919G>A g.2917878G>A ARSD(NM_001669.3):c.789C>T (p.D263=) - ARSD_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1000+389_1000+390insTTA r.(=) p.(=) Unknown - VUS g.2833208_2833209insAAT g.2915167_2915168insAAT - - ARSD_000066 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1000+390_1000+391insCA r.(=) p.(=) Unknown - VUS g.2833207_2833208insGT g.2915166_2915167insGT - - ARSD_000065 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1000+675_1000+676dup r.(=) p.(=) Unknown - VUS g.2832922_2832923dup g.2914881_2914882dup - - ARSD_000064 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1000+675_1000+676dup r.(=) p.(=) Unknown - VUS g.2832922_2832923dup g.2914881_2914882dup - - ARSD_000064 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1000+715_1000+716dup r.(=) p.(=) Unknown - VUS g.2832881_2832882dup g.2914840_2914841dup - - ARSD_000063 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1000+715_1000+716dup r.(=) p.(=) Unknown - VUS g.2832881_2832882dup g.2914840_2914841dup - - ARSD_000063 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1000+825C>T r.(=) p.(=) Unknown - VUS g.2832772G>A - ARSD(NM_009589.3):c.1043C>T (p.A348V) - ARSD_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1000+989_1000+990insGGGATTAGT r.(=) p.(=) Unknown - VUS g.2832610_2832611insAATCCCACT g.2914569_2914570insAATCCCACT - - ARSD_000062 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-?/. - c.1122C>T r.(?) p.(Asn374=) Unknown - likely benign g.2828713G>A - ARSD(NM_001669.3):c.1122C>T (p.N374=) - ARSD_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1136-338_1136-337insTTA r.(=) p.(=) Maternal (inferred) - VUS g.2828359_2828360insATA g.2910318_2910319insATA - - ARSD_000061 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1136-338_1136-337insTTA r.(=) p.(=) Maternal (inferred) - VUS g.2828359_2828360insATA g.2910318_2910319insATA - - ARSD_000061 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-?/. - c.1209G>A r.(?) p.(Pro403=) Unknown - likely benign g.2827947C>T - ARSD(NM_001669.3):c.1209G>A (p.P403=) - ARSD_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1600G>A r.(?) p.(Glu534Lys) Unknown - likely benign g.2825494C>T g.2907453C>T ARSD(NM_001669.3):c.1600G>A (p.(Glu534Lys)) - ARSD_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1655G>A r.(?) p.(Arg552Gln) Unknown - likely benign g.2825439C>T g.2907398C>T ARSD(NM_001669.3):c.1655G>A (p.R552Q) - ARSD_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 10 c.1691T>C r.(?) p.(Met564Thr) Parent #1 - VUS g.2825403A>G g.2907362A>G M564T - ARSD_000001 recurrent, found 7 times PubMed: Tarpey 2009 - - Germline - 7/208 cases - 0 - DNA SEQ - - MRX;IDX 19377260-Pat? PubMed: Tarpey 2009 - ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 7 Lucy Raymond
-?/. - c.1745T>C r.(?) p.(Phe582Ser) Unknown - likely benign g.2825349A>G g.2907308A>G ARSD(NM_001669.3):c.1745T>C (p.(Phe582Ser)) - ARSD_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query