Unique variants in the BCAP31 gene

Information The variants shown are described using the NM_001256447.1 transcript reference sequence.

108 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. 1 - c.-457_*445= r.0 p.0 - pathogenic (recessive) g.(152965947_152989556)= - - - BCAP31_000046 allel not expressed due to non-random X-inactivation PubMed: Kao 2020 - - Somatic - - - - - Johan den Dunnen
+/. 1 - c.341+3643_*445{0} r.? p.? - pathogenic (recessive) g.152958460_152977354del g.153693005_153711899del - - BCAP31_000042 - PubMed: Osaka 2012 - - De novo - - - - - Johan den Dunnen
+/. 4 - c.702+318_*445{0} r.? p.? - pathogenic (recessive) g.152961800_152967144del g.153696345_153701689del del ex8 - BCAP31_000041 SLC6A8 transcript level 0.46 PubMed: Cacciagli 2013 - - Germline - - - - - Johan den Dunnen
+?/. 1 - c.705_*4del r.(?) p.(Ala236_Glu246delinsSerPheLeuProCysLeuGlnLeuAlaSerThrTrpHisValProAlaAlaSer) ACMG likely pathogenic g.152966388_152966428del g.153700933_153700973del chrX:GGCCCTTACTCTTCCTTCTTGTCCATGGGACCATCTACTGCA>G - BCAP31_000052 - - - - Germline - - - - - Laurent Villard
-?/. 1 - c.-5089G>A r.(?) p.(=) - likely benign g.152994833C>T - ABCD1(NM_000033.3):c.1047C>T (p.V349=) - ABCD1_000148 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-5089G>T r.(?) p.(=) - likely benign g.152994833C>A g.153729378C>A ABCD1(NM_000033.3):c.1047C>A (p.(Val349=)) - BCAP31_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-4938G>A r.(?) p.(=) - likely benign g.152994682C>T g.153729227C>T ABCD1(NM_000033.3):c.901-5C>T (p.?) - ABCD1_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 - c.-4938G>T r.(?) p.(=) - likely pathogenic g.152994682C>A g.153729227C>A - - ABCD1_000104 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-4933G>A r.(?) p.(=) - likely benign g.152994677C>T - ABCD1(NM_000033.3):c.901-10C>T (p.(=)) - ABCD1_000153 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 2 - c.-4927G>A r.(?) p.(=) - likely benign g.152994671C>T g.153729216C>T ABCD1(NM_000033.3):c.901-16C>T (p.(=)), ABCD1(NM_000033.4):c.901-16C>T - BCAP31_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
?/. 2 - c.-1873T>C r.(?) p.(=) - VUS g.152991617A>G g.153726162A>G ABCD1(NM_000033.3):c.896A>G (p.H299R, p.(His299Arg)) - BCAP31_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 1 - c.-1872G>A r.(?) p.(=) - likely benign g.152991616C>T - ABCD1(NM_000033.4):c.895C>T (p.H299Y) - ABCD1_000177 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/. 1 - c.-1869C>T r.(?) p.(=) - likely pathogenic g.152991613G>A g.153726158G>A - - ABCD1_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.-1857C>T r.(?) p.(=) - likely pathogenic g.152991601G>A - ABCD1(NM_000033.4):c.880G>A (p.A294T) - ABCD1_000165 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 1 - c.-1828G>T r.(?) p.(=) - pathogenic g.152991572C>A - - - ABCD1_000138 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-1826G>A r.(?) p.(=) - likely benign g.152991570C>T g.153726115C>T ABCD1(NM_000033.3):c.849C>T (p.H283=) - ABCD1_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-1825T>C r.(?) p.(=) - VUS g.152991569A>G g.153726114A>G - - ABCD1_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.-1820G>T r.(?) p.(=) - pathogenic g.152991564C>A - - - ABCD1_000134 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.-1815G>A r.(?) p.(=) - VUS g.152991559C>T g.153726104C>T - - ABCD1_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.-1797G>A r.(?) p.(=) - VUS g.152991541C>T - - - ABCD1_000147 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.-1773C>T r.(?) p.(=) - likely pathogenic g.152991517G>A - - - ABCD1_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 4 - c.-1734G>C r.(?) p.(=) - likely benign g.152991478C>G g.153726023C>G ABCD1(NM_000033.3):c.757C>G (p.L253V, p.(Leu253Val)), ABCD1(NM_000033.4):c.757C>G (p.L253V) - ABCD1_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht
?/. 1 - c.-1719C>T r.(?) p.(=) - VUS g.152991463G>A - ABCD1(NM_000033.3):c.742G>A (p.G248S) - ABCD1_000129 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-1708G>A r.(?) p.(=) - VUS g.152991452C>T - ABCD1(NM_000033.3):c.731C>T (p.S244L) - ABCD1_000137 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 2 - c.-1684C>T r.(?) p.(=) - likely benign, VUS g.152991428G>A g.153725973G>A ABCD1(NM_000033.3):c.707G>A (p.(Arg236His)), ABCD1(NM_000033.4):c.707G>A (p.R236H) - BCAP31_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen
?/. 1 - c.-1681G>A r.(?) p.(=) - VUS g.152991425C>T - - - ABCD1_000136 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 2 - c.-1677G>A r.(?) p.(=) - likely pathogenic g.152991421C>T - ABCD1(NM_000033.4):c.700C>T (p.R234C) - ABCD1_000169 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_VUmc
-?/. 1 - c.-1673C>A r.(?) p.(=) - likely benign g.152991417G>T - ABCD1(NM_000033.3):c.696G>T (p.(Ala232=)) - ABCD1_000183 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.-1636A>G r.(?) p.(=) - pathogenic g.152991380T>C g.153725925T>C - - ABCD1_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.-1549C>T r.(?) p.(=) - VUS g.152991293G>A - ABCD1(NM_000033.3):c.572G>A (p.R191H) - ABCD1_000146 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.-1542del r.(?) p.(=) - pathogenic g.152991286del g.153725831del ABCD1(NM_000033.4):c.565delC (p.R189Gfs*9) - BCAP31_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.-1539C>T r.(?) p.(=) - VUS g.152991283G>A g.153725828G>A ABCD1(NM_000033.3):c.562G>A (p.G188R) - ABCD1_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-1538G>A r.(?) p.(=) - likely benign g.152991282C>T g.153725827C>T ABCD1(NM_000033.3):c.561C>T (p.D187=) - BCAP31_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.-1506G>A r.(?) p.(=) - pathogenic g.152991250C>T g.153725795C>T - - ABCD1_000099 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.-1470G>A r.(?) p.(=) - VUS g.152991214C>T g.153725759C>T - - ABCD1_000098 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-1452C>T r.(?) p.(=) - likely benign g.152991196G>A g.153725741G>A ABCD1(NM_000033.3):c.475G>A (p.A159T) - BCAP31_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-1451C>T r.(?) p.(=) - likely benign g.152991195G>A g.153725740G>A ABCD1(NM_000033.3):c.474G>A (p.L158=) - BCAP31_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.-1431G>A r.(?) p.(=) - pathogenic g.152991175C>T g.153725720C>T - - BCAP31_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.-1423C>T r.(?) p.(=) - likely pathogenic g.152991167G>A - - - ABCD1_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-1416C>T r.(?) p.(=) - likely benign g.152991160G>A - ABCD1(NM_000033.3):c.439G>A (p.(Val147Ile)) - ABCD1_000168 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-1399G>T r.(?) p.(=) - VUS g.152991143C>A g.153725688C>A - - ABCD1_000097 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/., ?/. 2 - c.-1369C>A r.(?) p.(=) - likely benign, VUS g.152991113G>T g.153725658G>T ABCD1(NM_000033.3):c.392G>T (p.G131V, p.(Gly131Val)) - ABCD1_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 1 - c.-1343G>T r.(?) p.(=) - likely benign g.152991087C>A g.153725632C>A ABCD1(NM_000033.3):c.366C>A (p.I122=) - ABCD1_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-1336C>T r.(?) p.(=) - VUS g.152991080G>A g.153725625G>A - - ABCD1_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-1333G>A r.(?) p.(=) - likely benign g.152991077C>T - ABCD1(NM_000033.3):c.356C>T (p.(Ala119Val)) - ABCD1_000181 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.-1314G>A r.(?) p.(=) - pathogenic g.152991058C>T g.153725603C>T ABCD1(NM_000033.3):c.337C>T (p.R113C) - BCAP31_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.-1291G>A r.(?) p.(=) - pathogenic g.152991035C>T g.153725580C>T - - BCAP31_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.-1277G>C r.(?) p.(=) - VUS g.152991021C>G g.153725566C>G - - ABCD1_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-1274G>A r.(?) p.(=) - likely benign g.152991018C>T g.153725563C>T ABCD1(NM_000033.3):c.297C>T (p.A99=) - BCAP31_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.-1270G>C r.(?) p.(=) - likely pathogenic g.152991014C>G g.153725559C>G - - ABCD1_000094 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.-1267T>G r.(?) p.(=) - likely pathogenic g.152991011A>C g.153725556A>C - - ABCD1_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-1251C>T r.(?) p.(=) - likely benign g.152990995G>A - - - ABCD1_000171 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 2 - c.-1243C>T r.(?) p.(=) - VUS g.152990987G>A g.153725532G>A ABCD1(NM_000033.4):c.266G>A (p.R89Q) - ABCD1_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen
-?/. 2 - c.-1235G>A r.(?) p.(=) - likely benign g.152990979C>T - ABCD1(NM_000033.3):c.258C>T (p.V86=, p.(Val86=)) - ABCD1_000135 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 1 - c.-1226G>A r.(?) p.(=) - likely benign g.152990970C>T - ABCD1(NM_000033.3):c.249C>T (p.F83=) - ABCD1_000128 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-1185C>G r.(?) p.(=) - likely benign g.152990929G>C g.153725474G>C - - ABCD1_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.-1155C>G r.(?) p.(=) - VUS g.152990899G>C - ABCD1(NM_000033.3):c.178G>C (p.(Val60Leu)) - ABCD1_000180 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-1093C>A r.(?) p.(=) - likely benign g.152990837G>T - ABCD1(NM_000033.3):c.116G>T (p.C39F) - ABCD1_000152 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.-1018G>C r.(?) p.(=) - likely benign g.152990762C>G g.153725307C>G ABCD1(NM_000033.3):c.41C>G (p.T14R) - ABCD1_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
-?/. 2 - c.-1017T>C r.(?) p.(=) - likely benign g.152990761A>G g.153725306A>G ABCD1(NM_000033.3):c.40A>G (p.T14A, p.(Thr14Ala)) - ABCD1_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 5 - c.-1015T>G r.(?) p.(=) - likely benign g.152990759A>C g.153725304A>C ABCD1(NM_000033.3):c.38A>C (p.N13T, p.(Asn13Thr)), ABCD1(NM_000033.4):c.38A>C (p.N13T) - BCAP31_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_AMC
-?/. 1 - c.-1013C>T r.(?) p.(=) - likely benign g.152990757G>A - ABCD1(NM_000033.3):c.36G>A (p.G12=) - ABCD1_000133 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-1008G>C r.(?) p.(=) - VUS g.152990752C>G g.153725297C>G ABCD1(NM_000033.3):c.31C>G (p.R11G) - BCAP31_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.-978T>C r.(?) p.(=) - pathogenic g.152990722A>G g.153725267A>G - - ABCD1_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.-620162_*255586dup r.0? p.0? - pathogenic g.152710806_153609906dup - MECP2 - MECP2_002820 - PubMed: Hu 2016 - - Germline yes - - - - Johan den Dunnen
?/. 2 - c.-86T>G r.(=) p.(=) - VUS g.152989830A>C g.153724375A>C - - BCAP31_000001 - - - - Germline - - - - - Yu Sun
-?/. 1 - c.-45+326C>A r.(=) p.(=) - likely benign g.152989463G>T g.153724008G>T BCAP31(NM_001139441.1):c.-45+8C>A (p.(=)) - BCAP31_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/., ?/. 2 - c.-44-238C>T r.(=) p.(=) - likely benign, VUS g.152988981G>A g.153723526G>A BCAP31(NM_001139457.2):c.139C>T (p.H47Y, p.(His47Tyr)) - BCAP31_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
?/. 1 - c.-44-223G>A r.(=) p.(=) - VUS g.152988966C>T g.153723511C>T BCAP31(NM_001139457.2):c.154G>A (p.(Ala52Thr)) - BCAP31_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/., ?/. 2 - c.-12_-10del r.(?) p.(=) - likely benign, VUS g.152988711_152988713del g.153723256_153723258del BCAP31(NM_001139457.2):c.190_192delTCT (p.S65del) - BCAP31_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
+?/. 1 - c.3G>C r.(?) p.0? ACMG likely pathogenic g.152988697C>G g.153723242C>G - - BCAP31_000049 - - - - Germline - - - - - Laurent Villard
+?/. 1 - c.47T>A r.(?) p.(Val16Asp) ACMG likely pathogenic g.152988653A>T - - - BCAP31_000047 - - - - Germline - - - - - Marie Shaw
+/. 1 - c.60_65del r.(?) p.(Leu20_Leu22delinsPhe) - pathogenic (recessive) g.152988635_152988640del - 261_266delGCTTCT - BCAP31_000043 - PubMed: Vittal 2015 - - Germline - - - - - Johan den Dunnen
+/. 2 - c.92G>A r.(?), r.[-44_92del,292_292ins92+1_92+110] p.(Arg31Lys), p.[0,?] ACMG pathogenic, pathogenic (recessive) g.152988608C>T g.153723153C>T - - BCAP31_000038 ACMG criteria PS2, PS3, PM2, PP3, PP4 PubMed: Kao 2020 - - De novo - - - - - Johan den Dunnen, Ni-Chung Lee
+?/. 2 - c.92+1G>A r.spl p.? ACMG likely pathogenic g.152988607C>T g.153723152C>T - - BCAP31_000059 - - - - Germline - - - - - Laurent Villard
-?/. 1 - c.92+4T>C r.spl? p.? - likely benign g.152988604A>G g.153723149A>G BCAP31(NM_001139457.2):c.293+4T>C - BCAP31_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.92+545_194-1172del r.(?) p.(Trp32Cysfs*9) ACMG likely pathogenic g.152982315_152988064del g.153716860_153722609del - - BCAP31_000060 - - - - Germline - - - - - Laurent Villard
+/. 2 - c.97C>T r.(?) p.(Gln33*) - pathogenic (recessive) g.152986423G>A g.153720968G>A 97C>T - BCAP31_000045 - PubMed: Cacciagli 2013, PubMed: Shimizu 2020 - - De novo, Germline - - - - - Johan den Dunnen
?/. 1 - c.116G>A r.(?) p.(Arg39Gln) - VUS g.152986404C>T g.153720949C>T BCAP31(NM_001139441.1):c.116G>A (p.(Arg39Gln)) - BCAP31_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 4 - c.137C>A r.(?) p.(Ser46Tyr) ACMG likely pathogenic g.152986383G>T g.153720928G>T - - BCAP31_000040 - - - - Germline, Germline/De novo (untested) yes - - - - Marie Shaw
-?/. 1 - c.192C>T r.(?) p.(Ile64=) - likely benign g.152986328G>A g.153720873G>A BCAP31(NM_001139457.2):c.393C>T (p.I131=) - BCAP31_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 - c.194-2A>G r.193_194ins[194-41_194-3;gg] p.? - pathogenic (recessive) g.152981146T>C g.153715691T>C 194-2A>G - BCAP31_000048 - PubMed: Cacciagli 2013 - - Germline - - - - - Johan den Dunnen
?/. 2 - c.230C>T r.(?) p.(Thr77Met) - VUS g.152981108G>A g.153715653G>A BCAP31(NM_001139441.1):c.230C>T (p.T77M), BCAP31(NM_001139457.2):c.431C>T (p.T144M) - BCAP31_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
?/. 1 - c.254A>G r.(?) p.(Asn85Ser) - VUS g.152981084T>C g.153715629T>C BCAP31(NM_001139457.2):c.455A>G (p.N152S) - BCAP31_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 - c.332_335dup r.(?) p.(Ser113Alafs*6) - pathogenic, pathogenic (recessive) g.152981003_152981006dup g.153715548_153715551dup 332_335dupTGCT - BCAP31_000012 - PubMed: Albanyan 2017, PubMed: Lionel 2018 - - Germline, Germline/De novo (untested) - - - - - Johan den Dunnen
-?/. 1 - c.342C>T r.(?) p.(Phe114=) - likely benign g.152969549G>A - BCAP31(NM_001139441.1):c.342C>T (p.F114=) - BCAP31_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.350G>A r.(?) p.(Arg117Lys) - VUS g.152969541C>T - BCAP31(NM_001139441.1):c.350G>A (p.R117K) - BCAP31_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.353G>A r.(?) p.(Arg118His) - VUS g.152969538C>T g.153704083C>T BCAP31(NM_001139457.2):c.554G>A (p.R185H) - BCAP31_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.361A>T r.(?) p.(Thr121Ser) - likely benign g.152969530T>A g.153704075T>A BCAP31(NM_001139441.1):c.361A>T (p.(Thr121Ser)), BCAP31(NM_001139457.2):c.562A>T (p.T188S) - BCAP31_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
+?/. 2 - c.365_366del r.(?) p.(Leu122Hisfs*12) ACMG likely pathogenic g.152969528_152969529del g.153704073_153704074del chrX:152969524TGA>T - BCAP31_000053 - - - - De novo, Germline - - - - - Laurent Villard
+?/. 1 - c.380_383dup r.(?) p.(Leu129Hisfs*7) ACMG likely pathogenic g.152969508_152969511dup g.153704053_153704056dup chrX:152969507C>CGTGG - BCAP31_000051 - - - - Unknown - - - - - Laurent Villard
-?/. 2 - c.383C>T r.(?) p.(Thr128Met) - likely benign g.152969508G>A g.153704053G>A BCAP31(NM_001139441.1):c.383C>T (p.(Thr128Met)), BCAP31(NM_001139457.2):c.584C>T (p.T195M) - BCAP31_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 2 - c.384G>A r.(?) p.(Thr128=) - likely benign g.152969507C>T g.153704052C>T BCAP31(NM_001139441.1):c.384G>A (p.T128=), BCAP31(NM_001139457.2):c.585G>A (p.T195=) - BCAP31_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/. 1 - c.393C>T r.(?) p.(Ala131=) - likely benign g.152969498G>A g.153704043G>A BCAP31(NM_001139457.2):c.594C>T (p.A198=) - BCAP31_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.415C>T r.(?) p.(Gln139Ter) - pathogenic g.152969476G>A g.153704021G>A - - BCAP31_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.445A>T r.(?) p.(Lys149*) ACMG likely pathogenic g.152969446T>A g.153703991T>A - - BCAP31_000057 - - - - Germline - - - - - Laurent Villard
+?/. 1 - c.466C>T r.(?) p.(Gln156*) ACMG likely pathogenic g.152969425G>A g.153703970G>A - - BCAP31_000058 - - - - Germline - - - - - Laurent Villard
?/. 1 - c.580G>A r.(?) p.(Glu194Lys) - VUS g.152968411C>T g.153702956C>T BCAP31(NM_001139457.2):c.781G>A (p.E261K) - BCAP31_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.601+9C>T r.(=) p.(=) - likely benign g.152968381G>A - BCAP31(NM_001139457.2):c.802+9C>T - BCAP31_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.601+10G>A r.(=) p.(=) - likely benign g.152968380C>T - BCAP31(NM_001139457.2):c.802+10G>A - BCAP31_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query   « First ‹ Prev     1 2     Next › Last »


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.