Unique variants in the CCDC15 gene

Information The variants shown are described using the NM_025004.2 transcript reference sequence.

3 entries on 1 page. Showing entries 1 - 3.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
./. 1 - c.497T>G r.(?) p.(Phe166Cys) - VUS g.124829880T>G g.124959984T>G NM_025004.2:c.497T>G (Phe166Cys) - CCDC15_000001 variant not associated with phenotype PubMed: de Ligt 2012 - - De novo - - - - - Johan den Dunnen
?/. 1 - c.1126_1146del r.(?) p.(Ala376_Gln382del) - VUS g.124857248_124857268del g.124987352_124987372del CCDC15(NM_025004.2):c.1126_1146delGCCATTGAGCCAGAAGGCCAG (p.A376_Q382del) - CCDC15_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1932C>G r.(?) p.(Tyr644Ter) - VUS g.124861380C>G g.124991484C>G CCDC15(NM_025004.2):c.1932C>G (p.Y644*) - CCDC15_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.