Unique variants in the CFB gene

Information The variants shown are described using the NM_001710.5 transcript reference sequence.

76 entries on 1 page. Showing entries 1 - 76.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. 1 - c.-3237_-3234del r.(?) p.(=) - pathogenic g.31910762_31910765del - C2(NM_001282458.1):c.1159_1162delCTGG (p.L387Mfs*7) - C2_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.-3061G>T r.(?) p.(=) - benign g.31910938G>T g.31943161G>T C2(NM_000063.4):c.1360+62G>T - C2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.-3001A>G r.(?) p.(=) - likely benign g.31910998A>G g.31943221A>G C2(NM_000063.4):c.1361-4A>G - C2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/., ?/. 2 - c.-2969C>T r.(?) p.(=) - likely benign, VUS g.31911030C>T g.31943253C>T C2(NM_001282458.2):c.1302C>T (p.C434=) - C2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen
-?/. 1 - c.-2944G>A r.(?) p.(=) - likely benign g.31911055G>A - C2(NM_000063.4):c.1414G>A (p.A472T) - C2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.-2768C>T r.(?) p.(=) - likely benign g.31911231C>T - C2(NM_001282458.1):c.1407C>T (p.S469=) - C2_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-2767G>A r.(?) p.(=) - likely benign g.31911232G>A g.31943455G>A C2(NM_000063.4):c.1495G>A (p.D499N) - C2_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.-2673_-2652del r.(?) p.(=) - likely benign g.31911326_31911347del - C2(NM_000063.4):c.1567+22_1567+43delCCTCCTGATCCTGAAGCCACAG (p.?) - C2_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-2569A>G r.(?) p.(=) - likely benign g.31911430A>G - C2(NM_000063.4):c.1577A>G (p.K526R) - C2_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.-2430G>C r.(?) p.(=) - VUS g.31911569G>C g.31943792G>C C2(NM_001282458.2):c.1629G>C (p.K543N) - C2_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.-2090T>C r.(?) p.(=) - VUS g.31911909T>C - - - C2_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 1 - c.-1990G>C r.(?) p.(=) - benign g.31912009G>C g.31944232G>C C2(NM_000063.4):c.1902+6G>C - C2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 2 - c.-1476T>C r.(?) p.(=) - benign g.31912523T>C g.31944746T>C C2(NM_000063.4):c.1922T>C (p.V641A) - C2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-/. 1 - c.-1226A>G r.(?) p.(=) - benign g.31912773A>G g.31944996A>G C2(NM_001282458.1):c.1959A>G (p.A653=) - C2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 2 - c.-953C>T r.(?) p.(=) - likely benign, VUS g.31913046C>T g.31945269C>T C2(NM_000063.6):c.2171C>T (p.P724L), C2(NM_001282458.1):c.2084C>T (p.P695L) - C2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-/., -?/. 4 - c.26T>A r.(?) p.(Leu9His) - benign, likely benign g.31914024T>A g.31946247T>A CFB(NM_001710.5):c.26T>A (p.(Leu9His), p.L9H), CFB(NM_001710.6):c.26T>A (p.L9H) - CFB_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
?/. 1 - c.82T>C r.(?) p.(Trp28Arg) - VUS g.31914167T>C - - - C2_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/., ?/. 2 - c.94C>T r.(?) p.(Arg32Trp) - benign, VUS g.31914179C>T g.31946402C>T CFB(NM_001710.5):c.94C>T (p.R32W) - CFB_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
-/. 2 - c.95G>A r.(?) p.(Arg32Gln) - benign g.31914180G>A g.31946403G>A CFB(NM_001710.5):c.95G>A (p.R32Q) - CFB_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-?/. 1 - c.166C>G r.(?) p.(Gln56Glu) - likely benign g.31914251C>G - CFB(NM_001710.5):c.166C>G (p.(Gln56Glu)) - C2_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.274A>T r.(?) p.(Thr92Ser) - likely benign g.31914359A>T - CFB(NM_001710.5):c.274A>T (p.T92S) - C2_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.291G>A r.(?) p.(Glu97=) - likely benign g.31914376G>A - - - C2_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.362A>G r.(?) p.(Tyr121Cys) - VUS g.31914847A>G - CFB(NM_001710.6):c.362A>G (p.Y121C) - C2_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.394T>C r.(?) p.(Tyr132His) - VUS g.31914879T>C g.31947102T>C CFB(NM_001710.5):c.394T>C (p.Y132H) - C2_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 2 - c.405C>T r.(?) p.(Tyr135=) - benign g.31914890C>T g.31947113C>T CFB(NM_001710.5):c.405C>T (p.Y135=) - CFB_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-/., ./. 3 - c.450A>G r.(=), r.(?) p.(=), p.(Arg150=) - benign, VUS g.31914935A>G g.31947158A>G - - CFB_000017 VKGL data sharing initiative Nederland, for details see the Uveogene database, 1 more item PubMed: Liu 2016, PubMed: Pang 2012 - rs1048709 CLASSIFICATION record, Germline - 66/186 cases, 85/196 cases - - - VKGL-NL_Nijmegen, Peizeng Yang
-/. 2 - c.504G>A r.(?) p.(Pro168=) - benign g.31915144G>A g.31947367G>A CFB(NM_001710.5):c.504G>A (p.P168=) - CFB_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
?/. 1 - c.511C>A r.(?) p.(Pro171Thr) - VUS g.31915151C>A - CFB(NM_001710.6):c.511C>A (p.P171T) - C2_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 2 - c.559G>A r.(?) p.(Val187Ile) - VUS g.31915199G>A - CFB(NM_001710.6):c.559G>A (p.V187I) - C2_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen
-/., -?/. 2 - c.600C>T r.(?) p.(Ser200=) - benign, likely benign g.31915240C>T g.31947463C>T CFB(NM_001710.5):c.600C>T (p.S200=) - CFB_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
?/. 1 - c.641C>T r.(?) p.(Thr214Met) - VUS g.31915281C>T - CFB(NM_001710.5):c.641C>T (p.T214M) - C2_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 2 - c.672C>T r.(?) p.(Tyr224=) - benign g.31915532C>T g.31947755C>T CFB(NM_001710.5):c.672C>T (p.Y224=) - CFB_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
?/. 1 - c.673G>A r.(?) p.(Asp225Asn) - VUS g.31915533G>A - CFB(NM_001710.5):c.673G>A (p.D225N) - C2_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.704T>C r.(?) p.(Leu235Pro) - VUS g.31915564T>C - CFB(NM_001710.5):c.704T>C (p.L235P) - C2_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 1 - c.720G>A r.(?) p.(Glu240=) - benign g.31915580G>A g.31947803G>A - - C2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/., ?/. 5 - c.724A>C r.(?) p.(Ile242Leu) - likely benign, VUS g.31915584A>C g.31947807A>C CFB(NM_001710.5):c.724A>C (p.I242L, p.(Ile242Leu)), CFB(NM_001710.6):c.724A>C (p.I242L) - C2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
?/. 1 - c.736G>A r.(?) p.(Asp246Asn) - VUS g.31915596G>A - - - C2_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/., -?/. 2 - c.754G>A r.(?) p.(Gly252Ser) - benign, likely benign g.31915614G>A g.31947837G>A - - CFB_000018 12 heterozygous, no homozygous; Clinindb (India), VKGL data sharing initiative Nederland PubMed: Narang 2020, Journal: Narang 2020 - rs4151651 CLASSIFICATION record, Germline - 12/2795 individuals - - - VKGL-NL_Nijmegen, Mohammed Faruq
-/. 2 - c.858C>T r.(?) p.(Phe286=) - benign g.31915819C>T g.31948042C>T CFB(NM_001710.5):c.858C>T (p.F286=) - C2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-?/. 1 - c.897+17_897+20del r.(=) p.(=) - likely benign g.31915875_31915878del - CFB(NM_001710.5):c.897+17_897+20delCCTG - C2_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 1 - c.898-138T>C r.(=) p.(=) - benign g.31916013T>C g.31948236T>C CFB(NM_001710.5):c.898-138T>C - CFB_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.978A>C r.(?) p.(Glu326Asp) - likely benign g.31916231A>C - CFB(NM_001710.5):c.978A>C (p.E326D) - C2_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.1015C>T r.(?) p.(Leu339Phe) - VUS g.31916268C>T - - - C2_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/., ?/. 3 - c.1037-10C>G r.(=) p.(=) - likely benign, VUS g.31916597C>G g.31948820C>G CFB(NM_001710.5):c.1037-10C>G - C2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
?/. 1 - c.1074C>T r.(?) p.(Ala358=) - VUS g.31916644C>T g.31948867C>T - - C2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/., ?/. 2 - c.1106C>T r.(?) p.(Pro369Leu) - likely benign, VUS g.31916676C>T - CFB(NM_001710.5):c.1106C>T (p.P369L) - C2_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-/., -?/. 3 - c.1137C>T r.(=), r.(?) p.(=), p.(Arg379=) - benign, likely benign g.31916707C>T g.31948930C>T - - C2_000022 2 homozygous; Clinindb (India), 83 heterozygous; Clinindb (India), 1 more item PubMed: Narang 2020, Journal: Narang 2020 - rs45600936 CLASSIFICATION record, Germline - 2/2795 individuals, 83/2795 individuals - - - VKGL-NL_Nijmegen, Mohammed Faruq
-?/. 3 - c.1143C>T r.(?) p.(Arg381=) - likely benign g.31916713C>T g.31948936C>T CFB(NM_001710.5):c.1143C>T (p.R381=) - CFB_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
?/. 1 - c.1151T>C r.(?) p.(Ile384Thr) - VUS g.31916721T>C - CFB(NM_001710.6):c.1151T>C (p.I384T) - C2_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.1169-35T>A r.(=) p.(=) - benign g.31916985T>A g.31949208T>A CFB(NM_001710.5):c.1169-35T>A - CFB_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.1217G>A r.(?) p.(Arg406Gln) - VUS g.31917068G>A - - - C2_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.1341C>A r.(?) p.(Asp447Glu) - VUS g.31917267C>A - - - C2_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 2 - c.1365C>T r.(?) p.(Val455=) - benign g.31917291C>T g.31949514C>T CFB(NM_001710.5):c.1365C>T (p.V455=) - CFB_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
?/. 1 - c.1374G>A r.(?) p.(Met458Ile) - VUS g.31917300G>A - - - C2_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 2 - c.1408+7A>C r.(=) p.(=) - likely benign g.31917341A>C g.31949564A>C CFB(NM_001710.5):c.1408+7A>C - C2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
?/. 1 - c.1464C>T r.(?) p.(Thr488=) - VUS g.31917882C>T - - - C2_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 3 - c.1524C>T r.(?) p.(His508=) - likely benign g.31918080C>T g.31950303C>T CFB(NM_001710.5):c.1524C>T (p.H508=) - CFB_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-?/. 1 - c.1548G>A r.(?) p.(Val516=) - likely benign g.31918104G>A - CFB(NM_001710.5):c.1548G>A (p.V516=) - C2_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/., -?/., ?/. 4 - c.1598A>G r.(?) p.(Lys533Arg) - likely benign, likely pathogenic, VUS g.31918154A>G g.31950377A>G CFB(NM_001710.5):c.1598 A>G(p.K533R), 1 more item - C2_000024 VKGL data sharing initiative Nederland PubMed: Sun 2018 - - CLASSIFICATION record, Germline/De novo (untested) ? 187 - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_VUmc
-?/. 1 - c.1693A>G r.(?) p.(Lys565Glu) - likely benign g.31918464A>G g.31950687A>G - - CFB_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/., -?/. 5 - c.1697A>C r.(?) p.(Glu566Ala) - likely benign, likely pathogenic g.31918468A>C g.31950691A>C CFB (NM_001710.5):c.1697A>C (p.E566A), CFB(NM_001710.5):c.1697A>C (p.E566A) - CFB_000011 2 homozygous; Clinindb (India), 83 heterozygous; Clinindb (India), 1 more item PubMed: Narang 2020, Journal: Narang 2020, PubMed: Sun 2018 - rs45484591 CLASSIFICATION record, Germline, Germline/De novo (untested) ? 2/2793 individuals, 205, 83/2793 individuals - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen, Mohammed Faruq
?/. 1 - c.1705A>C r.(?) p.(Ile569Leu) - VUS g.31918476A>C g.31950699A>C - - CFB_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 2 - c.1729G>A r.(?) p.(Val577Ile) - VUS g.31918500G>A g.31950723G>A CFB(NM_001710.5):c.1729G>A (p.V577I) - CFB_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
-?/. 1 - c.1778+8C>T r.(=) p.(=) - likely benign g.31918557C>T - - - CFB_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 3 - c.1778+9G>A r.(=) p.(=) - likely benign g.31918558G>A g.31950781G>A CFB(NM_001710.5):c.1778+9G>A - CFB_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-/. 1 - c.1856-18C>T r.(=) p.(=) - benign g.31918903C>T g.31951126C>T - - CFB_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 2 - c.1878G>A r.(?) p.(Gln626=) - likely benign g.31918943G>A g.31951166G>A CFB(NM_001710.5):c.1878G>A (p.Q626=) - CFB_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/. 1 - c.1921A>T r.(?) p.(Thr641Ser) - likely benign g.31918986A>T - CFB(NM_001710.5):c.1921A>T (p.T641S) - CFB_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/., -?/. 2 - c.1953T>G r.(?) p.(Asp651Glu) - benign, likely benign g.31919018T>G - CFB(NM_001710.5):c.1953T>G (p.D651E) - CFB_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-?/. 1 - c.1956+10G>A r.(=) p.(=) - likely benign g.31919031G>A - CFB(NM_001710.5):c.1956+10G>A - CFB_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1957-8C>T r.(=) p.(=) - likely benign g.31919110C>T g.31951333C>T CFB(NM_001710.5):c.1957-8C>T - CFB_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.1975_1976del r.(?) p.(Asp659Cysfs*8) - likely pathogenic g.31919136_31919137del - CFB(NM_001710.6):c.1975_1976delGA (p.D659Cfs*8) - CFB_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/., ?/. 2 - c.2005G>C r.(?) p.(Val669Leu) - likely benign, VUS g.31919166G>C g.31951389G>C CFB(NM_001710.5):c.2005G>C (p.V669L) - CFB_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
?/. 1 - c.2023G>A r.(?) p.(Val675Met) - VUS g.31919184G>A - - - CFB_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.2272G>A r.(?) p.(Asp758Asn) - likely benign g.31919784G>A g.31952007G>A CFB(NM_001710.5):c.2272G>A (p.D758N) - CFB_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.*2750G>A r.(=) p.(=) - likely benign g.31922557G>A - NELFE(NM_002904.6):c.517C>T (p.R173C) - CFB_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.