All variants in the CFB gene

Information The variants shown are described using the NM_001710.5 transcript reference sequence.

121 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. - c.-3237_-3234del r.(?) p.(=) - pathogenic g.31910762_31910765del - C2(NM_001282458.1):c.1159_1162delCTGG (p.L387Mfs*7) - C2_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.-3061G>T r.(?) p.(=) - benign g.31910938G>T g.31943161G>T C2(NM_000063.4):c.1360+62G>T - C2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.-3001A>G r.(?) p.(=) - likely benign g.31910998A>G g.31943221A>G C2(NM_000063.4):c.1361-4A>G - C2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.-2969C>T r.(?) p.(=) - likely benign g.31911030C>T g.31943253C>T C2(NM_001282458.2):c.1302C>T (p.C434=) - C2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.-2969C>T r.(?) p.(=) - VUS g.31911030C>T - C2(NM_001282458.2):c.1302C>T (p.C434=) - C2_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.-2944G>A r.(?) p.(=) - likely benign g.31911055G>A - C2(NM_000063.4):c.1414G>A (p.A472T) - C2_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.-2768C>T r.(?) p.(=) - likely benign g.31911231C>T - C2(NM_001282458.1):c.1407C>T (p.S469=) - C2_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-2767G>A r.(?) p.(=) - likely benign g.31911232G>A g.31943455G>A C2(NM_000063.4):c.1495G>A (p.D499N) - C2_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.-2673_-2652del r.(?) p.(=) - likely benign g.31911326_31911347del - C2(NM_000063.4):c.1567+22_1567+43delCCTCCTGATCCTGAAGCCACAG (p.?) - C2_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-2569A>G r.(?) p.(=) - likely benign g.31911430A>G - C2(NM_000063.4):c.1577A>G (p.K526R) - C2_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.-2430G>C r.(?) p.(=) - VUS g.31911569G>C g.31943792G>C C2(NM_001282458.2):c.1629G>C (p.K543N) - C2_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.-2090T>C r.(?) p.(=) - VUS g.31911909T>C - - - C2_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.-1990G>C r.(?) p.(=) - benign g.31912009G>C g.31944232G>C C2(NM_000063.4):c.1902+6G>C - C2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.-1476T>C r.(?) p.(=) - benign g.31912523T>C g.31944746T>C C2(NM_000063.4):c.1922T>C (p.V641A) - C2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.-1476T>C r.(?) p.(=) - benign g.31912523T>C - C2(NM_000063.4):c.1922T>C (p.V641A) - C2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.-1226A>G r.(?) p.(=) - benign g.31912773A>G g.31944996A>G C2(NM_001282458.1):c.1959A>G (p.A653=) - C2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-953C>T r.(?) p.(=) - VUS g.31913046C>T g.31945269C>T C2(NM_000063.6):c.2171C>T (p.P724L), C2(NM_001282458.1):c.2084C>T (p.P695L) - C2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-953C>T r.(?) p.(=) - likely benign g.31913046C>T - C2(NM_000063.6):c.2171C>T (p.P724L), C2(NM_001282458.1):c.2084C>T (p.P695L) - C2_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.26T>A r.(?) p.(Leu9His) - likely benign g.31914024T>A g.31946247T>A CFB(NM_001710.5):c.26T>A (p.(Leu9His), p.L9H), CFB(NM_001710.6):c.26T>A (p.L9H) - CFB_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.26T>A r.(?) p.(Leu9His) - likely benign g.31914024T>A g.31946247T>A CFB(NM_001710.5):c.26T>A (p.(Leu9His), p.L9H), CFB(NM_001710.6):c.26T>A (p.L9H) - CFB_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.26T>A r.(?) p.(Leu9His) - benign g.31914024T>A g.31946247T>A CFB(NM_001710.5):c.26T>A (p.(Leu9His), p.L9H), CFB(NM_001710.6):c.26T>A (p.L9H) - CFB_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.26T>A r.(?) p.(Leu9His) - benign g.31914024T>A g.31946247T>A CFB(NM_001710.5):c.26T>A (p.(Leu9His), p.L9H), CFB(NM_001710.6):c.26T>A (p.L9H) - CFB_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.82T>C r.(?) p.(Trp28Arg) - VUS g.31914167T>C - - - C2_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.94C>T r.(?) p.(Arg32Trp) - benign g.31914179C>T g.31946402C>T CFB(NM_001710.5):c.94C>T (p.R32W) - CFB_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.94C>T r.(?) p.(Arg32Trp) - VUS g.31914179C>T g.31946402C>T CFB(NM_001710.5):c.94C>T (p.R32W) - CFB_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.95G>A r.(?) p.(Arg32Gln) - benign g.31914180G>A g.31946403G>A CFB(NM_001710.5):c.95G>A (p.R32Q) - CFB_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.95G>A r.(?) p.(Arg32Gln) - benign g.31914180G>A g.31946403G>A CFB(NM_001710.5):c.95G>A (p.R32Q) - CFB_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.166C>G r.(?) p.(Gln56Glu) - likely benign g.31914251C>G - CFB(NM_001710.5):c.166C>G (p.(Gln56Glu)) - C2_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.274A>T r.(?) p.(Thr92Ser) - likely benign g.31914359A>T - CFB(NM_001710.5):c.274A>T (p.T92S) - C2_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.291G>A r.(?) p.(Glu97=) - likely benign g.31914376G>A - - - C2_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.362A>G r.(?) p.(Tyr121Cys) - VUS g.31914847A>G - CFB(NM_001710.6):c.362A>G (p.Y121C) - C2_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.394T>C r.(?) p.(Tyr132His) - VUS g.31914879T>C g.31947102T>C CFB(NM_001710.5):c.394T>C (p.Y132H) - C2_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.405C>T r.(?) p.(Tyr135=) - benign g.31914890C>T g.31947113C>T CFB(NM_001710.5):c.405C>T (p.Y135=) - CFB_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.405C>T r.(?) p.(Tyr135=) - benign g.31914890C>T - CFB(NM_001710.5):c.405C>T (p.Y135=) - CFB_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.450A>G r.(?) p.(Arg150=) - benign g.31914935A>G g.31947158A>G - - CFB_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
./. - c.450A>G r.(=) p.(=) - VUS g.31914935A>G g.31947158A>G - - CFB_000017 for details see the Uveogene database PubMed: Liu 2016 - rs1048709 Germline - 66/186 cases - - - Peizeng Yang
./. - c.450A>G r.(=) p.(=) - VUS g.31914935A>G g.31947158A>G - - CFB_000017 for details see the Uveogene database PubMed: Pang 2012 - rs1048709 Germline - 85/196 cases - - - Peizeng Yang
-/. - c.504G>A r.(?) p.(Pro168=) - benign g.31915144G>A g.31947367G>A CFB(NM_001710.5):c.504G>A (p.P168=) - CFB_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.504G>A r.(?) p.(Pro168=) - benign g.31915144G>A g.31947367G>A CFB(NM_001710.5):c.504G>A (p.P168=) - CFB_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.511C>A r.(?) p.(Pro171Thr) - VUS g.31915151C>A - CFB(NM_001710.6):c.511C>A (p.P171T) - C2_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.559G>A r.(?) p.(Val187Ile) - VUS g.31915199G>A - CFB(NM_001710.6):c.559G>A (p.V187I) - C2_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.559G>A r.(?) p.(Val187Ile) - VUS g.31915199G>A - CFB(NM_001710.6):c.559G>A (p.V187I) - C2_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.600C>T r.(?) p.(Ser200=) - benign g.31915240C>T g.31947463C>T CFB(NM_001710.5):c.600C>T (p.S200=) - CFB_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.600C>T r.(?) p.(Ser200=) - likely benign g.31915240C>T g.31947463C>T CFB(NM_001710.5):c.600C>T (p.S200=) - CFB_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.641C>T r.(?) p.(Thr214Met) - VUS g.31915281C>T - CFB(NM_001710.5):c.641C>T (p.T214M) - C2_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.672C>T r.(?) p.(Tyr224=) - benign g.31915532C>T g.31947755C>T CFB(NM_001710.5):c.672C>T (p.Y224=) - CFB_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.672C>T r.(?) p.(Tyr224=) - benign g.31915532C>T g.31947755C>T CFB(NM_001710.5):c.672C>T (p.Y224=) - CFB_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.673G>A r.(?) p.(Asp225Asn) - VUS g.31915533G>A - CFB(NM_001710.5):c.673G>A (p.D225N) - C2_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.704T>C r.(?) p.(Leu235Pro) - VUS g.31915564T>C - CFB(NM_001710.5):c.704T>C (p.L235P) - C2_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.720G>A r.(?) p.(Glu240=) - benign g.31915580G>A g.31947803G>A - - C2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.724A>C r.(?) p.(Ile242Leu) - likely benign g.31915584A>C g.31947807A>C CFB(NM_001710.5):c.724A>C (p.I242L, p.(Ile242Leu)), CFB(NM_001710.6):c.724A>C (p.I242L) - C2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.724A>C r.(?) p.(Ile242Leu) - VUS g.31915584A>C g.31947807A>C CFB(NM_001710.5):c.724A>C (p.I242L, p.(Ile242Leu)), CFB(NM_001710.6):c.724A>C (p.I242L) - C2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.724A>C r.(?) p.(Ile242Leu) - likely benign g.31915584A>C - CFB(NM_001710.5):c.724A>C (p.I242L, p.(Ile242Leu)), CFB(NM_001710.6):c.724A>C (p.I242L) - C2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.724A>C r.(?) p.(Ile242Leu) - VUS g.31915584A>C - CFB(NM_001710.5):c.724A>C (p.I242L, p.(Ile242Leu)), CFB(NM_001710.6):c.724A>C (p.I242L) - C2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.724A>C r.(?) p.(Ile242Leu) - likely benign g.31915584A>C - CFB(NM_001710.5):c.724A>C (p.I242L, p.(Ile242Leu)), CFB(NM_001710.6):c.724A>C (p.I242L) - C2_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.736G>A r.(?) p.(Asp246Asn) - VUS g.31915596G>A - - - C2_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.754G>A r.(?) p.(Gly252Ser) - benign g.31915614G>A g.31947837G>A - - CFB_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.754G>A r.(?) p.(Gly252Ser) - likely benign g.31915614G>A g.31947837G>A - - CFB_000018 12 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs4151651 Germline - 12/2795 individuals - - - Mohammed Faruq
-/. - c.858C>T r.(?) p.(Phe286=) - benign g.31915819C>T g.31948042C>T CFB(NM_001710.5):c.858C>T (p.F286=) - C2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.858C>T r.(?) p.(Phe286=) - benign g.31915819C>T - CFB(NM_001710.5):c.858C>T (p.F286=) - C2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.897+17_897+20del r.(=) p.(=) - likely benign g.31915875_31915878del - CFB(NM_001710.5):c.897+17_897+20delCCTG - C2_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.898-138T>C r.(=) p.(=) - benign g.31916013T>C g.31948236T>C CFB(NM_001710.5):c.898-138T>C - CFB_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.978A>C r.(?) p.(Glu326Asp) - likely benign g.31916231A>C - CFB(NM_001710.5):c.978A>C (p.E326D) - C2_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1015C>T r.(?) p.(Leu339Phe) - VUS g.31916268C>T - - - C2_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1037-10C>G r.(=) p.(=) - likely benign g.31916597C>G g.31948820C>G CFB(NM_001710.5):c.1037-10C>G - C2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1037-10C>G r.(=) p.(=) - VUS g.31916597C>G g.31948820C>G CFB(NM_001710.5):c.1037-10C>G - C2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1037-10C>G r.(=) p.(=) - likely benign g.31916597C>G - CFB(NM_001710.5):c.1037-10C>G - C2_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1074C>T r.(?) p.(Ala358=) - VUS g.31916644C>T g.31948867C>T - - C2_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.1106C>T r.(?) p.(Pro369Leu) - VUS g.31916676C>T - CFB(NM_001710.5):c.1106C>T (p.P369L) - C2_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1106C>T r.(?) p.(Pro369Leu) - likely benign g.31916676C>T - CFB(NM_001710.5):c.1106C>T (p.P369L) - C2_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.1137C>T r.(?) p.(Arg379=) - benign g.31916707C>T g.31948930C>T - - C2_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1137C>T r.(=) p.(=) - likely benign g.31916707C>T g.31948930C>T - - C2_000022 83 heterozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs45600936 Germline - 83/2795 individuals - - - Mohammed Faruq
-?/. - c.1137C>T r.(=) p.(=) - likely benign g.31916707C>T g.31948930C>T - - C2_000022 2 homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs45600936 Germline - 2/2795 individuals - - - Mohammed Faruq
-?/. - c.1143C>T r.(?) p.(Arg381=) - likely benign g.31916713C>T g.31948936C>T CFB(NM_001710.5):c.1143C>T (p.R381=) - CFB_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1143C>T r.(?) p.(Arg381=) - likely benign g.31916713C>T g.31948936C>T CFB(NM_001710.5):c.1143C>T (p.R381=) - CFB_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1143C>T r.(?) p.(Arg381=) - likely benign g.31916713C>T - CFB(NM_001710.5):c.1143C>T (p.R381=) - CFB_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1151T>C r.(?) p.(Ile384Thr) - VUS g.31916721T>C - CFB(NM_001710.6):c.1151T>C (p.I384T) - C2_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.1169-35T>A r.(=) p.(=) - benign g.31916985T>A g.31949208T>A CFB(NM_001710.5):c.1169-35T>A - CFB_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1217G>A r.(?) p.(Arg406Gln) - VUS g.31917068G>A - - - C2_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.1341C>A r.(?) p.(Asp447Glu) - VUS g.31917267C>A - - - C2_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.1365C>T r.(?) p.(Val455=) - benign g.31917291C>T g.31949514C>T CFB(NM_001710.5):c.1365C>T (p.V455=) - CFB_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.1365C>T r.(?) p.(Val455=) - benign g.31917291C>T g.31949514C>T CFB(NM_001710.5):c.1365C>T (p.V455=) - CFB_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.1374G>A r.(?) p.(Met458Ile) - VUS g.31917300G>A - - - C2_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1408+7A>C r.(=) p.(=) - likely benign g.31917341A>C g.31949564A>C CFB(NM_001710.5):c.1408+7A>C - C2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1408+7A>C r.(=) p.(=) - likely benign g.31917341A>C - CFB(NM_001710.5):c.1408+7A>C - C2_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1464C>T r.(?) p.(Thr488=) - VUS g.31917882C>T - - - C2_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1524C>T r.(?) p.(His508=) - likely benign g.31918080C>T g.31950303C>T CFB(NM_001710.5):c.1524C>T (p.H508=) - CFB_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1524C>T r.(?) p.(His508=) - likely benign g.31918080C>T g.31950303C>T CFB(NM_001710.5):c.1524C>T (p.H508=) - CFB_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1524C>T r.(?) p.(His508=) - likely benign g.31918080C>T g.31950303C>T CFB(NM_001710.5):c.1524C>T (p.H508=) - CFB_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1548G>A r.(?) p.(Val516=) - likely benign g.31918104G>A - CFB(NM_001710.5):c.1548G>A (p.V516=) - C2_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1598A>G r.(?) p.(Lys533Arg) - likely benign g.31918154A>G g.31950377A>G CFB(NM_001710.5):c.1598A>G (p.K533R), CFB(NM_001710.6):c.1598A>G (p.K533R) - C2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1598A>G r.(?) p.(Lys533Arg) - likely benign g.31918154A>G g.31950377A>G CFB(NM_001710.5):c.1598A>G (p.K533R), CFB(NM_001710.6):c.1598A>G (p.K533R) - C2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1598A>G r.(?) p.(Lys533Arg) - VUS g.31918154A>G - CFB(NM_001710.5):c.1598A>G (p.K533R), CFB(NM_001710.6):c.1598A>G (p.K533R) - C2_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+?/. - c.1598A>G r.(?) p.(Lys533Arg) - likely pathogenic g.31918154A>G g.31950377A>G CFB(NM_001710.5):c.1598 A>G(p.K533R) - C2_000024 - PubMed: Sun 2018 - - Germline/De novo (untested) ? 187 - - - LOVD
-?/. - c.1693A>G r.(?) p.(Lys565Glu) - likely benign g.31918464A>G g.31950687A>G - - CFB_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1697A>C r.(?) p.(Glu566Ala) - likely benign g.31918468A>C g.31950691A>C CFB(NM_001710.5):c.1697A>C (p.E566A) - CFB_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1697A>C r.(?) p.(Glu566Ala) - likely benign g.31918468A>C g.31950691A>C CFB(NM_001710.5):c.1697A>C (p.E566A) - CFB_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1697A>C r.(?) p.(Glu566Ala) - likely benign g.31918468A>C g.31950691A>C - - CFB_000011 83 heterozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs45484591 Germline - 83/2793 individuals - - - Mohammed Faruq
-?/. - c.1697A>C r.(?) p.(Glu566Ala) - likely benign g.31918468A>C g.31950691A>C - - CFB_000011 2 homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs45484591 Germline - 2/2793 individuals - - - Mohammed Faruq
+?/. - c.1697A>C r.(?) p.(Glu566Ala) - likely pathogenic g.31918468A>C g.31950691A>C CFB (NM_001710.5):c.1697A>C (p.E566A) - CFB_000011 - PubMed: Sun 2018 - - Germline/De novo (untested) ? 205 - - - LOVD
Legend   How to query   « First ‹ Prev     1 2     Next › Last »


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.