Unique variants in the CITED2 gene

Information The variants shown are described using the NM_001168388.2 transcript reference sequence.

11 entries on 1 page. Showing entries 1 - 11.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-/., -?/. 5 - c.117_119del r.(?) p.(His39del) - benign, likely benign g.139694968_139694970del g.139373831_139373833del 1 more item - CITED2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
?/. 1 - c.289C>T r.(?) p.(Gln97Ter) - VUS g.139694793G>A g.139373656G>A CITED2(NM_006079.4):c.289C>T (p.Q97*) - CITED2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 3 - c.466T>G r.(?) p.(Cys156Gly) - VUS g.139694616A>C g.139373479A>C CITED2(NM_006079.4):c.466T>G (p.(Cys156Gly)), CITED2(NM_006079.5):c.466T>G (p.C156G) - CITED2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen, VKGL-NL_Nijmegen
-?/. 1 - c.479A>T r.(?) p.(His160Leu) - likely benign g.139694603T>A - CITED2(NM_006079.5):c.479A>T (p.(His160Leu)) - CITED2_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/., ?/. 2 - c.510_536del r.(?) p.(Gly172_Gly180del) - likely benign, VUS g.139694572_139694598del - CITED2(NM_006079.5):c.510_536delGGGCGGCAGCAGCACCCCCGGCGGCTC (p.G172_G180del) - CITED2_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen
?/. 1 - c.521_523dup r.(?) p.(Ser174dup) - VUS g.139694565_139694567dup - CITED2(NM_006079.4):c.521_523dupGCA (p.S174dup) - CITED2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/., -?/. 3 - c.542G>C r.(?) p.(Ser181Thr) - likely benign, likely pathogenic g.139694540C>G g.139373403C>G CITED2(NM_006079.4):c.542G>C (p.S181T), CITED2(NM_006079.5):c.542G>C (p.S181T) - CITED2_000009 VKGL data sharing initiative Nederland PubMed: Miszalski-Jamka 2017 - - CLASSIFICATION record, Germline/De novo (untested) - - - - - Johan den Dunnen, VKGL-NL_Rotterdam, VKGL-NL_Groningen
?/. 3 - c.547_570del r.(?) p.(Ser183_Ser190del) - VUS g.139694521_139694544del g.139373384_139373407del 1 more item - CITED2_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen
-/. 1 - c.580_585del r.(?) p.(Gly194_Gly195del) - benign g.139694502_139694507del g.139373365_139373370del CITED2(NM_006079.5):c.580_585delGGCGGC (p.G194_G195del) - CITED2_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 2 - c.582C>T r.(?) p.(Gly194=) - benign g.139694500G>A g.139373363G>A CITED2(NM_006079.5):c.582C>T (p.G194=) - CITED2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-?/., ?/. 4 - c.593_598del r.(?) p.(Ser198_Gly199del) - likely benign, VUS g.139694496_139694501del g.139373359_139373364del 1 more item - CITED2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.