Unique variants in gene CITED2

Information The variants shown are described using the NM_001168388.2 transcript reference sequence.

8 entries on 1 page. Showing entries 1 - 8.




AscendingDNA change (cDNA)     


RNA change     


DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







-?/. 2 - c.117_119del likely benign r.(?) p.(His39del) g.139694968_139694970del - CITED2(NM_006079.4):c.117_119delCCA (p.H39del) - CITED2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen
?/. 1 - c.289C>T VUS r.(?) p.(Gln97*) g.139694793G>A - CITED2(NM_006079.4):c.289C>T (p.Q97*) - CITED2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.466T>G VUS r.(?) p.(Cys156Gly) g.139694616A>C - - - CITED2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.542G>C likely benign r.(?) p.(Ser181Thr) g.139694540C>G - CITED2(NM_006079.4):c.542G>C (p.S181T) - CITED2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.547_570del VUS r.(?) p.(Ser183_Ser190del) g.139694521_139694544del - CITED2(NM_006079.4):c.547_570delTCGGGCGGCGGCGCGGGCAGCAGC (p.S183_S190del) - CITED2_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.580_585del benign r.(?) p.(Gly194_Gly195del) g.139694502_139694507del - CITED2(NM_006079.4):c.580_585delGGCGGC (p.G194_G195del) - CITED2_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.582C>T benign r.(?) p.(=) g.139694500G>A - - - CITED2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/., ?/. 2 - c.593_598del likely benign, VUS r.(?) p.(Ser198_Gly199del) g.139694496_139694501del - CITED2(NM_006079.4):c.593_598delGCGGCA (p.S198_G199del) - CITED2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_Rotterdam