Unique variants in the DOCK8 gene

Information The variants shown are described using the NM_203447.3 transcript reference sequence.

164 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. 1 - c.-298G>A r.(?) p.(=) - VUS g.214679G>A g.214679G>A C9orf66(NM_152569.2):c.718C>T (p.(Pro240Ser)) - C9orf66_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.-10873_*7734780del r.0? p.0? - pathogenic g.204104_8198999del g.204104_8198999del - - GLDC_000111 decreased gene dosage PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - - - Johan den Dunnen
+/. 1 _1_48_ c.-112_*1040{0} r.0 p.0 - pathogenic (recessive) g.(?_214865)_(465259_?)del g.(?_214865)_(465259_?)del del coding sequence - DOCK8_000107 - - - - Germline - - - - - Johan den Dunnen
?/. 1 - c.52A>G r.(?) p.(Arg18Gly) - VUS g.215028A>G g.215028A>G DOCK8(NM_203447.3):c.52A>G (p.R18G) - C9orf66_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.53+163C>G r.(=) p.(=) - VUS g.215192C>G g.215192C>G C9orf66(NM_152569.2):c.205G>C (p.A69P) - C9orf66_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.53+170_53+192del r.(=) p.(=) - VUS g.215199_215221del g.215199_215221del C9orf66(NM_152569.2):c.182_204delCAGGAGCCGCCGCGCGTCCAGCG (p.A61Gfs*57) - C9orf66_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.53+358A>G r.(=) p.(=) - likely benign g.215387A>G g.215387A>G C9orf66(NM_152569.2):c.10T>C (p.S4P) - C9orf66_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., +?/. 2 - c.54-1G>T r.spl? p.? - likely pathogenic, pathogenic g.271626G>T g.271626G>T DOCK8(NM_203447.3):c.54-1G>T - DOCK8_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-/. 2 - c.65C>T r.(?) p.(Ala22Val) - benign g.271638C>T g.271638C>T DOCK8(NM_203447.3):c.65C>T (p.A22V) - DOCK8_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
?/. 1 - c.157-1G>C r.spl? p.? - VUS g.286460G>C - - - DOCK8_000110 - Liu submitted, 2021 - - Germline - - - - - Liu Wenbing
-/. 2 - c.289C>A r.(?) p.(Pro97Thr) - benign g.286593C>A g.286593C>A DOCK8(NM_203447.3):c.289C>A (p.P97T) - DOCK8_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
?/. 1 - c.295G>A r.(?) p.(Glu99Lys) - VUS g.286599G>A g.286599G>A - - DOCK8_000106 - PubMed: Riazuddin 2017 - - Germline - - - - - Johan den Dunnen
-?/. 1 - c.378C>G r.(?) p.(Ile126Met) - likely benign g.289555C>G g.289555C>G DOCK8(NM_203447.3):c.378C>G (p.I126M) - C9orf66_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.379C>T r.(?) p.(Arg127Cys) - VUS g.289556C>T g.289556C>T DOCK8(NM_203447.3):c.379C>T (p.R127C) - DOCK8_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 2 - c.380G>A r.(?) p.(Arg127His) - likely benign, VUS g.289557G>A g.289557G>A DOCK8(NM_203447.3):c.380G>A (p.R127H) - C9orf66_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-/. 1 - c.404+16del r.(=) p.(=) - benign g.289597del g.289597del DOCK8(NM_203447.3):c.404+16delT - DOCK8_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+?/., ?/. 2 - c.452G>A r.(?) p.(Arg151Gln) - likely pathogenic, VUS g.304628G>A g.304628G>A DOCK8(NM_203447.3):c.452G>A (p.R151Q), NM_203447.3(DOCK8):c.452G>A p.(Arg151Gln) - DOCK8_000001 variant could not be associated with disease phenotype, VKGL data sharing initiative Nederland PubMed: Vogelaar 2017, Journal: Vogelaar 2017 - - CLASSIFICATION record, Germline - - - - - Marjolijn JL Ligtenberg, VKGL-NL_Rotterdam
-?/. 1 - c.470C>T r.(?) p.(Thr157Met) - likely benign g.304646C>T g.304646C>T DOCK8(NM_203447.3):c.470C>T (p.T157M) - C9orf66_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.476C>T r.(?) p.(Pro159Leu) - VUS g.304652C>T g.304652C>T DOCK8(NM_001190458.1):c.272C>T (p.(Pro91Leu)) - DOCK8_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.485C>T r.(?) p.(Thr162Met) - VUS g.304661C>T g.304661C>T DOCK8(NM_203447.3):c.485C>T - DOCK8_000100 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 2 - c.494C>T r.(?) p.(Ser165Leu) - likely benign g.304670C>T g.304670C>T DOCK8(NM_203447.3):c.494C>T (p.S165L) - DOCK8_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-/. 1 - c.529-140C>G r.(=) p.(=) - benign g.311814C>G g.311814C>G DOCK8(NM_203447.3):c.529-140C>G - DOCK8_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.578C>G r.(?) p.(Pro193Arg) - likely benign g.312003C>G g.312003C>G DOCK8(NM_203447.3):c.578C>G (p.P193R) - C9orf66_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.580G>A r.(?) p.(Val194Ile) - likely benign g.312005G>A g.312005G>A DOCK8(NM_203447.3):c.580G>A (p.V194I) - DOCK8_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/. 1 - c.623A>G r.(?) p.(Lys208Arg) - likely benign g.312048A>G g.312048A>G DOCK8(NM_203447.3):c.623A>G (p.K208R) - C9orf66_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 2 - c.663C>A r.(?) p.(Asp221Glu) - likely benign, VUS g.312088C>A g.312088C>A DOCK8(NM_203447.3):c.663C>A (p.D221E) - DOCK8_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_VUmc
-/., ?/. 2 - c.679G>A r.(?) p.(Glu227Lys) - benign, VUS g.312104G>A g.312104G>A DOCK8(NM_001190458.1):c.475G>A (p.(Glu159Lys)), DOCK8(NM_203447.3):c.679G>A (p.E227K) - DOCK8_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 1 - c.685G>C r.(?) p.(Ala229Pro) - likely benign g.312110G>C g.312110G>C DOCK8(NM_203447.3):c.685G>C (p.A229P) - C9orf66_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.688C>T r.(?) p.(Arg230Trp) - VUS g.312113C>T - DOCK8(NM_203447.3):c.688C>T (p.R230W) - C9orf66_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.699T>C r.(?) p.(Asn233=) - benign g.312124T>C g.312124T>C DOCK8(NM_203447.3):c.699T>C (p.N233=) - DOCK8_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/., -?/. 4 - c.709G>A r.(?) p.(Glu237Lys) - benign, likely benign g.312134G>A g.312134G>A DOCK8(NM_203447.3):c.709G>A (p.E237K) - DOCK8_000015 231 heterozygous; Clinindb (India), 9 homozygous; Clinindb (India), 1 more item PubMed: Narang 2020, Journal: Narang 2020 - rs11789099 CLASSIFICATION record, Germline - 231/2793 individuals, 9/2793 individuals - - - VKGL-NL_Utrecht, VKGL-NL_VUmc, Mohammed Faruq
+/. 1 7i_23i c.(827+1_828-1)_(2874+1_2875-1)del r.? p.? - pathogenic (recessive) g.(317131_325672)_(386427_390470)del g.(317131_325672)_(386427_390470)del del ex8-23 - DOCK8_000108 - - - - Germline - - - - - Johan den Dunnen
?/. 1 - c.874G>A r.(?) p.(Asp292Asn) - VUS g.325717G>A - DOCK8(NM_203447.3):c.874G>A (p.D292N) - C9orf66_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.894+74_894+75insC r.(=) p.(=) - benign g.325811_325812insC g.325811_325812insC DOCK8(NM_203447.3):c.894+74_894+75insC - C9orf66_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 2 - c.895-16T>C r.(=) p.(=) - benign g.328006T>C g.328006T>C DOCK8(NM_203447.3):c.895-16T>C - DOCK8_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
-?/. 1 - c.914G>T r.(?) p.(Cys305Phe) - likely benign g.328041G>T g.328041G>T DOCK8(NM_203447.3):c.914G>T (p.C305F) - C9orf66_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 2 - c.986C>T r.(?) p.(Ala329Val) - VUS g.328113C>T g.328113C>T - - DOCK8_000104 conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; Clinindb (India) Liu submitted, 2021, PubMed: Narang 2020, Journal: Narang 2020 - rs75352090 Germline - 3/2795 individuals - - - Mohammed Faruq, Liu Wenbing
+?/., ?/. 2 - c.1016C>T r.(?) p.(Pro339Leu) - likely pathogenic, VUS g.328143C>T g.328143C>T DOCK8(NM_203447.3):c.1016C>T (p.P339L) - DOCK8_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
?/. 1 - c.1036G>A r.(?) p.(Val346Ile) - VUS g.328163G>A - - - DOCK8_000109 - Liu submitted, 2021 - - Germline - - - - - Liu Wenbing
?/. 1 - c.1072A>G r.(?) p.(Ile358Val) - VUS g.332425A>G g.332425A>G DOCK8(NM_001190458.1):c.868A>G (p.(Ile290Val)) - DOCK8_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1090C>T r.(?) p.(Pro364Ser) - VUS g.332443C>T g.332443C>T DOCK8(NM_001190458.1):c.886C>T (p.(Pro296Ser)) - DOCK8_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1098G>A r.(?) p.(Thr366=) - likely benign g.332451G>A g.332451G>A DOCK8(NM_203447.3):c.1098G>A (p.T366=) - C9orf66_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1178G>A r.(?) p.(Arg393His) - VUS g.334277G>A - DOCK8(NM_203447.3):c.1178G>A (p.R393H) - C9orf66_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.1238A>G r.(?) p.(Asn413Ser) - benign g.334337A>G g.334337A>G DOCK8(NM_203447.3):c.1238A>G (p.N413S) - DOCK8_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.1285+1G>A r.spl? p.? - pathogenic g.334385G>A g.334385G>A DOCK8(NM_203447.3):c.1285+1G>A - DOCK8_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 1 - c.1422+101G>T r.(=) p.(=) - benign g.336819G>T g.336819G>T DOCK8(NM_203447.3):c.1422+101G>T - DOCK8_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.1526G>C r.(?) p.(Arg509Thr) - likely benign g.340168G>C g.340168G>C DOCK8(NM_203447.3):c.1526G>C (p.R509T) - C9orf66_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 1 - c.1587C>G r.(?) p.(Pro529=) - benign g.340229C>G g.340229C>G DOCK8(NM_203447.3):c.1587C>G (p.P529=) - C9orf66_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1623C>G r.(?) p.(His541Gln) - VUS g.340265C>G - DOCK8(NM_203447.3):c.1623C>G (p.H541Q) - DOCK8_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-/. 1 - c.1679+18G>A r.(=) p.(=) - benign g.340339G>A g.340339G>A DOCK8(NM_203447.3):c.1679+18G>A - DOCK8_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 1 - c.1680-2431del r.(=) p.(=) - benign g.365587del g.365587del DOCK8(NM_203447.3):c.1680-2431delT - DOCK8_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.1683C>A r.(?) p.(Asn561Lys) - likely benign g.368021C>A g.368021C>A DOCK8(NM_001190458.1):c.1479C>A (p.(Asn493Lys)) - C9orf66_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/., -?/. 3 - c.1790C>T r.(?) p.(Ala597Val) - benign, likely benign g.368128C>T g.368128C>T DOCK8(NM_203447.3):c.1790C>T (p.A597V) - DOCK8_000031 3 homozygous; Clinindb (India), 79 heterozygous; Clinindb (India), 1 more item PubMed: Narang 2020, Journal: Narang 2020 - rs17673268 CLASSIFICATION record, Germline - 3/2795 individuals, 79/2795 individuals - - - VKGL-NL_Groningen, Mohammed Faruq
?/. 1 - c.1798-4A>G r.spl? p.? - VUS g.370226A>G - DOCK8(NM_203447.3):c.1798-4A>G - C9orf66_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-/. 2 - c.1812A>G r.(?) p.(Lys604=) - benign g.370244A>G g.370244A>G DOCK8(NM_203447.3):c.1812A>G (p.K604=) - DOCK8_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
?/. 1 - c.1813T>C r.(?) p.(Ser605Pro) - VUS g.370245T>C g.370245T>C DOCK8(NM_203447.3):c.1813T>C (p.S605P) - C9orf66_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1829T>G r.(?) p.(Phe610Cys) - VUS g.370261T>G g.370261T>G DOCK8(NM_001190458.1):c.1625T>G (p.(Phe542Cys)) - DOCK8_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.1860C>A r.(?) p.(Tyr620Ter) - pathogenic g.370292C>A g.370292C>A DOCK8(NM_203447.3):c.1860C>A (p.Y620*) - DOCK8_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.1883A>T r.(?) p.(Tyr628Phe) - VUS g.371442A>T g.371442A>T - - DOCK8_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.2074A>G r.(?) p.(Lys692Glu) - VUS g.372251A>G - DOCK8(NM_203447.3):c.2074A>G (p.K692E) - C9orf66_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.2109+11del r.(=) p.(=) - likely benign g.372297del - DOCK8(NM_203447.3):c.2109+11delA - C9orf66_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.2110-7A>T r.(=) p.(=) - likely benign g.376203A>T g.376203A>T DOCK8(NM_203447.3):c.2110-7A>T - DOCK8_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.2111A>G r.(?) p.(Lys704Arg) - VUS g.376211A>G g.376211A>G DOCK8(NM_203447.3):c.2111A>G (p.K704R) - C9orf66_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.2269A>G r.(?) p.(Ile757Val) - likely benign g.377040A>G g.377040A>G DOCK8(NM_203447.3):c.2269A>G (p.I757V) - DOCK8_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.2272C>T r.(?) p.(Arg758Cys) - VUS g.377043C>T g.377043C>T - - C9orf66_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 1 - c.2295C>T r.(?) p.(Ser765=) - benign g.377066C>T g.377066C>T DOCK8(NM_203447.3):c.2295C>T (p.S765=) - DOCK8_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.2296G>A r.(?) p.(Glu766Lys) - VUS g.377067G>A g.377067G>A DOCK8(NM_203447.3):c.2296G>A (p.E766K) - C9orf66_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.2304G>A r.(?) p.(Ala768=) - likely benign g.377075G>A - DOCK8(NM_203447.3):c.2304G>A (p.A768=) - C9orf66_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 2 - c.2340G>C r.(?) p.(Leu780=) - benign g.377111G>C g.377111G>C DOCK8(NM_203447.3):c.2340G>C (p.L780=) - DOCK8_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
-?/. 1 - c.2364C>T r.(?) p.(Leu788=) - likely benign g.377135C>T - DOCK8(NM_203447.3):c.2364C>T (p.L788=) - C9orf66_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.2372T>C r.(?) p.(Phe791Ser) - VUS g.377143T>C g.377143T>C - - C9orf66_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.2436G>C r.(?) p.(Gln812His) - VUS g.377207G>C - - - DOCK8_000111 - Liu submitted, 2021 - - Germline - - - - - Liu Wenbing
?/. 1 - c.2444A>C r.(?) p.(Asn815Thr) - VUS g.379774A>C g.379774A>C DOCK8(NM_203447.3):c.2444A>C (p.N815T) - C9orf66_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.2494C>T r.(?) p.(His832Tyr) - VUS g.379824C>T - DOCK8(NM_203447.3):c.2494C>T (p.H832Y) - DOCK8_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. 1 - c.2594T>C r.(?) p.(Val865Ala) - likely benign g.379924T>C g.379924T>C DOCK8(NM_203447.3):c.2594T>C (p.V865A) - C9orf66_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.2830G>T r.(?) p.(Asp944Tyr) - VUS g.386382G>T g.386382G>T DOCK8(NM_203447.3):c.2830G>T (p.D944Y) - DOCK8_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.2874+1G>T r.spl? p.? - likely pathogenic g.386427G>T g.386427G>T - - C9orf66_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.2899C>T r.(?) p.(Gln967Ter) - pathogenic g.390495C>T g.390495C>T DOCK8(NM_203447.3):c.2899C>T (p.Q967*) - DOCK8_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 2 - c.2916C>T r.(?) p.(Thr972=) - benign g.390512C>T g.390512C>T DOCK8(NM_203447.3):c.2916C>T (p.T972=) - DOCK8_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
-/., ?/. 2 - c.3022C>T r.(?) p.(Arg1008Trp) - benign, VUS g.396836C>T g.396836C>T DOCK8(NM_203447.3):c.3022C>T (p.R1008W) - C9orf66_000020 conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; Clinindb (India), 1 more item PubMed: Narang 2020, Journal: Narang 2020 - rs16937932 CLASSIFICATION record, Germline - 1/2795 individuals - - - VKGL-NL_Rotterdam, Mohammed Faruq
?/. 2 - c.3023G>A r.(?) p.(Arg1008Gln) - VUS g.396837G>A g.396837G>A DOCK8(NM_203447.3):c.3023G>A (p.R1008Q) - DOCK8_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
-?/. 1 - c.3058A>G r.(?) p.(Ile1020Val) - likely benign g.396872A>G g.396872A>G DOCK8(NM_203447.3):c.3058A>G (p.I1020V) - C9orf66_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.3123A>C r.(?) p.(Glu1041Asp) - VUS g.399148A>C g.399148A>C DOCK8(NM_203447.3):c.3123A>C (p.E1041D) - C9orf66_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.3179T>C r.(?) p.(Leu1060Pro) - VUS g.399204T>C g.399204T>C DOCK8(NM_203447.3):c.3179T>C (p.L1060P) - C9orf66_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 3 - c.3220C>A r.(?) p.(His1074Asn) - likely benign, VUS g.399245C>A g.399245C>A DOCK8(NM_001190458.1):c.2920C>A (p.(His974Asn)), DOCK8(NM_203447.3):c.3220C>A (p.H1074N) - DOCK8_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen
-/. 1 - c.3230G>A r.(?) p.(Ser1077Asn) - benign g.399255G>A g.399255G>A DOCK8(NM_203447.3):c.3230G>A (p.S1077N) - C9orf66_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.3234+2T>C r.spl? p.? - pathogenic g.399261T>C g.399261T>C DOCK8(NM_203447.3):c.3234+2T>C - C9orf66_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.3234+8_3234+9insGC r.(=) p.(=) - likely benign g.399267_399268insGC g.399267_399268insGC DOCK8(NM_203447.3):c.3234+8_3234+9insGC - C9orf66_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.3234+15del r.(=) p.(=) - likely benign g.399274del g.399274del DOCK8(NM_203447.3):c.3234+15delC - DOCK8_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-/. 1 - c.3234+102T>A r.(=) p.(=) - benign g.399361T>A g.399361T>A DOCK8(NM_203447.3):c.3234+102T>A - DOCK8_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.3263C>T r.(?) p.(Thr1088Met) - VUS g.404946C>T g.404946C>T DOCK8(NM_203447.3):c.3263C>T (p.T1088M) - C9orf66_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.3274A>G r.(?) p.(Met1092Val) - likely benign g.404957A>G - DOCK8(NM_203447.3):c.3274A>G (p.M1092V) - C9orf66_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 2 - c.3312G>C r.(?) p.(Glu1104Asp) - VUS g.404995G>C g.404995G>C DOCK8(NM_203447.3):c.3312G>C (p.E1104D) - DOCK8_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
+/. 1 - c.3389A>G r.(?) p.(Gln1130Arg) - pathogenic g.405072A>G g.405072A>G DOCK8(NM_203447.3):c.3389A>G (p.Q1130R) - DOCK8_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.3391-124_3391-123insC r.(=) p.(=) - VUS g.406806_406807insC g.406806_406807insC DOCK8(NM_203447.3):c.3391-124_3391-123insC - C9orf66_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.3414C>A r.(?) p.(Phe1138Leu) - likely benign g.406953C>A g.406953C>A DOCK8(NM_001190458.1):c.3114C>A (p.(Phe1038Leu)) - DOCK8_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/., ?/. 2 - c.3460C>T r.(?) p.(Arg1154Cys) - likely benign, VUS g.406999C>T g.406999C>T DOCK8(NM_203447.3):c.3460C>T (p.R1154C) - C9orf66_000027 conflicting interpretations of pathogenicity; 50 heterozygous, no homozygous; Clinindb (India), 1 more item PubMed: Narang 2020, Journal: Narang 2020 - rs34390308 CLASSIFICATION record, Germline - 50/2795 individuals - - - VKGL-NL_Rotterdam, Mohammed Faruq
?/. 1 - c.3480C>A r.(?) p.(Thr1160=) - VUS g.407019C>A - DOCK8(NM_203447.3):c.3480C>A (p.T1160=) - C9orf66_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.3485T>C r.(?) p.(Leu1162Pro) - VUS g.407024T>C g.407024T>C DOCK8(NM_001190458.1):c.3185T>C (p.(Leu1062Pro)) - C9orf66_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.3496G>T r.(?) p.(Glu1166*) - VUS g.407035G>T g.407035G>T Gln735His - DOCK8_000105 phenotype fits better with PHF8 variant PubMed: Redin 2014 - - De novo - - - - - Johan den Dunnen
Legend   How to query   « First ‹ Prev     1 2     Next › Last »