Unique variants in the DPAGT1 gene

Euroglycanet logoCongenital Disorders of Glycosylation (CDG)
Some variants in this database are copied from the CDG database at the Euroglycanet site.
Information The variants shown are described using the NM_001382.3 transcript reference sequence.

46 entries on 1 page. Showing entries 1 - 46.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. 1 - c.85A>T r.(?) p.(Ile29Phe) - VUS g.118972281T>A - DPAGT1(NM_001382.4):c.85A>T (p.(Ile29Phe)) - DPAGT1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.276C>T r.(?) p.(His92=) - likely benign g.118971734G>A - DPAGT1(NM_001382.3):c.276C>T (p.H92=) - DPAGT1_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.308T>G r.(?) p.(Leu103Arg) - VUS g.118971528A>C g.119100818A>C - - DPAGT1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 3 c.326T>A r.(?) p.(Ile109Asn) - VUS g.118971510A>T g.119100800A>T - - DPAGT1_000001 - - - - Unknown - - - - - Anke Rietveld
+?/. 1 3 c.362G>A r.(?) p.(Arg121His) ACMG likely pathogenic g.118971474C>T g.119100764C>T - - DPAGT1_000022 - - - rs1131691904 Germline yes - - - - Raffaella Brugnoni
?/. 1 - c.466C>T r.(?) p.(Arg156Cys) - VUS g.118971370G>A g.119100660G>A - - DPAGT1_000024 no segregation analysis PubMed: Westra 2019 - - Germline/De novo (untested) - - - - - Johan den Dunnen
?/. 1 - c.496+3A>G r.spl? p.? - VUS g.118971337T>C - DPAGT1(NM_001382.3):c.496+3A>G (p.?) - DPAGT1_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.496+5G>A r.spl? p.? - VUS g.118971335C>T - DPAGT1(NM_001382.4):c.496+5G>A - DPAGT1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.497-4G>A r.spl? p.? - VUS g.118971122C>T g.119100412C>T DPAGT1(NM_001382.3):c.497-4G>A (p.?) - DPAGT1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.530C>T r.(?) p.(Ala177Val) - VUS g.118971085G>A g.119100375G>A - - DPAGT1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.539G>C r.(?) p.(Cys180Ser) - likely pathogenic g.118971076C>G g.119100366C>G DPAGT1(NM_001382.4):c.539G>C (p.C180S) - DPAGT1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.556A>G r.(?) p.(Ile186Val) - VUS g.118971059T>C g.119100349T>C - - DPAGT1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.573C>T r.(?) p.(=) - likely benign g.118971042G>A - DPAGT1(NM_001382.4):c.573C>T (p.(Asn191=)) - DPAGT1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 - c.652C>T r.(?) p.(Arg218Trp) - likely pathogenic g.118969189G>A g.119098479G>A - - DPAGT1_000015 Basiri et al. 2013. Neuriomuscul Disord 23: 843 - - rs1053302601 Germline - - - - - Andreas Laner
?/. 1 - c.667T>G r.(?) p.(Phe223Val) - VUS g.118969174A>C g.119098464A>C - - DPAGT1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.733_734del r.(?) p.(Pro245Ilefs*104) - pathogenic g.118968749_118968750del - DPAGT1(NM_001382.3):c.733_734delCC (p.P245Ifs*104) - DPAGT1_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.820A>T r.(?) p.(Thr274Ser) - VUS g.118968662T>A - DPAGT1(NM_001382.4):c.820A>T (p.(Thr274Ser)) - DPAGT1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 6 c.854A>G r.(?) p.(Asn285Ser) ACMG VUS g.118968628T>C g.119097918T>C - - DPAGT1_000021 - - - - Germline yes - - - - Raffaella Brugnoni
-?/. 1 - c.917+7G>A r.(=) p.(=) - likely benign g.118968558C>T - DPAGT1(NM_001382.4):c.917+7G>A - DPAGT1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.918-5C>A r.spl? p.? - VUS g.118968266G>T - DPAGT1(NM_001382.4):c.918-5C>A - DPAGT1_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 - c.989G>A r.(?) p.(Gly330Asp) - likely pathogenic g.118968190C>T g.119097480C>T DPAGT1(NM_001382.4):c.989G>A (p.G330D) - DPAGT1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.1079_1081del r.(?) p.(Asn360del) - VUS g.118967936_118967938del - DPAGT1(NM_001382.3):c.1079_1081del (p.(Asn360del)) - DPAGT1_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1125T>G r.(?) p.(His375Gln) - VUS g.118967888A>C g.119097178A>C DPAGT1(NM_001382.3):c.1125T>G (p.(His375Gln)) - DPAGT1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 3 - c.1177A>G r.(?) p.(Ile393Val) - benign g.118967758T>C g.119097048T>C DPAGT1(NM_001382.4):c.1177A>G (p.I393V) - DPAGT1_000002 VKGL data sharing initiative Nederland - - rs643788 CLASSIFICATION record, Germline - frequency up to 0,49% - - - Andreas Laner, VKGL-NL_Groningen, VKGL-NL_Utrecht
-?/. 1 - c.*3726C>T r.(=) p.(=) - likely benign g.118963982G>A g.119093272G>A HMBS(NM_000190.4):c.1075G>A (p.D359N) - DPAGT1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.*3737C>T r.(=) p.(=) - VUS g.118963971G>A g.119093261G>A HMBS(NM_000190.4):c.1064G>A (p.R355Q) - DPAGT1_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.*3781G>A r.(=) p.(=) - likely benign g.118963927C>T - HMBS(NM_000190.4):c.1020C>T (p.N340=) - DPAGT1_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+/. 1 - c.*3810C>T r.(=) p.(=) - pathogenic g.118963898G>A g.119093188G>A HMBS(NM_000190.4):c.991G>A (p.A331T) - HMBS_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.*3839C>T r.(=) p.(=) - likely benign g.118963869G>A g.119093159G>A HMBS(NM_000190.4):c.962G>A (p.R321H) - HMBS_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_VUmc
-/. 1 - c.*3915G>C r.(=) p.(=) - benign g.118963793C>G g.119093083C>G HMBS(NM_000190.4):c.913-27C>G - HMBS_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.*3958C>T r.(=) p.(=) - likely benign g.118963750G>A g.119093040G>A HMBS(NM_000190.4):c.912+19G>A - HMBS_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
-?/. 1 - c.*3972G>A r.(=) p.(=) - likely benign g.118963736C>T g.119093026C>T HMBS(NM_000190.4):c.912+5C>T - HMBS_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.*4031G>A r.(=) p.(=) - likely benign g.118963677C>T - HMBS(NM_000190.4):c.858C>T (p.D286=) - DPAGT1_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.*4031G>T r.(=) p.(=) - VUS g.118963677C>A - HMBS(NM_000190.3):c.858C>A (p.(Asp286Glu)) - DPAGT1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.*4186C>T r.(=) p.(=) - pathogenic g.118963522G>A g.119092812G>A HMBS(NM_000190.4):c.825+1G>A - HMBS_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.*4222del r.(?) p.(=) - pathogenic g.118963487del g.119092777del HMBS(NM_000190.4):c.791delC (p.P264Qfs*2) - HMBS_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.*4481C>G r.(=) p.(=) - likely benign g.118963227G>C g.119092517G>C HMBS(NM_000190.3):c.765G>C (p.(Arg255Ser)) - HMBS_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.*4503_*4522dup r.(=) p.(=) - pathogenic g.118963186_118963205dup g.119092476_119092495dup HMBS(NM_000190.4):c.724_743dupGAGACTCTGCTTCGCTGCAT (p.I248Mfs*14) - DPAGT1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.*4507A>G r.(=) p.(=) - pathogenic g.118963201T>C g.119092491T>C HMBS(NM_000190.4):c.739T>C (p.C247R) - HMBS_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.*4517_*4518del r.(=) p.(=) - pathogenic g.118963192_118963193del - HMBS(NM_000190.4):c.730_731delCT (p.L244Afs*6) - DPAGT1_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.*4530T>C r.(=) p.(=) - pathogenic g.118963178A>G g.119092468A>G HMBS(NM_000190.4):c.716A>G (p.H239R) - HMBS_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., +?/., ?/. 3 - c.*4572C>T r.(=) p.(=) - likely pathogenic, pathogenic, VUS g.118963136G>A g.119092426G>A HMBS(NM_000190.4):c.674G>A (p.R225Q) - HMBS_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen, VKGL-NL_VUmc
+/. 1 - c.*4579C>T r.(=) p.(=) - pathogenic g.118963129G>A g.119092419G>A HMBS(NM_000190.4):c.667G>A (p.E223K) - HMBS_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.*4595C>G r.(=) p.(=) - pathogenic g.118963113G>C g.119092403G>C HMBS(NM_000190.4):c.652-1G>C - HMBS_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 4 - c.*4892G>T r.(=) p.(=) - benign g.118962816C>A g.119092106C>A HMBS(NM_000190.4):c.613-19C>A - HMBS_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_VUmc, VKGL-NL_AMC
-/. 3 - c.*5478C>A r.(=) p.(=) - benign g.118962230G>T g.119091520G>T HMBS(NM_000190.4):c.606G>T (p.V202=) - HMBS_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_VUmc, VKGL-NL_AMC
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.