Unique variants in the EDA gene

Information The variants shown are described using the NM_001399.4 transcript reference sequence.

153 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/., +?/. 4 _1_1i c.(?_-181)_(396+1_397-1)del r.0? p.0? - pathogenic (dominant), pathogenic (recessive) g.(?_68835972)_(68836549_69176876)del g.(?_69616128)_(69616705_69957026)del deletion exon 1, exon 1 del - EDA_000015 gene exons described as 1a, 3a, 4-9 PubMed: Kere 1996, PubMed: Kere 1996 PubMed: Paakkonen 2001, PubMed: Paakkonen 2001, 1 more item - - Germline - - - - - Johan den Dunnen, Céline Cluzeau
+/., -?/. 2 - c.-56G>T r.(?) p.(=) - likely benign, pathogenic (recessive) g.68836097G>T g.69616253G>T 187G>T - EDA_000096 - PubMed: Kere 1996 - - Germline yes - - - - Johan den Dunnen
-?/. 1 - c.-16G>A r.(?) p.(=) - likely benign g.68836137G>A g.69616293G>A 227G>A - EDA_000097 - PubMed: Kere 1996 - - Germline yes - - - - Johan den Dunnen
+?/. 1 1 c.2T>G r.(?) p.(M1R) - likely pathogenic g.68836154T>G g.69616310T>G - - EDA_000016 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+/. 1 - c.4G>T r.(?) p.(Gly2Cys) - pathogenic (dominant) g.68836156G>T g.69616312G>T - - EDA_000098 - PubMed: Schneider 2011 - - Germline - - - - - Johan den Dunnen
+/. 1 - c.44dup r.(?) p.(Ala16Serfs*84) - pathogenic (recessive) g.68836196dup g.69616352dup 287insC - EDA_000093 - PubMed: Kere 1996 - - De novo - - - - - Johan den Dunnen
+/. 2 - c.45_49del r.(?) p.(Pro17Glyfs*81) - pathogenic (dominant) g.68836197_68836201del g.69616353_69616357del - - EDA_000099 - PubMed: Schneider 2011 - - Germline - - - - - Johan den Dunnen
+/. 4 1 c.64_71dup r.(?) p.(Cys25Alafs*35) - pathogenic (dominant) g.68836216_68836223dup g.69616372_69616379dup 64_71dup8 - EDA_000037 - PubMed: Wohlfart 2016 - - Germline - 4/124 cases - - - Sigrun Maier-Wohlfart
+/. 1 - c.67C>T r.(?) p.(Gln23*) - pathogenic (recessive) g.68836219C>T g.69616375C>T 366C>T - EDA_000100 - PubMed: Kere 1996 - - Germline yes - - - - Johan den Dunnen
+/. 1 - c.78del r.(?) p.(Cys27Valfs*30) - pathogenic g.68836230del - EDA(NM_001399.5):c.78delG (p.C27Vfs*30) - EDA_000147 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.93T>C r.(?) p.(Pro31=) - likely benign g.68836245T>C g.69616401T>C EDA(NM_001399.5):c.93T>C (p.P31=) - EDA_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/. 1 1 c.119_120insTGTG r.(?) p.(Leu41Valfs*60) - pathogenic (dominant) g.68836271_68836272insTGTG g.69616427_69616428insTGTG - - EDA_000013 - PubMed: Gunadi 2009 - - Unknown - - - - - Céline Cluzeau
+/. 1 - c.121dup r.(?) p.(Leu41Profs*59) - pathogenic (recessive) g.68836273dup g.69616429dup 363insC - EDA_000101 - PubMed: Kere 1996 - - Germline yes - - - - Johan den Dunnen
+?/. 1 - c.170C>G r.(?) p.(Thr57Arg) - likely pathogenic g.68836322C>G g.69616478C>G EDA(NM_001399.5):c.170C>G (p.T57R) - EDA_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 1 - c.181T>C r.(?) p.(Tyr61His) - pathogenic (recessive) g.68836333T>C g.69616489T>C 423T>C - EDA_000102 - PubMed: Kere 1996 - - Germline yes - - - - Johan den Dunnen
+/. 1 - c.183C>G r.(?) p.(Tyr61*) - pathogenic (recessive) g.68836335C>G g.69616491C>G - 425C>G EDA_000094 - PubMed: Yotsumoto 1998 - - Germline - - - - - Johan den Dunnen
+/. 1 - c.185del r.(?) p.(Leu62Glnfs*29) - pathogenic (recessive) g.68836337del g.69616493del 427delT - EDA_000103 - PubMed: Kere 1996 - - Germline yes - - - - Johan den Dunnen
+/. 1 - c.187G>A r.(?) p.(Glu63Lys) - pathogenic (recessive) g.68836339G>A g.69616495G>A 429G>A - EDA_000104 - PubMed: Kere 1996 - - Germline yes - - - - Johan den Dunnen
+/., -/., -?/., ?/. 8 - c.206G>T r.(?) p.(Arg69Leu) - benign, likely benign, pathogenic (dominant), pathogenic (recessive), VUS g.68836358G>T g.69616514G>T 206G>T/991C>T, 448G>T, 1 more item - EDA_000067 VKGL data sharing initiative Nederland PubMed: Burger 2014, PubMed: Kere 1996, PubMed: Schneider 2011 - - CLASSIFICATION record, Germline yes - - - - Johan den Dunnen, VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht
+/. 1 - c.242C>A r.(?) p.(Ser81Ter) - pathogenic g.68836394C>A g.69616550C>A EDA(NM_001399.5):c.242C>A (p.S81*) - EDA_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 4 1 c.252del r.(?) p.(Gly85Alafs*6) - pathogenic (dominant), pathogenic (recessive) g.68836404del g.69616560del 494delT - EDA_000043 - PubMed: Kere 1996, PubMed: Wohlfart 2016 - - Germline yes 1/124 cases - - - Johan den Dunnen, Sigrun Maier-Wohlfart
+/. 1 - c.351_353delinsG r.(?) p.(Pro118Glyfs*8) - pathogenic (recessive) g.68836503_68836505delinsG g.69616659_69616661delinsG 593A>G;594-595delCC - EDA_000105 - PubMed: Kere 1996 - - Germline yes - - - - Johan den Dunnen
+?/. 1 1 c.358G>T r.(?) p.(Glu120X) - likely pathogenic g.68836510G>T g.69616666G>T - - EDA_000017 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+?/. 1 1 c.361del r.(?) p.(Ala121Profs*16) - likely pathogenic g.68836513del g.69616669del - - EDA_000032 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+?/. 1 - c.374C>G r.(?) p.(Ser125Cys) - likely pathogenic g.68836526C>G g.69616682C>G g.616C>G - EDA_000149 - - - - Germline - - - - - Sigrun Maier-Wohlfart
+/. 1 1 c.376_379del r.(?) p.(Asp126Profs*10) - pathogenic (dominant) g.68836528_68836531del g.69616684_69616687del 376_379del4 - EDA_000040 - PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Sigrun Maier-Wohlfart
+/. 1 - c.394C>T r.(?) p.(Gln132*) - pathogenic (recessive) g.68836546C>T g.69616702C>T 636C>T - EDA_000106 - PubMed: Kere 1996 - - Germline yes - - - - Johan den Dunnen
+/., +?/. 2 1i c.396+5G>A r.spl? p.0?, p.? - likely pathogenic (dominant), pathogenic (dominant) g.68836553G>A g.69616709G>A - - EDA_000050 - PubMed: Prasad 2016, PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Johan den Dunnen, Sigrun Maier-Wohlfart
-?/. 1 1i c.396+32900dup r.(=) p.(=) - likely benign g.68869448dup g.69649604dup 68869433insT - EDA_000059 - PubMed: Kumar 2016, Journal: Kumar 2016 - rs367558953 Germline - - - - - Thuong Ha
-?/. 1 1i c.396+36982del r.(?) p.(=) - likely benign g.68873530del g.69653686del 68873526_68873527delA - EDA_000060 - PubMed: Kumar 2016, Journal: Kumar 2016 - - Germline - - - - - Thuong Ha
-?/. 1 1i c.396+44701A>T r.(?) p.(=) - likely benign g.68881249A>T g.69661405A>T - - EDA_000061 - PubMed: Kumar 2016, Journal: Kumar 2016 - rs7471344 Germline - - - - - Thuong Ha
-?/. 1 - c.396+53503_396+53508del r.(=) p.(=) - likely benign g.68890051_68890056del g.69670207_69670212del EDA(NM_001005613.2):c.397-3_399del (p.?) - EDA_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.396+53504_396+53508del r.(=) p.(=) - VUS g.68890052_68890056del g.69670208_69670212del EDA(NM_001005609.1):c.396+53503_396+53507del (p.?) - EDA_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.396+53508C>T r.(=) p.(=) - VUS g.68890056C>T g.69670212C>T EDA(NM_001005609.1):c.396+53508C>T (p.?) - EDA_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 1i c.397-78326_397-78325del r.(?) p.(=) - likely benign g.69098551_69098552del g.69878701_69878702del - - EDA_000056 - - - - Germline - - - - - Yu Sun
-?/. 2 1i c.397-78293_397-78292del r.(?) p.(=) - likely benign g.69098584_69098585del g.69878734_69878735del - - EDA_000057 - - - - Germline - - - - - Yu Sun
+/. 1 1i_2i c.397-6065_502+3117dup r.? p.? - pathogenic (dominant) g.69170812_69180099dup g.69950962_69960249dup duplication exon 2 - EDA_000054 - PubMed: Wohlfart 2016 - - Unknown - 1/124 cases - - - Sigrun Maier-Wohlfart
+/. 3 1i_2i c.397-5853_502+3446dup r.? p.? - pathogenic (dominant) g.69171024_69180428dup g.69951174_69960578dup duplication exon 2 - EDA_000036 - PubMed: Wohlfart 2016 - - Germline - 3/124 cases - - - Sigrun Maier-Wohlfart
+?/. 1 2 c.397-1G>A r.(?) p.(?) - likely pathogenic g.69176876G>A g.69957026G>A - - EDA_000030 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+/. 2 1i_2i c.(396+1_397-1)_(502+1_503-1)del r.? p.? - pathogenic (dominant) g.(68836549_69176876)_(69176983_69243067)del g.(69616705_69957026)_(69957133_70023217)del deletion exon 2, 397-?_502+?del, exon 3 del - EDA_000055 gene exons described as 1a, 3a, 4-9 PubMed: Schneider 2011, PubMed: Wohlfart 2016 - - Germline, Unknown - 1/124 cases - - - Johan den Dunnen, Sigrun Maier-Wohlfart
+/. 1 1i_2i c.(396+1_397-1)_(502+1_503-1)dup r.? p.? - pathogenic (dominant) g.(68836549_69176876)_(69176983_69243067)dup g.(69616705_69957026)_(69957133_70023217)dup - - EDA_000064 Testing revealed a partial duplication including exon 2. - - - Unknown - - - - - Alizabeth Woodruff
+/. 1 - c.449_456del r.(?) p.(Glu150Alafs*6) - pathogenic (dominant) g.69176929_69176936del g.69957079_69957086del - - EDA_000107 - PubMed: Schneider 2011 - - Germline - - - - - Johan den Dunnen
+/. 6 - c.457C>T r.(?), r.spl p.(Arg153Cys) - pathogenic (dominant) g.69176937C>T g.69957087C>T - - EDA_000108 - PubMed: Burger 2014, PubMed: Schneider 2011, PubMed: Wohlfart 2016 - - Germline - 2/124 cases - - - Johan den Dunnen
-?/. 1 - c.458G>A r.(?) p.(Arg153His) - likely benign g.69176938G>A g.69957088G>A EDA(NM_001005609.1):c.458G>A (p.(Arg153His)) - EDA_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 12 - c.463C>T r.(?) p.(Arg155Cys) - pathogenic, pathogenic (dominant), pathogenic (recessive) g.69176943C>T g.69957093C>T C704T, EDA(NM_001399.5):c.463C>T (p.R155C) - EDA_000069 VKGL data sharing initiative Nederland PubMed: Monreal 1998, PubMed: Schneider 2011, PubMed: Wohlfart 2016 - - CLASSIFICATION record, Germline - 8/124 cases - - - Johan den Dunnen, VKGL-NL_Groningen, VKGL-NL_Utrecht
+?/. 1 2 c.466C>G r.(?) p.(Arg156Gly) - likely pathogenic g.69176946C>G g.69957096C>G - - EDA_000018 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+/. 7 2 c.466C>T r.(?) p.(Arg156Cys) ACMG pathogenic, pathogenic (dominant), pathogenic (recessive) g.69176946C>T g.69957096C>T 707C>T (R156C), C707T, R156C - EDA_000002 ACMG grading: PS3,PM1,PM2,PM5,PP3, frequent variant in HED, located in the furin cleavage site PubMed: Bayes 1998, PubMed: Burger 2014, PubMed: Cluzeau 2011, PubMed: Monreal 1998, 2 more items - rs132630313 De novo, Germline, Unknown - 1/124 cases - - - Johan den Dunnen, Andreas Laner, Céline Cluzeau
+/. 17 2 c.467G>A r.(?) p.(Arg156His) - pathogenic, pathogenic (dominant), pathogenic (recessive) g.69176947G>A g.69957097G>A 708G>A (R156H), G708A - EDA_000003 located in the furin cleavage site PubMed: Burger 2014, PubMed: Cluzeau 2011, PubMed: Monreal 1998, PubMed: Monreal 1998; OMIM:var0005, 3 more items - - De novo, Germline, Unknown - 8/124 cases - - - Johan den Dunnen, Céline Cluzeau
+/. 1 - c.467G>T r.(?) p.(Arg156Leu) - pathogenic (dominant) g.69176947G>T g.69957097G>T - - EDA_000109 - PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Johan den Dunnen
+/. 3 2 c.467_468del r.(?) p.(Arg156Glnfs*2) - pathogenic (dominant) g.69176947_69176948del g.69957097_69957098del 467_468del2 - EDA_000041 - PubMed: Wohlfart 2016 - - Germline - 3/124 cases - - - Sigrun Maier-Wohlfart
-?/. 1 - c.491A>C r.(?) p.(Glu164Ala) - likely benign g.69176971A>C g.69957121A>C EDA(NM_001399.4):c.491A>C (p.E164A) - EDA_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 6 - c.502+1G>A r.spl, r.spl? p.? - pathogenic, pathogenic (dominant) g.69176983G>A g.69957133G>A EDA(NM_001399.5):c.502+1G>A - EDA_000079 1 heterozygous, no homozygous; Clinindb (India), VKGL data sharing initiative Nederland PubMed: Burger 2014, PubMed: Narang 2020, Journal: Narang 2020, PubMed: Wohlfart 2016 - rs727505013 CLASSIFICATION record, Germline - 1/2793 individuals, 3/124 cases - - - Johan den Dunnen, VKGL-NL_Groningen, Mohammed Faruq
-?/. 1 2i c.502+27544G>A r.(?) p.(=) - likely benign g.69204526G>A g.69984676G>A - - EDA_000062 - PubMed: Kumar 2016, Journal: Kumar 2016 - - Germline - - - - - Thuong Ha
+?/. 1 4 c.503-?_1176+?del r.(?) p.(?) - likely pathogenic g.69243068_69255459del g.70023218_70035609del - - EDA_000035 1 more item PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+/. 1 2i_8_ c.(502+1_503-1)_(*1_?)del r.? p.? - pathogenic (dominant) g.(69176983_69243067)_(69255460_?)del g.(69957133_70023217)_(70035610_?)del exon 4-9 del - EDA_000095 gene exons described as 1a, 3a, 4-9 PubMed: Schneider 2011 - - Germline - - - - - Johan den Dunnen
+/. 1 2i_8_ c.(502+1_503-1)_(*1_?)dup r.(dup) p.? - pathogenic (dominant) g.(69176983_69243067)_(69255460_?)dup - dup ex3-8 - EDA_000047 - PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Sigrun Maier-Wohlfart
+/. 1 3i_6i c.527-3066_793+1017delinsGAGTACAG r.(del) p.? - pathogenic (dominant) g.69244641_69251387delinsGAGTACAG g.70024791_70031537delinsGAGTACAG 527-3066_793+1017del-ins8 (del ex4-6) - EDA_000045 1 more item PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Sigrun Maier-Wohlfart
-/. 1 - c.527-25del r.(=) p.(=) - benign g.69247682del g.70027832del EDA(NM_001399.5):c.527-34delA - EDA_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/., +?/. 3 - c.527G>T r.(?), r.spl p.(Arg153Cys), p.(Gly176Val) - likely pathogenic, pathogenic (dominant) g.69247707G>T g.70027857G>T g.411797G>T - EDA_000110 - PubMed: Burger 2014, PubMed: Schneider 2011 - - Germline - - - - - Johan den Dunnen, Sigrun Maier-Wohlfart
+/. 5 - c.533_552delinsCTGAA r.(?) p.(Lys178_Pro184delinsThrGlu) - pathogenic (dominant) g.69247713_69247732delinsCTGAA g.70027863_70027882delinsCTGAA 533_552del-ins5 - EDA_000111 - PubMed: Burger 2014, PubMed: Wohlfart 2016 - - Germline - 3/124 cases - - - Johan den Dunnen
+/. 1 - c.543_569del r.(?) p.(Asn185_Pro193del) - pathogenic g.69247723_69247749del g.70027873_70027899del EDA(NM_001399.5):c.543_569delTCCTGGACCCAATGGCCCTCCAGGACC (p.N185_P193del) - EDA_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 3 4 c.546_581del r.(?) p.(Asn185_Pro196del) - pathogenic (dominant) g.69247726_69247761del g.70027876_70027911del 536_571del36 (G180_P191del), 542_577del36 - EDA_000049, EDA_000112, EDA_000113 - PubMed: Burger 2014, PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Johan den Dunnen, Sigrun Maier-Wohlfart
+/. 4 - c.553_588del r.(?) p.(Asn185_Pro196del) - pathogenic, pathogenic (dominant), pathogenic (recessive) g.69247733_69247768del g.70027883_70027918del del794_829, EDA(NM_001399.5):c.553_588del (p.N185_P196del) - EDA_000080 VKGL data sharing initiative Nederland PubMed: Monreal 1998, PubMed: Schneider 2011 - - CLASSIFICATION record, De novo, Germline - - - - - Johan den Dunnen, VKGL-NL_Groningen
+/. 1 - c.562_589del r.(?) p.(Pro188Argfs*83) - pathogenic (recessive) g.69247742_69247769del g.70027892_70027919del del803-830 - EDA_000114 - PubMed: Monreal 1998 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.572_589del r.(?) p.(Pro191_Pro196del) - pathogenic (dominant) g.69247752_69247769del g.70027902_70027919del - - EDA_000115 - PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Johan den Dunnen
+?/. 1 4 c.573_590del r.(?) p.(Gly192_Gln197del) - likely pathogenic g.69247753_69247770del g.70027903_70027920del - - EDA_000034 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+/. 1 - c.574G>A r.(?) p.(Gly192Arg) - pathogenic (dominant) g.69247754G>A g.70027904G>A - - EDA_000116 - PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Johan den Dunnen
+/. 1 - c.599dup r.(?) p.(Gly201ArgfsTer39) - pathogenic g.69247779dup g.70027929dup EDA(NM_001399.5):c.599dupC (p.G201Rfs*39) - EDA_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 3 4 c.601G>T r.(?) p.(Gly201*) - pathogenic (dominant) g.69247781G>T g.70027931G>T - - EDA_000039 - PubMed: Wohlfart 2016 - - Germline - 3/124 cases - - - Sigrun Maier-Wohlfart
+/. 2 4 c.608C>T r.(?) p.(Pro203Leu) - pathogenic (dominant) g.69247788C>T g.70027938C>T - - EDA_000048 - PubMed: Wohlfart 2016 - - Germline - 2/124 cases - - - Sigrun Maier-Wohlfart
+?/. 1 4 c.620G>T r.(?) p.(Gly207Val) - likely pathogenic g.69247800G>T g.70027950G>T - - EDA_000019 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+/., ?/. 2 - c.626C>T r.(?) p.(Pro209Leu) - pathogenic (recessive), VUS g.69247806C>T g.70027956C>T C867T - EDA_000088 1 heterozygous, no homozygous; Clinindb (India) PubMed: Monreal 1998, PubMed: Narang 2020, Journal: Narang 2020 - rs132630315 Germline - 1/2782 individuals - - - Johan den Dunnen, Mohammed Faruq
+?/. 1 - c.628G>A r.(?) p.(Gly210Arg) - likely pathogenic g.69247808G>A g.70027958G>A EDA(NM_001399.5):c.628G>A (p.G210R) - EDA_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/. 1 4 c.632C>G r.(?) p.(Thr211Arg) - likely pathogenic g.69247812C>G g.70027962C>G - - EDA_000020 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+?/. 1 4 c.640dup r.(?) p.(Met214Asnfs*26) - likely pathogenic g.69247820dup g.70027970dup - - EDA_000033 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+/. 1 - c.643G>A r.(?) p.(Gly215Arg) - pathogenic (dominant) g.69247823G>A g.70027973G>A - - EDA_000117 - PubMed: Schneider 2011 - - Germline - - - - - Johan den Dunnen
+/. 1 - c.644G>A r.(?) p.(Gly215Glu) - pathogenic g.69247824G>A g.70027974G>A EDA(NM_001399.5):c.644G>A (p.G215E) - EDA_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 2 4 c.648_665del r.(?) p.(Pro220_Pro225del) - pathogenic (dominant) g.69247828_69247845del g.70027978_70027995del 648_665del18 (Pro216_Gly221del - EDA_000052 - PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Johan den Dunnen, Sigrun Maier-Wohlfart
+/. 2 - c.653G>A r.(?) p.(Gly218Asp) - pathogenic (dominant) g.69247833G>A g.70027983G>A - - EDA_000118 - PubMed: Wohlfart 2016 - - Germline - 2/124 cases - - - Johan den Dunnen
+/. 8 - c.659_676del r.(?) p.(Pro220_Pro225del) - pathogenic (dominant) g.69247839_69247856del g.70027989_70028006del - - EDA_000119 - PubMed: Burger 2014, PubMed: Schneider 2011, PubMed: Wohlfart 2016 - - Germline - 4/124 cases - - - Johan den Dunnen
+/. 1 - c.663_697del r.(?) p.(Pro222Thrfs*6) - pathogenic (recessive) g.69247843_69247877del g.70027993_70028027del del904-938 - EDA_000120 - PubMed: Monreal 1998 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.671G>C r.(?) p.(Gly224Ala) - pathogenic (recessive) g.69247851G>C g.70028001G>C G912C - EDA_000121 - PubMed: Monreal 1998 - - Germline - - - - - Johan den Dunnen
+/. 2 - c.671G>T r.(?) p.(Gly224Val) - pathogenic (dominant) g.69247851G>T g.70028001G>T - - EDA_000122 - PubMed: Burger 2014, PubMed: Schneider 2011 - - Germline - - - - - Johan den Dunnen
+/. 1 - c.686dup r.(?) p.(Gly230Trpfs*10) - pathogenic (dominant) g.69247866dup g.70028016dup 686insC - EDA_000123 - PubMed: Burger 2014 - - Germline - - - - - Johan den Dunnen
+?/. 1 4 c.694C>T r.(?) p.(Gln232X) - likely pathogenic g.69247874C>T g.70028024C>T - - EDA_000021 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
+/. 1 4i c.707-13T>G r.(?) p.(=) - pathogenic (dominant) g.69249341T>G g.70029491T>G splice site - EDA_000046 - PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Sigrun Maier-Wohlfart
+/. 1 - c.707-2A>G r.spl p.? - pathogenic (dominant) g.69249352A>G g.70029502A>G - - EDA_000124 - PubMed: Schneider 2011 - - Germline - - - - - Johan den Dunnen
+/. 1 - c.707-2A>T r.spl p.? - pathogenic (dominant) g.69249352A>T g.70029502A>T - - EDA_000125 - PubMed: Schneider 2011 - - Germline - - - - - Johan den Dunnen
+/., ?/. 5 5 c.730C>T r.(?) p.(Arg244*), p.(Arg244X), p.(R244X) - pathogenic, VUS g.69249377C>T g.70029527C>T 972C>T, EDA(NM_001399.5):c.730C>T (p.R244*) - EDA_000004 VKGL data sharing initiative Nederland PubMed: Vincent 2001 - - CLASSIFICATION record, Germline, Unknown - - - - - Céline Cluzeau, VKGL-NL_Groningen, Sha Hong
-?/. 1 - c.741+9G>A r.(=) p.(=) - likely benign g.69249397G>A g.70029547G>A EDA(NM_001399.4):c.741+9G>A - EDA_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.750G>T r.(?) p.(Val250=) - VUS g.69250327G>T - EDA(NM_001399.4):c.750G>T (p.V250=) - EDA_000146 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.755A>T r.(?) p.(His252Leu) - pathogenic (recessive) g.69250332A>T g.70030482A>T A986T - EDA_000126 - PubMed: Monreal 1998 - - Germline - - - - - Johan den Dunnen
-?/. 1 6 c.757C>T r.(?) p.= - likely benign g.69250334C>T g.70030484C>T L253L - EDA_000001 found once, nonrecurrent change PubMed: Tarpey 2009 - - Unknown - 1/208 cases - - - Lucy Raymond
+?/. 2 6 c.764G>A r.(?) p.(Gly255Asp) - likely pathogenic g.69250341G>A g.70030491G>A 1006G>A - EDA_000005 Asymptomatic mother, Mild affected father hemizygous for the mutation with mosaicism PubMed: Paakkonen 2001 - - Unknown - - - - - Céline Cluzeau
+/. 2 - c.784G>T r.(?) p.(Val262Phe) - pathogenic (dominant) g.69250361G>T g.70030511G>T - - EDA_000127 - PubMed: Schneider 2011, PubMed: Wohlfart 2016 - - Germline - 1/124 cases - - - Johan den Dunnen
+?/. 2 6 c.789_825del r.(?) p.(K263DfsX5) - likely pathogenic g.69250366_69253279del g.70030516_70033429del 789/795del36 - EDA_000014 - PubMed: Bayes 1998 - - Unknown - - - - - Céline Cluzeau
+/. 2 6 c.793G>T r.spl? p.[Asp265Tyr), ?] - pathogenic (dominant) g.69250370G>T g.70030520G>T - - EDA_000038 - PubMed: Wohlfart 2016 - - Germline - 2/124 cases - - - Sigrun Maier-Wohlfart
+/. 1 - c.793+1G>C r.spl p.? - pathogenic (dominant) g.69250371G>C g.70030521G>C - - EDA_000128 - PubMed: Schneider 2011 - - Germline - - - - - Johan den Dunnen
+?/. 1 - c.794-1G>A r.spl? p.? - likely pathogenic g.69253247G>A g.70033397G>A EDA(NM_001399.5):c.794-1G>A - EDA_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/. 1 7 c.797T>G r.(?) p.(Leu266Arg) - likely pathogenic g.69253251T>G g.70033401T>G - - EDA_000022 - PubMed: Cluzeau 2011 - - Unknown - - - - - Céline Cluzeau
Legend   How to query   « First ‹ Prev     1 2     Next › Last »