All variants in the FFAR4 gene

Information The variants shown are described using the NM_181745.3 transcript reference sequence.

4 entries on 1 page. Showing entries 1 - 4.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. - c.*6238G>T r.(=) p.(=) - VUS g.95353604G>T g.93593847G>T RBP4(NM_006744.3):c.544C>A (p.Q182K) - RBP4_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - c.*6243_*6262del r.(=) p.(=) - likely pathogenic g.95353609_95353628del - RBP4(NM_006744.4):c.524_543delAGGAGCTGTGCCTGGCCAGG (p.E175Afs*27) - RBP4_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-/. - c.*6302G>A r.(=) p.(=) - benign g.95353668G>A g.93593911G>A RBP4(NM_006744.4):c.480C>T (p.N160=) - RBP4_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.*6311C>T r.(=) p.(=) - likely benign g.95353677C>T g.93593920C>T RBP4(NM_006744.3):c.471G>A (p.R157=) - RBP4_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.