All variants in the FRMPD4 gene

Information The variants shown are described using the NM_014728.3 transcript reference sequence.

87 entries on 1 page. Showing entries 1 - 87.
Legend   How to query  



AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







+/. 1i_2i c.(42-2799_42-998)_(159-45940_159-44840)del r.? p.(Arg16_His54del) - likely pathogenic (recessive) g.(12514000_12515801)_(12581900_1258300)del - chrX:12515801–12581900del hg19 - FRMPD4_000075 ∼66 Kb microdeletion exon 2 PubMed: Piard 2018 - - Germline - - - 0 - Joaquin De La Torre Vela
+/. 1i_2i c.(42-2799_42-998)_(159-45940_159-44840)del r.? p.(Arg16_His54del) - likely pathogenic (recessive) g.(12514000_12515801)_(12581900_1258300)del - chrX:12515801–12581900del hg19 - FRMPD4_000075 ∼66 Kb microdeletion exon 2 PubMed: Piard 2018 - - Germline - - - 0 - Joaquin De La Torre Vela
?/. - c.42-319A>G r.(=) p.(=) - VUS g.12516480A>G g.12498361A>G - - FRMPD4_000020 - - - - Germline - - - - - Yu Sun
?/. - c.62G>C r.(?) p.(Gly21Ala) - VUS g.12516819G>C g.12498700G>C FRMPD4(NM_014728.3):c.62G>C (p.G21A) - FRMPD4_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+?/. - c.119_141del r.(?) p.(Glu40AlafsTer15) - likely pathogenic g.12516876_12516898del - FRMPD4(NM_014728.3):c.119_141delAGATGACGGCAAACCGAGATGGG (p.E40Afs*15) - FRMPD4_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. - c.301G>C r.(?) p.(Val101Leu) - VUS g.12627982G>C - - - FRMPD4_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.380C>T r.(?) p.(Pro127Leu) - likely benign g.12632958C>T g.12614839C>T FRMPD4(NM_014728.3):c.380C>T (p.P127L) - FRMPD4_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.388G>A r.(?) p.(Ala130Thr) - likely benign g.12632966G>A g.12614847G>A FRMPD4(NM_014728.3):c.388G>A (p.A130T, p.(Ala130Thr)) - FRMPD4_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.388G>A r.(?) p.(Ala130Thr) - likely benign g.12632966G>A g.12614847G>A FRMPD4(NM_014728.3):c.388G>A (p.A130T, p.(Ala130Thr)) - FRMPD4_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.396C>A r.(?) p.(Pro132=) - benign g.12632974C>A - FRMPD4(NM_014728.3):c.396C>A (p.P132=) - FRMPD4_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 5 c.438G>A r.(?) p.(=) - likely benign g.12692997G>A g.12674878G>A S146S - FRMPD4_000046 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - Lucy Raymond
+/. - c.856C>T r.(?) p.(Arg286*) - likely pathogenic (recessive) g.12712496C>T g.12694377C>T - - FRMPD4_000074 - PubMed: Piard 2018 - - Germline - - - 0 - Joaquin De La Torre Vela
+/. - c.856C>T r.(?) p.(Arg286*) - likely pathogenic (recessive) g.12712496C>T g.12694377C>T - - FRMPD4_000074 - PubMed: Piard 2018 - - Germline - - - 0 - Joaquin De La Torre Vela
-?/. - c.894A>G r.(?) p.(Leu298=) - likely benign g.12712534A>G g.12694415A>G FRMPD4(NM_014728.3):c.894A>G (p.L298=) - FRMPD4_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1187C>A r.(?) p.(Pro396Gln) - VUS g.12722594C>A g.12704475C>A FRMPD4(NM_014728.3):c.1187C>A (p.P396Q) - FRMPD4_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1197+12C>G r.(=) p.(=) - VUS g.12722616C>G g.12704497C>G - - FRMPD4_000017 - - - - Germline - - - - - Yu Sun
?/. - c.1197+12C>G r.(=) p.(=) - VUS g.12722616C>G g.12704497C>G - - FRMPD4_000017 - - - - Germline - - - - - Yu Sun
-/. - c.1197+12C>G r.(=) p.(=) - benign g.12722616C>G g.12704497C>G FRMPD4(NM_014728.3):c.1197+12C>G - FRMPD4_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.1198-5C>T r.spl? p.? - likely benign g.12724940C>T - FRMPD4(NM_014728.3):c.1198-5C>T - FRMPD4_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1224T>C r.(?) p.(His408=) - likely benign g.12724971T>C - FRMPD4(NM_014728.3):c.1224T>C (p.H408=) - FRMPD4_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1272C>G r.(?) p.(Phe424Leu) - VUS g.12725019C>G g.12706900C>G FRMPD4(NM_014728.3):c.1272C>G (p.(Phe424Leu)) - FRMPD4_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.1287+8del r.(=) p.(=) - VUS g.12725042del g.12706923del - - FRMPD4_000023 - - - - Germline - - - - - Yu Sun
?/. - c.1287+8del r.(=) p.(=) - VUS g.12725042del g.12706923del - - FRMPD4_000023 - - - - Germline - - - - - Yu Sun
-/. - c.1287+25_1287+26del r.(=) p.(=) - benign g.12725059_12725060del g.12706940_12706941del FRMPD4(NM_014728.3):c.1287+25_1287+26delTT - FRMPD4_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1287+26del r.(=) p.(=) - likely benign g.12725060del g.12706941del FRMPD4(NM_014728.3):c.1287+26delT - FRMPD4_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.1287+26dup r.(=) p.(=) - VUS g.12725060dup g.12706941dup - - FRMPD4_000003 - - - - Germline - - - - - Yu Sun
-?/. - c.1398C>T r.(?) p.(His466=) - likely benign g.12725698C>T g.12707579C>T FRMPD4(NM_014728.3):c.1398C>T (p.H466=) - FRMPD4_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 13 c.1401C>G r.(?) p.(=) - likely benign g.12725701C>G g.12707582C>G V467V - FRMPD4_000047 recurrent, found 17 times PubMed: Tarpey 2009 - - Germline - 17/208 cases - 0 - Lucy Raymond
-?/. - c.1452C>G r.(?) p.(Leu484=) - likely benign g.12725752C>G g.12707633C>G FRMPD4(NM_014728.3):c.1452C>G (p.L484=) - FRMPD4_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.1471-266_1471-259del r.(=) p.(=) - VUS g.12728252_12728259del g.12710133_12710140del - - FRMPD4_000021 - - - - Germline - - - - - Yu Sun
?/. - c.1471-266_1471-259del r.(=) p.(=) - VUS g.12728252_12728259del g.12710133_12710140del - - FRMPD4_000021 - - - - Germline - - - - - Yu Sun
?/. - c.1471-258_1471-251del r.(=) p.(=) - VUS g.12728260_12728267del g.12710141_12710148del - - FRMPD4_000006 - - - - Germline - - - - - Yu Sun
?/. - c.1471-258_1471-251del r.(=) p.(=) - VUS g.12728260_12728267del g.12710141_12710148del - - FRMPD4_000006 - - - - Germline - - - - - Yu Sun
?/. - c.1478C>T r.(?) p.(Thr493Met) - VUS g.12728525C>T - FRMPD4(NM_014728.3):c.1478C>T (p.T493M) - FRMPD4_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.1524G>T r.(?) p.(Thr508=) - likely benign g.12728571G>T - FRMPD4(NM_014728.3):c.1524G>T (p.T508=) - FRMPD4_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1538G>A r.(?) p.(Arg513Gln) - likely benign g.12728585G>A g.12710466G>A - - FRMPD4_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.1565T>C r.(?) p.(Ile522Thr) - VUS g.12728612T>C - FRMPD4(NM_014728.3):c.1565T>C (p.I522T) - FRMPD4_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.1602G>T r.(?) p.(Gln534His) - likely benign g.12728649G>T g.12710530G>T FRMPD4(NM_014728.3):c.1602G>T (p.Q534H) - FRMPD4_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 15 c.1657T>C r.(?) p.(Cys553Arg) - pathogenic (recessive) g.12734235T>C g.12716116T>C Cys553Arg - FRMPD4_000050 - PubMed: Hu 2016 - - De novo - - - 0 - Johan den Dunnen
+/. - c.1657T>C r.(?) p.(Cys553Arg) - likely pathogenic (recessive) g.12734235T>C g.12716116T>C - - FRMPD4_000050 - PubMed: Piard 2018 - - De novo - - - 0 - Joaquin De La Torre Vela
-?/. - c.1721A>C r.(?) p.(Asp574Ala) - likely benign g.12734299A>C - FRMPD4(NM_014728.3):c.1721A>C (p.(Asp574Ala)) - FRMPD4_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.1761G>A r.(?) p.(Met587Ile) - likely benign g.12734339G>A - FRMPD4(NM_014728.3):c.1761G>A (p.M587I) - FRMPD4_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1800C>T r.(?) p.(Ala600=) - likely benign g.12734378C>T g.12716259C>T FRMPD4(NM_014728.3):c.1800C>T (p.A600=) - FRMPD4_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1848C>A r.(?) p.(Ala616=) - likely benign g.12734426C>A - FRMPD4(NM_014728.3):c.1848C>A (p.A616=) - FRMPD4_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 15 c.1851del r.(?) p.(Cys618Valfs*8) - pathogenic (recessive) g.12734429del g.12716310del Cys618Valfs*8 - FRMPD4_000051 - PubMed: Hu 2016 - - Germline yes - - 0 - Johan den Dunnen
-?/. - c.1938G>A r.(?) p.(Pro646=) - likely benign g.12734516G>A g.12716397G>A FRMPD4(NM_014728.3):c.1938G>A (p.P646=) - FRMPD4_000070 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2048A>G r.(?) p.(Glu683Gly) - likely benign g.12734626A>G g.12716507A>G FRMPD4(NM_014728.3):c.2048A>G (p.E683G, p.(Glu683Gly)) - FRMPD4_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.2048A>G r.(?) p.(Glu683Gly) - likely benign g.12734626A>G g.12716507A>G FRMPD4(NM_014728.3):c.2048A>G (p.E683G, p.(Glu683Gly)) - FRMPD4_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.2072G>T r.(?) p.(Gly691Val) - likely benign g.12734650G>T g.12716531G>T FRMPD4(NM_014728.3):c.2072G>T (p.G691V) - FRMPD4_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.2243C>G r.(?) p.(Ala748Gly) - likely benign g.12734821C>G g.12716702C>G FRMPD4(NM_014728.3):c.2243C>G (p.A748G) - FRMPD4_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2247G>A r.(?) p.(Glu749=) - likely benign g.12734825G>A g.12716706G>A FRMPD4(NM_014728.3):c.2247G>A (p.E749=) - FRMPD4_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2250C>T r.(?) p.(Asp750=) - likely benign g.12734828C>T g.12716709C>T FRMPD4(NM_014728.3):c.2250C>T (p.D750=) - FRMPD4_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.2278C>T r.(?) p.(Leu760Phe) - VUS g.12734856C>T g.12716737C>T FRMPD4(NM_014728.3):c.2278C>T (p.(Leu760Phe)) - FRMPD4_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.2283G>C r.(?) p.(Val761=) - likely benign g.12734861G>C - FRMPD4(NM_014728.3):c.2283G>C (p.V761=) - FRMPD4_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2439C>A r.(?) p.(Gly813=) - likely benign g.12735017C>A - FRMPD4(NM_014728.3):c.2439C>A (p.G813=) - FRMPD4_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.2543C>T r.(?) p.(Ser848Phe) - VUS g.12735121C>T - FRMPD4(NM_014728.3):c.2543C>T (p.S848F) - FRMPD4_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2553C>T r.(?) p.(Asp851=) - likely benign g.12735131C>T - FRMPD4(NM_014728.3):c.2553C>T (p.D851=) - FRMPD4_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2599A>G r.(?) p.(Asn867Asp) - likely benign g.12735177A>G g.12717058A>G FRMPD4(NM_014728.3):c.2599A>G (p.N867D) - FRMPD4_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.2615C>T r.(?) p.(Thr872Met) - VUS g.12735193C>T - FRMPD4(NM_014728.3):c.2615C>T (p.T872M) - FRMPD4_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. - c.2640C>T r.(?) p.(Ser880=) - likely benign g.12735218C>T g.12717099C>T FRMPD4(NM_014728.3):c.2640C>T (p.S880=) - FRMPD4_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.2841A>G r.(?) p.(Ala947=) - likely benign g.12735786A>G - FRMPD4(NM_014728.3):c.2841A>G (p.A947=) - FRMPD4_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 16 c.2868C>T r.(?) p.(=) - likely benign g.12735813C>T g.12717694C>T S956S - FRMPD4_000048 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - Lucy Raymond
?/. - c.2878G>A r.(?) p.(Ala960Thr) - VUS g.12735823G>A g.12717704G>A FRMPD4(NM_014728.3):c.2878G>A (p.A960T, p.(Ala960Thr)) - FRMPD4_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.2878G>A r.(?) p.(Ala960Thr) - likely benign g.12735823G>A g.12717704G>A FRMPD4(NM_014728.3):c.2878G>A (p.A960T, p.(Ala960Thr)) - FRMPD4_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.2914G>T r.(?) p.(Ala972Ser) - VUS g.12735859G>T g.12717740G>T FRMPD4(NM_014728.3):c.2914G>T (p.(Ala972Ser)) - FRMPD4_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.2917G>C r.(?) p.(Ala973Pro) - likely benign g.12735862G>C g.12717743G>C FRMPD4(NM_014728.3):c.2917G>C (p.A973P) - FRMPD4_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.3067T>C r.(?) p.(Cys1023Arg) - likely benign g.12736012T>C g.12717893T>C FRMPD4(NM_014728.3):c.3067T>C (p.C1023R) - FRMPD4_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.3097G>A r.(?) p.(Asp1033Asn) - likely benign g.12736042G>A g.12717923G>A FRMPD4(NM_014728.3):c.3097G>A (p.(Asp1033Asn)) - FRMPD4_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.3268A>G r.(?) p.(Ser1090Gly) - likely benign g.12736213A>G g.12718094A>G FRMPD4(NM_014728.3):c.3268A>G (p.S1090G) - FRMPD4_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.3379G>A r.(?) p.(Glu1127Lys) - likely benign g.12736324G>A - FRMPD4(NM_014728.3):c.3379G>A (p.E1127K) - FRMPD4_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.3400C>T r.(?) p.(Pro1134Ser) - VUS g.12736345C>T g.12718226C>T FRMPD4(NM_014728.3):c.3400C>T (p.(Pro1134Ser)) - FRMPD4_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.3438A>C r.(?) p.(Gln1146His) - likely benign g.12736383A>C g.12718264A>C FRMPD4(NM_014728.3):c.3438A>C (p.Q1146H, p.(Gln1146His)) - FRMPD4_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.3438A>C r.(?) p.(Gln1146His) - likely benign g.12736383A>C g.12718264A>C FRMPD4(NM_014728.3):c.3438A>C (p.Q1146H, p.(Gln1146His)) - FRMPD4_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.3445C>T r.(?) p.(Arg1149Cys) - likely benign g.12736390C>T g.12718271C>T FRMPD4(NM_014728.3):c.3445C>T (p.R1149C) - FRMPD4_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.3491A>T r.(?) p.(Asp1164Val) - likely benign g.12736436A>T g.12718317A>T FRMPD4(NM_014728.3):c.3491A>T (p.D1164V, p.(Asp1164Val)) - FRMPD4_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.3491A>T r.(?) p.(Asp1164Val) - likely benign g.12736436A>T g.12718317A>T FRMPD4(NM_014728.3):c.3491A>T (p.D1164V, p.(Asp1164Val)) - FRMPD4_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.3565C>T r.(?) p.(Arg1189Cys) - VUS g.12736510C>T g.12718391C>T FRMPD4(NM_014728.3):c.3565C>T (p.(Arg1189Cys)) - FRMPD4_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.3713C>T r.(?) p.(Pro1238Leu) - likely benign g.12736658C>T g.12718539C>T FRMPD4(NM_014728.3):c.3713C>T (p.P1238L) - FRMPD4_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.3813C>T r.(?) p.(His1271=) - likely benign g.12736758C>T g.12718639C>T FRMPD4(NM_014728.3):c.3813C>T (p.H1271=) - FRMPD4_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 16 c.3937C>A r.(?) p.(=) - likely benign g.12736882C>A g.12718763C>A R1313R - FRMPD4_000049 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - Lucy Raymond
-?/. - c.3937C>A r.(?) p.(Arg1313=) - likely benign g.12736882C>A - FRMPD4(NM_014728.3):c.3937C>A (p.R1313=) - FRMPD4_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.3964+237G>T r.(=) p.(=) - VUS g.12737146G>T g.12719027G>T - - FRMPD4_000008 - - - - Germline - - - - - Yu Sun
?/. - c.3964+237G>T r.(=) p.(=) - VUS g.12737146G>T g.12719027G>T - - FRMPD4_000008 - - - - Germline - - - - - Yu Sun
?/. - c.*642A>G r.(=) p.(=) - VUS g.12739294A>G g.12721175A>G - - FRMPD4_000011 - - - - Germline - - - - - Yu Sun
?/. - c.*642A>G r.(=) p.(=) - VUS g.12739294A>G g.12721175A>G - - FRMPD4_000011 - - - - Germline - - - - - Yu Sun
?/. - c.*1466T>C r.(=) p.(=) - VUS g.12740118T>C g.12721999T>C - - FRMPD4_000014 - - - - Germline - - - - - Yu Sun
?/. - c.*1466T>C r.(=) p.(=) - VUS g.12740118T>C g.12721999T>C - - FRMPD4_000014 - - - - Germline - - - - - Yu Sun
Legend   How to query