Unique variants in the FZD4 gene

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_012193.3 transcript reference sequence.

94 entries on 1 page. Showing entries 1 - 94.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+?/., ?/. 2 - c.? r.(?), r.0 p.(Leu443Met), p.0 - likely pathogenic (dominant), VUS g.? - whole gene deletion - DRD4_000002 - PubMed: Heidet 2017, PubMed: Seo 2015 - - Germline - - - - - Johan den Dunnen
-?/. 1 - c.-12C>A r.(?) p.(=) - likely benign g.86666139G>T g.86955097G>T FZD4(NM_012193.3):c.-12C>A - FZD4_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 _1_1i c.-313_(285+1_286-1)[0] r.0? p.0? - pathogenic (dominant) g.(86663513_86665842)_(86666440_?)del g.(86952471_86954800)_(86955398_?)del del exon 1 - FZD4_000077 - PubMed: Mammo 2015 - - Germline/De novo (untested) - - - - - Dimitra Ilektra Lerou
+/. 3 - c.40_49del r.(?) p.(Pro14Serfs*44), p.(Pro14SerfsTer44) - pathogenic g.86666089_86666098del g.86955047_86955056del 40_49delCCCGGGGGCG - FZD4_000050 VKGL data sharing initiative Nederland PubMed: Khan 2016, PubMed: TKhan 2016 - - CLASSIFICATION record, Germline yes - - - - VKGL-NL_Nijmegen, Dimitra Ilektra Lerou
?/. 1 - c.47G>A r.(?) p.(Gly16Asp) - VUS g.86666081C>T g.86955039C>T FZD4(NM_012193.3):c.47G>A (p.G16D) - FZD4_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.48C>T r.(?) p.(Gly16=) - benign g.86666080G>A g.86955038G>A FZD4(NM_012193.3):c.48C>T (p.G16=) - FZD4_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/., -/. 3 1 c.97C>T r.(?) p.(Pro33Ser) - benign, pathogenic g.86666031G>A g.86954989G>A P33S - FZD4_000033 VKGL data sharing initiative Nederland PubMed: MacDonald 2005, PubMed: Nallathambi 2006 - - CLASSIFICATION record, Germline, Germline/De novo (untested) yes 1/53 families - - - Johan den Dunnen, VKGL-NL_Nijmegen, Dimitra Ilektra Lerou
+/. 2 1 c.107G>A r.(?) p.(Gly36Asp) - pathogenic g.86666021C>T g.86954979C>T G36D - FZD4_000011 0/400 control chromosomes Toomes 2004b, PubMed: Tang 2016 - - Germline yes 1/40 - - - Johan den Dunnen, Dimitra Ilektra Lerou
+/., ?/. 3 1 c.118G>C r.(?) p.(Glu40Gln) - pathogenic, VUS g.86666010C>G g.86954968C>G - - FZD4_000012 0/100 control chromosomes; carries pathogenic variant LRP5:c.4489-1G>A, 1 more item PubMed: Nikopoulos 2010, PubMed: Tiwari 2016 - - CLASSIFICATION record, Germline - 1/8 - - - Frans Cremers, VKGL-NL_Nijmegen
+/. 1 1 c.133T>A r.(?) p.(Cys45Ser) - pathogenic g.86665995A>T g.86954953A>T C45S - FZD4_000076 - PubMed: Tang 2015 - - Germline yes - - - - Dimitra Ilektra Lerou
+/. 1 1 c.133T>C r.(?) p.(Cys45Arg) - pathogenic g.86665995A>G g.86954953A>G C45R - FZD4_000075 - PubMed: Tang 2015 - - Germline yes - - - - Dimitra Ilektra Lerou
+/. 1 1 c.134G>A r.(?) p.(Cys45Tyr) - pathogenic g.86665994C>T g.86954952C>T C45Y - FZD4_000074 - PubMed: Tang 2015 - - Germline yes - - - - Dimitra Ilektra Lerou
+/. 1 1 c.158G>C r.(?) p.(Cys53Ser) - pathogenic g.86665970C>G g.86954928C>G C53S - FZD4_000073 - PubMed: Tang 2016 - - Germline yes - - - - Dimitra Ilektra Lerou
+?/. 1 - c.160C>T r.(?) p.(Gln54Ter) - likely pathogenic (dominant) g.86665968G>A g.86954926G>A - - FZD4_000110 - PubMed: Seo 2015 - - Germline - - - - - -
?/. 1 - c.177C>A r.(?) p.(Asn59Lys) - VUS g.86665951G>T g.86954909G>T FZD4(NM_012193.3):c.177C>A (p.N59K) - FZD4_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/., -?/. 2 1 c.205C>T r.(?) p.(His69Tyr) - likely benign, pathogenic g.86665923G>A g.86954881G>A FZD4(NM_012193.3):c.205C>T (p.H69Y), p.H69Y - FZD4_000035 VKGL data sharing initiative Nederland PubMed: Omoto 2004 - - CLASSIFICATION record, Germline yes - - - - VKGL-NL_Rotterdam, Dimitra Ilektra Lerou
+/. 1 1 c.223G>A r.(?) p.(Ala75Thr) - pathogenic g.86665905C>T g.86954863C>T A75T - FZD4_000072 - PubMed: Tang 2016 - - Unknown yes - - - - Dimitra Ilektra Lerou
+/. 1 1 c.244_251delinsGCAGCTCATCCAGTACGCCGAGCTGCA r.(?) p.(Phe82Alafs*54) - pathogenic g.86665877_86665884delinsTGCAGCTCGGCGTACTGGATGAGCTGC g.86954835_86954842delinsTGCAGCTCGGCGTACTGGATGAGCTGC 244_251del8ins27 (F82fsX135) - FZD4_000001 0/200 control chromosomes PubMed: Nallathambi 2006 - - Germline yes 1/53 families - - - Johan den Dunnen
+/. 1 1 c.268T>C r.(?) p.(Cys90Arg) - pathogenic g.86665860A>G g.86954818A>G C90R - FZD4_000071 - PubMed: Tang 2016 - - Germline yes - - - - Dimitra Ilektra Lerou
+/. 1 - c.277C>T r.(?) p.(Gln93Ter) - pathogenic g.86665851G>A g.86954809G>A - - FZD4_000097 - PubMed: Iarossi 2017 - - Germline - - - - - -
-?/. 1 - c.285+18_285+23dup r.(=) p.(=) - likely benign g.86665830_86665835dup g.86954788_86954793dup FZD4(NM_012193.3):c.285+18_285+23dupCACCCC - FZD4_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/., +?/., ?/. 16 2 c.313A>G r.(?) p.(Met105Val) - likely pathogenic, likely pathogenic (dominant), pathogenic, VUS g.86663485T>C g.69991122T>C, g.86952443T>C M105V - FZD4_000013 0/300 control chromosomes, not in 358 control alleles, not in 624 control chromosomes, 1 more item Kondo 2003, PubMed: Iwata 2019, PubMed: Ellingford 2016, PubMed: Huang 2017, PubMed: Musada 2016, 4 more items - - De novo, Germline, Germline/De novo (untested) yes 1/24, 1/596 chromosomes - - - Johan den Dunnen, Dimitra Ilektra Lerou, Jasmine Chen
+/. 1 2 c.314T>C r.(?) p.(Met105Thr) - pathogenic g.86663484A>G g.86952442A>G - - FZD4_000014 0/400 control chromosomes Toomes 2004b - - Germline - 1/40 - - - Johan den Dunnen
+/. 1 2 c.341T>C r.(?) p.(Ile114Thr) - pathogenic g.86663457A>G g.86952415A>G - - FZD4_000015 - Robitaille 2009 - - Germline yes 1/2 - - - Johan den Dunnen
+/. 1 2 c.341T>G r.(?) p.(Ile114Ser) - pathogenic g.86663457A>C g.86952415A>C - - FZD4_000103 - PubMed: Musada 2016 - - Germline - - - - - -
+/., +?/. 5 - c.349T>C r.(?) p.(Cys117Arg) ACMG likely pathogenic, pathogenic, pathogenic (dominant) g.86663449A>G g.86952407A>G - - FZD4_000094 - PubMed: Patel 2016, PubMed: Schatz 2017, PubMed: Sharon 2019 - - Germline - 1/2420 IRD families - - - Global Variome, with Curator vacancy, Johan den Dunnen
?/. 1 - c.356G>T r.(?) p.(Gly119Val) - VUS g.86663442C>A g.86952400C>A - - FZD4_000102 - PubMed: Tiwari 2016 - - Germline - - - - - -
+/. 1 - c.400G>T r.(?) p.(Glu134*) - pathogenic g.86663398C>A g.86952356C>A - - FZD4_000059 - PubMed: Fei 2015 - - Germline yes 1/61 - - - Dimitra Ilektra Lerou
+?/. 1 - c.456C>G r.(?) p.(Asn152Lys) - likely pathogenic (dominant) g.86663342G>C g.86952300G>C - - FZD4_000109 not in 362 control alleles PubMed: Seo 2015 - - Germline - - - - - -
+/. 1 2 c.469A>G r.(?) p.(Met157Val) - pathogenic g.86663329T>C g.86952287T>C - - FZD4_000016 0/400 control chromosomes Toomes 2004b - - Germline yes 1/40 - - - Johan den Dunnen
+/., +?/. 3 2 c.470T>C r.(?) p.(Met157Thr) - likely pathogenic (dominant), pathogenic g.86663328A>G g.86952286A>G - - FZD4_000101 not in 368 control alleles PubMed: Musada 2016, PubMed: Seo 2015 - - Germline yes - - - - -
+/., -/., -?/. 4 2 c.502C>T r.(?) p.(Pro168Ser) - benign, likely benign, pathogenic g.86663296G>A g.86952254G>A P168S - FZD4_000042 117 heterozygous; Clinindb (India), 2 homozygous; Clinindb (India), 1 more item PubMed: MacDonald , PubMed: Narang 2020, Journal: Narang 2020 - rs61735303 CLASSIFICATION record, Germline, Germline/De novo (untested) yes 117/2795 individuals, 2/2795 individuals - - - VKGL-NL_Nijmegen, Dimitra Ilektra Lerou, Mohammed Faruq
+?/. 1 - c.539_540del r.(?) p.(Glu180ValfsTer9) - likely pathogenic (dominant) g.86663260_86663261del g.86952218_86952219del 539_540delAG - FZD4_000108 - PubMed: Seo 2015 - - Germline - - - - - -
+/. 2 2 c.541T>C r.(?) p.(Cys181Arg) - pathogenic g.86663257A>G g.86952215A>G p.C181R - FZD4_000017 0/240 control chromosomes Omoto 2004, PubMed: Omoto 2004 - - Germline yes 1/2 - - - Johan den Dunnen, Dimitra Ilektra Lerou
+/. 1 - c.542G>A r.(?) p.(Cys181Tyr) - pathogenic g.86663256C>T g.86952214C>T - - FZD4_000096 - PubMed: Iarossi 2017 - - Germline - - - - - -
+/. 1 2 c.609G>C r.(?) p.(Lys203Asn) - pathogenic g.86663189C>G g.86952147C>G - - FZD4_000018 0/346 control chromosomes Ells 2010 - - Germline yes 1/104 - - - Johan den Dunnen
+/. 1 2 c.610T>C r.(?) p.(Cys204Arg) - pathogenic g.86663186A>G - 916T>C (Cys202Arg - FZD4_000020 1 more item PubMed: Nallathambi 2006 - - Germline yes 1/53 families - - - Johan den Dunnen
+/. 2 2 c.611G>A r.(?) p.(Cys204Tyr) - pathogenic g.86663187C>T g.86952145C>T - - FZD4_000019 0/100 control chromosomes, VKGL data sharing initiative Nederland PubMed: Nikopoulos 2010 - - CLASSIFICATION record, Germline - 1/8 - - - Frans Cremers, VKGL-NL_Nijmegen
+?/. 1 - c.611G>T r.(?) p.(Cys204Phe) - likely pathogenic g.86663187C>A g.86952145C>A - - FZD4_000095 - PubMed: Iarossi 2017 - - Germline - - - - - -
-?/. 1 - c.653_676dup r.(?) p.(Phe218_Val225dup) - likely benign g.86663124_86663147dup g.86952082_86952105dup 653_676dup24 - FZD4_000107 not in 360 control alleles PubMed: Seo 2015 - - Germline - 1/51 patients - - - -
+?/. 1 - c.664T>C r.(?) p.(Trp222Arg) - likely pathogenic (dominant) g.86663134A>G g.86952092A>G 664A>G - FZD4_000104 - PubMed: Weisschuh 2016 - - Germline - - - - - -
+/. 1 2 c.668T>A r.(?) p.(Met223Lys) - pathogenic g.86663130A>T g.86952088A>T - - FZD4_000021 0/80 control chromosomes Boonstra 2009 - - Germline yes 1/20 - - - Johan den Dunnen
+?/. 1 - c.676T>A r.(?) p.(Trp226Arg) - likely pathogenic (dominant) g.86663122A>T g.86952080A>T - - FZD4_000106 not in 358 control alleles PubMed: Seo 2015 - - Germline - - - - - -
-?/. 1 - c.729C>T r.(?) p.(Ile243=) - likely benign g.86663069G>A g.86952027G>A FZD4(NM_012193.3):c.729C>T (p.I243=) - FZD4_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 - c.749A>G r.(?) p.(Tyr250Cys) - pathogenic g.86663049T>C g.86952007T>C g.86952007T>C - FZD4_000058 - PubMed: Yang et al 2018, PubMed: Yang 2018 - - Germline yes - - - - Dimitra Ilektra Lerou
?/. 1 - c.757C>T r.(?) p.(Arg253Cys) - VUS g.86663041G>A g.86951999G>A - - FZD4_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/., +?/., ?/. 5 2 c.766A>G r.(?) p.(Ile256Val) - likely pathogenic, pathogenic, VUS g.86663032T>C g.86951990T>C FZD4(NM_012193.3):c.766A>G (p.I256V), I256V - FZD4_000022 0/200 control chromosomes, 1 heterozygous, no homozygous; Clinindb (India), 1 more item MacDonald 2005, PubMed: MacDonald 2005, PubMed: Narang 2020, Journal: Narang 2020 - rs104894223 CLASSIFICATION record, Germline, Germline/De novo (untested) yes 1/20, 1/2795 individuals - - - Johan den Dunnen, VKGL-NL_Rotterdam, VKGL-NL_AMC, Dimitra Ilektra Lerou, Mohammed Faruq
+?/. 1 - c.818T>G r.(?) p.(Leu273Arg) - likely pathogenic g.86662980A>C g.86951938A>C - - FZD4_000070 - PubMed: Bochiccio 2017 - - Unknown yes - - - - Dimitra Ilektra Lerou
+/. 2 2 c.856G>T r.(?) p.(Glu286*), p.(Glu286Ter) - pathogenic g.86662942C>A g.86951900C>A - - FZD4_000002 0/100 control chromosomes, VKGL data sharing initiative Nederland PubMed: Nikopoulos 2010 - - CLASSIFICATION record, Germline yes 1/8 - - - Frans Cremers, VKGL-NL_Nijmegen
+/. 2 - c.905G>A r.(?) p.(Cys302Tyr) - pathogenic g.86662893C>T g.86951851C>T - - FZD4_000054 - PubMed: Tian et al 2019, PubMed: Tian 2019 - - Germline yes 1/621 - - - Dimitra Ilektra Lerou
-/. 1 - c.945C>T r.(?) p.(Ala315=) - benign g.86662853G>A g.86951811G>A FZD4(NM_012193.3):c.945C>T (p.A315=) - FZD4_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 5 2 c.957del r.(?) p.(Trp319Cysfs*5) - pathogenic g.86662842del g.86951800del 957delG - FZD4_000003 0/200 control chromosomes Toomes 2004b, PubMed: Edwards 2012 - - Germline yes 1/40 - - - Johan den Dunnen, Dimitra Ilektra Lerou
+/. 4 2 c.957G>A r.(?) p.(Trp319*), p.(Trp319Ter) - pathogenic g.86662841C>T g.86951799C>T W319X - FZD4_000004 0/300 control chromosomes, 0/80 control chromosomes, VKGL data sharing initiative Nederland Boonstra 2009, Kondo 2003, PubMed: Tang 2016 - - CLASSIFICATION record, Germline yes 1/24, 5/20 - - - Johan den Dunnen, VKGL-NL_Nijmegen, Dimitra Ilektra Lerou
?/. 1 - c.961G>A r.(?) p.(Val321Ile) - VUS g.86662837C>T g.86951795C>T - - FZD4_000100 - PubMed: Ellingford 2016 - - Germline - - - - - -
+/. 2 2 c.975_978del r.(?) p.(Thr326Glyfs*31) - pathogenic g.86662824_86662827del g.86951782_86951785del 975_978delCACT, 975_978delCACT T326fsX356 - FZD4_000069 - PubMed: Tang 2015 - - Germline yes - - - - Dimitra Ilektra Lerou
+/. 1 - c.1004G>A r.(?) p.(Trp335Ter) - pathogenic g.86662794C>T g.86951752C>T - - FZD4_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 2 c.1005G>C r.(?) p.(Trp335Cys) - pathogenic g.86662793C>G g.86951751C>G - - FZD4_000023 0/300 control chromosomes Qin 2005 - - Germline yes 1/56 - - - Johan den Dunnen
?/. 1 - c.1009C>A r.(?) p.(His337Asn) - VUS g.86662789G>T g.86951747G>T FZD4(NM_012193.3):c.1009C>A (p.H337N) - FZD4_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 2 c.1024A>G r.(?) p.(Met342Val) - pathogenic g.86662774T>C g.86951732T>C - - FZD4_000024 0/120 control chromosomes, 0/300 control chromosomes Qin 2005, Yoshida 2004 - - Germline yes 1/1, 1/56 - - - Johan den Dunnen
+/. 1 - c.1026G>A r.(?) p.(Met342Val) - pathogenic g.86662772C>T g.86951730C>T - - FZD4_000068 - PubMed: Yoshida 2004 - - Germline yes - - - - Dimitra Ilektra Lerou
+/. 1 2 c.1034_1054del r.(?) p.(Ser345_Ala351del) - pathogenic g.86662746_86662766del g.86951704_86951724del 1034_1054delCTTATTTCCACATTGCAGCCT S345_A351del - FZD4_000067 - PubMed: Tang 2015 - - Germline yes - - - - Dimitra Ilektra Lerou
+/. 1 2 c.1109C>G r.(?) p.(Ala370Gly) - pathogenic g.86662689G>C g.86951647G>C - - FZD4_000025 0/346 control chromosomes Ells 2010 - - Germline - 1/104 - - - Johan den Dunnen
-/. 1 - c.1152C>T r.(?) p.(Leu384=) - benign g.86662646G>A g.86951604G>A FZD4(NM_012193.3):c.1152C>T (p.L384=) - FZD4_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.1167G>C r.(?) p.(Gly389=) - benign g.86662631C>G g.86951589C>G FZD4(NM_012193.3):c.1167G>C (p.G389=) - FZD4_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 2 - c.1188_1192del r.(?) p.(Phe396Leufs*61) - likely pathogenic g.86662609_86662613del g.86951567_86951571del - - FZD4_000053 - PubMed: Tian et al 2019 - - Germline yes 1/621 - - - Dimitra Ilektra Lerou
+?/. 1 - c.1210_1211del r.(?) p.(Leu404ValfsTer54) - likely pathogenic (dominant) g.86662588_86662589del g.86951546_86951547del 1210_1211delTT - FZD4_000105 - PubMed: Seo 2015 - - Germline - - - - - -
+/., +?/. 2 - c.1220del r.(?) p.(Ala407Valfs*24) - likely pathogenic, pathogenic (dominant) g.86662578del g.86951536del 1220delC - FZD4_000052 - PubMed: Tian et al 2019, PubMed: Tian 2019 - - Germline yes 1/621 - - - Dimitra Ilektra Lerou
?/. 1 - c.1239G>C r.(?) p.(Leu413Phe) - VUS g.86662559C>G g.86951517C>G FZD4(NM_012193.3):c.1239G>C (p.L413F) - FZD4_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 2 2 c.1250G>A r.(?) p.(Arg417Gln) - pathogenic g.86662548C>T g.86951506C>T - - FZD4_000026 0/300 control chromosomes Kondo 2003, PubMed: Kondo 2009 - - Germline yes 2/24 - - - Johan den Dunnen, Dimitra Ilektra Lerou
?/. 1 - c.1262A>C r.(?) p.(Gln421Pro) - VUS g.86662536T>G g.86951494T>G - - FZD4_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/., +?/., ?/. 12 2 c.1282_1285del r.(?) p.(Asp428Serfs*2), p.(Asp428SerfsTer2) - likely pathogenic, likely pathogenic (dominant), pathogenic, VUS g.86662518_86662521del g.86951476_86951479del 1282_1285delGACA, 1282_1285delGACA D428fsX429, 1282_1285delGACA/1286-1290delAGTTA - FZD4_000005 0/100 control chromosomes, mother nonpenetrant carrier PubMed: Ellingford 2016, PubMed: Musada 2016, PubMed: Nikopoulos 2010, PubMed: Seo 2015, 2 more items - - De novo, Germline yes 1/8 - - - Frans Cremers, Dimitra Ilektra Lerou, Jasmine Chen
+/. 3 2 c.1286_1290del r.(?) p.(Lys429Argfs*28), p.(Lys429ArgfsTer28) - pathogenic g.86662509_86662513del g.86951467_86951471del 1286-1290delAGTTA - FZD4_000006 - Muller 2008, PubMed: Musada 2016 - - Germline yes 1/2l - - - Johan den Dunnen
+?/. 2 - c.1325T>A r.(?) p.(Val442Glu) - likely pathogenic g.86662473A>T g.86951431A>T - - FZD4_000055 - PubMed: Tian 2019, PubMed: Tian et al 2019 - - Germline yes 1/621 - - - Dimitra Ilektra Lerou
+/., +?/. 2 2 c.1333A>C r.(?) p.(Thr445Pro) - likely pathogenic, pathogenic g.86662465T>G g.86951423T>G - - FZD4_000027 0/80 control chromosomes, VKGL data sharing initiative Nederland Boonstra 2009 - - CLASSIFICATION record, Germline yes 1/20 - - - Johan den Dunnen, VKGL-NL_Nijmegen
+/. 1 2 c.1395_1396insT r.(?) p.(Arg466SerfsTer6) - pathogenic g.86662407dup g.86951365dup - - FZD4_000099 - PubMed: Musada 2016 - - Germline - - - - - -
+/. 1 2 c.1463G>A r.(?) p.(Gly488Asp) - pathogenic g.86662335C>T g.86951293C>T - - FZD4_000028 0/300 control chromosomes Kondo 2003 - - Germline yes 1/24 - - - Johan den Dunnen
+?/. 1 - c.1472C>G r.(?) p.(Ser491*) - likely pathogenic g.86662326G>C g.86951284G>C - - FZD4_000066 - PubMed: Bochiccio 2017 - - Unknown yes - - - - Dimitra Ilektra Lerou
+/. 1 2 c.1474G>C r.(?) p.(Gly492Arg) - pathogenic g.86662324C>G g.86951282C>G - - FZD4_000029 - Muller 2008 - - Germline yes 1/2 - - - Johan den Dunnen
+/., +?/. 3 2 c.1475del r.(?) p.(Gly492Alafs*21) - likely pathogenic, pathogenic g.86662324del g.86951282del 1474delG, 1475delG G492fsX512 - FZD4_000056 - PubMed: Montecinos-Contreras 2016 , PubMed: Montecinos-Contreras 2016, PubMed: Tang 2015 - - De novo, Germline yes - - - - Dimitra Ilektra Lerou
+/. 2 2 c.1479_1484del r.(?) p.(Met493_Trp494del) - pathogenic g.86662316_86662321del g.86951274_86951279del 1479_1484delGTGGAT - FZD4_000032 0/306 control chromosomes PubMed: Robitaille 2002, Journal: Robitaille 2002, OMIM:var0001, 1 more item - - Germline yes 1/2 families - - - Johan den Dunnen, Dimitra Ilektra Lerou
+/., +?/. 2 2 c.1488G>A r.(?) p.(Trp496*), p.(Trp496Ter) - likely pathogenic, pathogenic g.86662310C>T g.86951268C>T - - FZD4_000007 0/80 control chromosomes, VKGL data sharing initiative Nederland Boonstra 2009 - - CLASSIFICATION record, Germline yes 1/20 - - - Johan den Dunnen, VKGL-NL_Nijmegen
+/. 1 2 c.1490C>T r.(?) p.(Ser497Phe) - pathogenic g.86662308G>A g.86951266G>A - - FZD4_000030 0/400 control chromosomes Toomes 2004b - - Germline - 1/40 - - - Johan den Dunnen
+/. 2 2 c.1498del r.(?) p.(Thr500Leufs*13) - pathogenic g.86662303del g.86951261del 1498delA T500fsX512 - FZD4_000008 0/200 control chromosomes Toomes 2004b, PubMed: Tang 2016 - - De novo, Germline yes 1/40 - - - Johan den Dunnen, Dimitra Ilektra Lerou
+/. 1 - c.1500_1506del r.(?) p.(Leu501Argfs*10) - pathogenic (dominant) g.86662294_86662300del g.86951252_86951258del 1498_1504del (500_502del) - FZD4_000062 - PubMed: Zhou 2018 - - Germline - - - - - -
+/. 3 2 c.1501_1502del r.(?) p.(Leu501Serfs*33) - pathogenic g.86662298_86662299del g.86951256_86951257del 1501_1502delCT - FZD4_000009 0/200 control chromosomes, 0/306 control chromosomes Toomes 2004b, PubMed: Robitaille 2002, PubMed: Robitaille 2002, Journal: Robitaille 2002, OMIM:var0002 - - Germline yes 1/2 families, 1/40 - - - Johan den Dunnen, Dimitra Ilektra Lerou
+/. 1 - c.1506del r.(?) p.(His502Glnfs*11) - pathogenic g.86662292del g.86951250del 1506delC - FZD4_000057 - PubMed: Fei 2015 - - De novo yes 1/61 - - - Dimitra Ilektra Lerou
+/. 1 2 c.1513C>T r.(?) p.(Gln505*) - pathogenic g.86662285G>A g.86951243G>A - - FZD4_000010 0/200 control chromosomes Toomes 2004b - - Germline yes 1/40 - - - Johan den Dunnen
?/. 1 - c.1561A>G r.(?) p.(Lys521Glu) - VUS g.86662237T>C g.86951195T>C - - FZD4_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 2 c.1573G>C r.(?) p.(Gly525Arg) - pathogenic g.86662225C>G g.86951183C>G - - FZD4_000031 0/100 control chromosomes PubMed: Nikopoulos 2010 - - Germline yes 1/8 - - - Frans Cremers
?/. 1 - c.1592A>G r.(?) p.(Lys531Arg) - VUS g.86662206T>C g.86951164T>C FZD4(NM_012193.3):c.1592A>G (p.K531R) - FZD4_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 2 c.1613A>C r.(?) p.(Ter538SerextTer2) - pathogenic g.86662185T>G g.86951143T>G - - FZD4_000098 - PubMed: Musada 2016 - - Germline - - - - - -
-?/. 2 - c.*2660C>T r.(=) p.(=) - likely benign g.86659524G>A g.86948482G>A - - FZD4_000093 244 heterozygous; Clinindb (India), 5 homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs11234890 Germline - 244/2795 individuals, 5/2795 individuals - - - Mohammed Faruq
?/. 1 - c.*142716C>T r.(=) p.(=) - VUS g.86519468G>A g.86808426G>A PRSS23(NM_007173.4):c.783G>A (p.(Met261Ile)) - PRSS23_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*143026G>A r.(=) p.(=) - VUS g.86519158C>T g.86808116C>T PRSS23(NM_007173.4):c.473C>T (p.(Thr158Met)) - PRSS23_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
Legend   How to query