Unique variants in the GDF5 gene

Information The variants shown are described using the NM_000557.2 transcript reference sequence.

24 entries on 1 page. Showing entries 1 - 24.
Legend   How to query  




AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







-/. 1 - c.-275T>C r.(?) p.(=) - benign g.34025983A>G g.35438203= - - GDF5_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-135G>A r.(=) p.(=) - likely benign g.34025843C>T g.35438063C>T - - GDF5_000025 72 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs73094730 Germline - 72/2795 individuals - - - Mohammed Faruq
-/. 1 - c.-48T>C r.(?) p.(=) - benign g.34025756A>G g.35437976= - - GDF5_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.157dup r.(?) p.(Leu53ProfsTer41) - pathogenic g.34025558dup g.35437778dup GDF5(NM_000557.4):c.157dupC (p.L53Pfs*41) - GDF5_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.158del r.(?) p.(Leu53Argfs*34) - pathogenic g.34025551del - GDF5(NM_000557.5):c.158delT (p.L53Rfs*34) - GDF5_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.302C>T r.(?) p.(Pro101Leu) - likely benign g.34025407G>A g.35437627G>A GDF5(NM_000557.2):c.302C>T (p.(Pro101Leu)) - GDF5_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.307G>A r.(?) p.(Gly103Ser) - likely benign g.34025402C>T g.35437622C>T GDF5(NM_000557.2):c.307G>A (p.(Gly103Ser)) - GDF5_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.442A>T r.(?) p.(Lys148Ter) - pathogenic g.34025267T>A g.35437487T>A GDF5(NM_000557.4):c.442A>T (p.K148*) - GDF5_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.464dup r.(?) p.(Arg156ThrfsTer29) - pathogenic g.34025249dup g.35437469dup GDF5(NM_000557.4):c.464dupC (p.R156Tfs*29) - GDF5_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.498del r.(?) p.(Ile167SerfsTer26) - pathogenic g.34025216del g.35437436del GDF5(NM_000557.4):c.498delC (p.I167Sfs*26) - GDF5_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.517_536dup r.(?) p.(Leu180CysfsTer20) - pathogenic g.34025175_34025194dup - GDF5(NM_000557.4):c.517_536dupATGCTCTCGCTGTACAGGAC (p.L180Cfs*20) - GDF5_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., +/? 2 1 c.527T>C r.(?) p.(Leu176Pro) - pathogenic g.34025182A>G g.35437402A>G GDF5(NM_000557.4):c.527T>C (p.L176P) - GDF5_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - Yutaka Shimomura, VKGL-NL_Rotterdam
+/. 1 - c.712G>T r.(?) p.(Glu238Ter) - pathogenic g.34022501C>A g.35434703C>A GDF5(NM_000557.4):c.712G>T (p.E238*) - GDF5_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 3 - c.826T>G r.(?) p.(Ser276Ala) - benign g.34022387A>C g.35434589= GDF5(NM_000557.4):c.826T>G (p.S276A), GDF5(NM_000557.5):c.826T>G (p.S276A) - GDF5_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Nijmegen
+/. 1 - c.901C>T r.(?) p.(Arg301Ter) - pathogenic g.34022312G>A g.35434514G>A GDF5(NM_000557.4):c.901C>T (p.R301*) - GDF5_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.992del r.(?) p.(Arg331Profs*122) - pathogenic g.34022221del g.35434423del - - GDF5_000021 - - - - Germline/De novo (untested) - - - - - Gemeinschaftspraxis für Humangenetik Dresden
-/. 2 - c.1017G>A r.(?) p.(Lys339=) - benign g.34022196C>T g.35434398= GDF5(NM_000557.4):c.1017G>A (p.K339=) - GDF5_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
?/. 1 - c.1028T>C r.(?) p.(Leu343Pro) - VUS g.34022185A>G g.35434387A>G GDF5(NM_000557.4):c.1028T>C (p.L343P) - GDF5_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1068T>A r.(?) p.(Asn356Lys) - VUS g.34022145A>T g.35434347A>T - - GDF5_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.1129C>T r.(?) p.(Arg377Trp) - pathogenic g.34022084G>A g.35434286G>A GDF5(NM_000557.2):c.1129C>T (p.(Arg377Trp)) - GDF5_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1286G>A r.(?) p.(Cys429Tyr) - VUS g.34021927C>T - - - GDF5_000028 - - - - Germline/De novo (untested) - - - - - Gemeinschaftspraxis für Humangenetik Dresden
?/. 1 - c.1334A>G r.(?) p.(Asn445Ser) - VUS g.34021879T>C g.35434081T>C GDF5(NM_000557.4):c.1334A>G (p.N445S) - GDF5_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.1335T>A r.(?) p.(Asn445Lys) - likely pathogenic g.34021878A>T - - - GDF5_000027 - - - - Germline - - - - - Gemeinschaftspraxis für Humangenetik Dresden
?/. 1 - c.1393T>C r.(?) p.(Cys465Arg) - VUS g.34021820A>G g.35434022A>G GDF5(NM_000557.2):c.1393T>C (p.(Cys465Arg)) - GDF5_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
Legend   How to query