Unique variants in gene HPS4

Information The variants shown are described using the NM_022081.5 transcript reference sequence.

43 entries on 1 page. Showing entries 1 - 43.




AscendingDNA change (cDNA)     


RNA change     


DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







-/. 1 - c.-806_-786del benign r.(?) p.(=) g.26879985_26880005del - SRRD(NM_001013694.3):c.129_149delGAGAGAGGCGGCGCCCCGGGG (p.R44_G50del) - SRRD_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 3 c.57delT - r.(?) p.(fs*) g.26875306delA g.26479340delA - - HPS4_000003 unknown variant 2nd chromosome PubMed: Suzuki 2002, OMIM:var0003 - - Unknown - - - - - William (Bill) Oetting
-/. 1 - c.123T>C benign r.(?) p.(=) g.26875240A>G - HPS4(NM_022081.5):c.123T>C (p.Y41=) - HPS4_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/., -/. 2 - c.250A>G likely benign, benign r.(?) p.(Ile84Val) g.26872985T>C - HPS4(NM_022081.5):c.250A>G (p.I84V) - HPS4_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC
?/. 1 - c.266A>T VUS r.(?) p.(Asp89Val) g.26872969T>A - HPS4(NM_001349898.1):c.266A>T (p.D89V) - HPS4_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 6 c.412G>T - r.(?) p.(Gln138*) g.26868357C>A g.26472391C>A - - HPS4_000007 - PubMed: Anderson 2003, OMIM:var0007 - - Unknown - - - - - William (Bill) Oetting
?/. 1 - c.445A>G VUS r.(?) p.(Asn149Asp) g.26868324T>C - HPS4(NM_022081.5):c.445A>G (p.N149D) - HPS4_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 6 c.461A>G - r.(?) p.(His154Arg) g.26868308T>C g.26472342T>C - - HPS4_000010 - PubMed: Anderson 2003 - - Unknown - - - - - William (Bill) Oetting
?/. 1 - c.532C>T VUS r.(?) p.(Arg178Cys) g.26866749G>A - HPS4(NM_022081.5):c.532C>T (p.R178C) - HPS4_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 7 c.541C>T - r.(?) p.(Gln181*) g.26866740G>A g.26470774G>A - - HPS4_000004 - PubMed: Suzuki 2002, OMIM:var0004 - - Unknown - - - - - William (Bill) Oetting
+/. 2 8 c.649C>T pathogenic r.(?) p.(Arg217*) g.26864537G>A g.26468571G>A HPS4(NM_022081.5):c.649C>T (p.R217*) - HPS4_000009 VKGL data sharing initiative Nederland PubMed: Anderson 2003, OMIM:var0006 - - Unknown, CLASSIFICATION record - - - - - William (Bill) Oetting, VKGL-NL_AMC
?/. 1 8 c.664G>T - r.(?) p.(Glu222*) g.26864522C>A g.26468556C>A - - HPS4_000008 - PubMed: Anderson 2003, OMIM:var0008 - - Unknown - - - - - William (Bill) Oetting
-/. 1 - c.686A>G benign r.(?) p.(Glu229Gly) g.26862212T>C - HPS4(NM_022081.5):c.686A>G (p.E229G) - HPS4_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 1 9i c.706+151C>T - r.(?) p.(=) g.26862041G>A g.26466075G>A - - HPS4_000005 reported as nonsense variant, located in intron (potential exon) PubMed: Yngvadottir 2009 - rs3747129 Unknown - - - - - William (Bill) Oetting
-?/., -/. 2 - c.710C>T likely benign, benign r.(?) p.(Ala237Val) g.26861514G>A - HPS4(NM_022081.5):c.710C>T (p.A237V) - HPS4_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC
-/. 1 - c.741T>A benign r.(?) p.(=) g.26861483A>T - HPS4(NM_022081.5):c.741T>A (p.P247=) - HPS4_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.751A>T likely benign r.(?) p.(Thr251Ser) g.26861473T>A - HPS4(NM_022081.5):c.751A>T (p.T251S) - HPS4_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.839C>G pathogenic r.(?) p.(Ser280*) g.26860757G>C - HPS4(NM_022081.5):c.839C>G (p.S280*) - HPS4_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.860G>C likely benign r.(?) p.(Gly287Ala) g.26860736C>G - HPS4(NM_022081.5):c.860G>C (p.G287A) - HPS4_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 11 c.(949_972dup) - r.(?) p.(Ala316_Glu323dup) g.26860624_26860647dup g.26464658_26464681dup dup24 - HPS4_000005 unknown variant 2nd chromosome PubMed: Suzuki 2002, OMIM:var0005 - - Unknown - - - - - William (Bill) Oetting
-/. 1 - c.1029C>T benign r.(?) p.(=) g.26860567G>A - HPS4(NM_022081.5):c.1029C>T (p.N343=) - HPS4_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1177C>T likely benign r.(?) p.(Pro393Ser) g.26860419G>A - HPS4(NM_022081.5):c.1177C>T (p.P393S) - HPS4_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.1327C>G benign r.(?) p.(Leu443Val) g.26860269G>C - HPS4(NM_022081.5):c.1327C>G (p.L443V) - HPS4_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.1356A>C benign r.(?) p.(Gln452His) g.26860240T>G - HPS4(NM_022081.5):c.1356A>C (p.Q452H) - HPS4_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1396C>T likely benign r.(?) p.(Arg466Cys) g.26860200G>A - HPS4(NM_022081.5):c.1396C>T (p.R466C) - HPS4_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.1397G>A VUS r.(?) p.(Arg466His) g.26860199C>T - HPS4(NM_022081.5):c.1397G>A (p.R466H) - HPS4_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.1516C>G VUS r.(?) p.(Leu506Val) g.26860080G>C - HPS4(NM_022081.5):c.1516C>G (p.L506V) - HPS4_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.1527T>G VUS r.(?) p.(Ser509Arg) g.26860069A>C - HPS4(NM_022081.5):c.1527T>G (p.S509R) - HPS4_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1645A>G likely benign r.(?) p.(Lys549Glu) g.26859951T>C - HPS4(NM_022081.5):c.1645A>G (p.K549E) - HPS4_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.1654G>A benign r.(?) p.(Val552Met) g.26859942C>T - HPS4(NM_022081.5):c.1654G>A (p.V552M) - HPS4_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.1816C>T benign r.(?) p.(His606Tyr) g.26854441G>A - HPS4(NM_022081.5):c.1816C>T (p.H606Y) - HPS4_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.1875G>T benign r.(?) p.(Gln625His) g.26853905C>A - HPS4(NM_022081.5):c.1875G>T (p.Q625H) - HPS4_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/., -/. 2 - c.1883G>A likely benign, benign r.(?) p.(Arg628His) g.26853897C>T - HPS4(NM_022081.5):c.1883G>A (p.R628H) - HPS4_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.1888C>T likely benign r.(?) p.(Leu630Phe) g.26853892G>A - HPS4(NM_022081.5):c.1888C>T (p.L630F) - HPS4_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 2 13 c.1891C>T - r.(?) p.(Gln631*) g.26853889G>A g.26457923G>A - - HPS4_000002 - PubMed: Suzuki 2002, OMIM:var0001 - - Unknown - - - - - William (Bill) Oetting
?/. 1 - c.1954A>G VUS r.(?) p.(Arg652Gly) g.26853826T>C - HPS4(NM_022081.5):c.1954A>G (p.R652G) - HPS4_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.1955+18G>A benign r.(=) p.(=) g.26853807C>T - HPS4(NM_022081.5):c.1955+18G>A - HPS4_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1959T>C likely benign r.(?) p.(=) g.26849367A>G - HPS4(NM_022081.5):c.1959T>C (p.N653=) - HPS4_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.1966A>T likely benign r.(?) p.(Thr656Ser) g.26849360T>A - HPS4(NM_022081.5):c.1966A>T (p.T656S) - HPS4_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1993A>T likely benign r.(?) p.(Ile665Phe) g.26849333T>A - HPS4(NM_022081.5):c.1993A>T (p.I665F) - HPS4_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., ?/. 2 14 c.2054delC - r.(?) p.(fs*) g.26849272del g.26453306delG - - HPS4_000006 - PubMed: Bachli 2004, OMIM:var0009 - - Unknown - - - - - William (Bill) Oetting
-?/. 1 - c.2079C>T likely benign r.(?) p.(=) g.26849247G>A - HPS4(NM_022081.5):c.2079C>T (p.S693=) - HPS4_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 14 c.2089_2093dup - r.(?) p.(fs*) g.26849233_26849237dup g.26453267_26453271dup 2089_2093dupAAGCA - HPS4_000001 - PubMed: Suzuki 2002, OMIM:var0002 - - Unknown - - - - - William (Bill) Oetting