Unique variants in the INPPL1 gene

Information The variants shown are described using the NM_001567.3 transcript reference sequence.

57 entries on 1 page. Showing entries 1 - 57.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 1 - c.-3401G>C r.(?) p.(=) - likely benign g.71932628G>C g.72221584G>C FOLR2(NM_000803.4):c.590G>C (p.(Ser197Thr)) - FOLR2_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-3332C>T r.(?) p.(=) - VUS g.71932697C>T g.72221653C>T FOLR2(NM_000803.4):c.659C>T (p.(Ala220Val)) - FOLR2_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 1 c.94_121del r.(?) p.(Glu32Metfs*77) - pathogenic (recessive) g.71936122_71936149del g.72225078_72225105del - - INPPL1_000028 ACMG PP4, PVS1, PM2, PP5 PubMed: Silveira 2021, Journal: Silveira 2021 - - Germline - - - - - Maria Dora Jazmin Lacarrubba-Flores
-/. 1 - c.182+18_182+45del r.(=) p.(=) - benign g.71936228_71936255del g.72225184_72225211del INPPL1(NM_001567.4):c.182+18_182+45delTCCTTGCGGGCTGGCGTGGACCGGGAGC - FOLR2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.252G>A r.(?) p.(Ser84=) - likely benign g.71939397G>A g.72228353G>A INPPL1(NM_001567.3):c.252G>A (p.S84=) - INPPL1_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.268C>T r.(?) p.(Arg90Cys) - VUS g.71939413C>T - INPPL1(NM_001567.3):c.268C>T (p.(Arg90Cys)) - INPPL1_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.385C>T r.(?) p.(Arg129Trp) - VUS g.71939530C>T g.72228486C>T INPPL1(NM_001567.3):c.385C>T (p.(Arg129Trp)) - INPPL1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.518+14C>G r.(=) p.(=) - benign g.71939905C>G g.72228861C>G INPPL1(NM_001567.4):c.518+14C>G - INPPL1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.626G>A r.(?) p.(Arg209His) - VUS g.71940241G>A - INPPL1(NM_001567.4):c.626G>A (p.(Arg209His)) - INPPL1_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.637A>G r.(?) p.(Thr213Ala) - likely benign g.71940252A>G - INPPL1(NM_001567.3):c.637A>G (p.(Thr213Ala)) - INPPL1_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.753G>A r.(?) p.(=) - VUS g.71940602G>A - INPPL1(NM_001567.4):c.753G>A (p.(Gln251=)) - INPPL1_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.754-4C>G r.spl? p.? - likely benign g.71940703C>G - INPPL1(NM_001567.3):c.754-4C>G (p.?) - INPPL1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.843+7T>C r.(=) p.(=) - likely benign g.71940803T>C g.72229759T>C INPPL1(NM_001567.3):c.843+7T>C (p.(=)) - INPPL1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.904C>T r.(?) p.(Arg302Cys) - VUS g.71941028C>T - INPPL1(NM_001567.4):c.904C>T (p.(Arg302Cys)) - INPPL1_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.909G>C r.(?) p.(Lys303Asn) - likely benign g.71941033G>C g.72229989G>C INPPL1(NM_001567.3):c.909G>C (p.(Lys303Asn)) - INPPL1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.987A>G r.(?) p.(Ser329=) - benign g.71941212A>G g.72230168A>G INPPL1(NM_001567.4):c.987A>G (p.S329=) - INPPL1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1029G>A r.(?) p.(Leu343=) - likely benign g.71941254G>A - INPPL1(NM_001567.4):c.1029G>A (p.L343=) - INPPL1_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/., ?/. 2 - c.1072A>G r.(?) p.(Thr358Ala) - likely benign, VUS g.71941297A>G g.72230253A>G INPPL1(NM_001567.3):c.1072A>G (p.T358A, p.(Thr358Ala)) - INPPL1_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
?/. 1 - c.1087C>T r.(?) p.(Arg363Cys) - VUS g.71941312C>T - INPPL1(NM_001567.4):c.1087C>T (p.(Arg363Cys)) - INPPL1_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1170C>T r.(?) p.(=) - VUS g.71941485C>T - INPPL1(NM_001567.4):c.1170C>T (p.(Arg390=)) - INPPL1_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1196G>A r.(?) p.(Arg399Gln) - VUS g.71941511G>A - INPPL1(NM_001567.4):c.1196G>A (p.(Arg399Gln)) - INPPL1_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1198-7C>T r.(=) p.(=) - likely benign g.71941833C>T - INPPL1(NM_001567.3):c.1198-7C>T (p.(=)) - INPPL1_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1301-9C>T r.(=) p.(=) - likely benign g.71942028C>T - INPPL1(NM_001567.4):c.1301-9C>T - INPPL1_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.1368C>T r.(?) p.(Asp456=) - benign g.71942104C>T g.72231060C>T INPPL1(NM_001567.4):c.1368C>T (p.D456=) - INPPL1_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1437C>T r.(?) p.(=) - likely benign g.71942173C>T - INPPL1(NM_001567.4):c.1437C>T (p.(Arg479=)) - INPPL1_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1497+6G>A r.(=) p.(=) - likely benign g.71942239G>A - INPPL1(NM_001567.4):c.1497+6G>A - INPPL1_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1615+3A>G r.spl? p.? - likely benign g.71942662A>G - INPPL1(NM_001567.4):c.1615+3A>G - INPPL1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.1636G>A r.(?) p.(Val546Ile) - pathogenic (recessive) g.71943304G>A g.72232260G>A - - INPPL1_000026 - PubMed: White 2018 - - Germline - - - - - Johan den Dunnen
-?/. 1 - c.1706C>T r.(?) p.(Thr569Met) - likely benign g.71943374C>T - INPPL1(NM_001567.3):c.1706C>T (p.(Thr569Met)) - INPPL1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1713-16G>A r.(=) p.(=) - likely benign g.71943654G>A g.72232610G>A INPPL1(NM_001567.4):c.1713-16G>A - INPPL1_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1713-5C>T r.spl? p.? - likely benign g.71943665C>T - INPPL1(NM_001567.3):c.1713-5C>T (p.?) - INPPL1_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1741C>T r.(?) p.(Arg581Trp) - VUS g.71943698C>T - INPPL1(NM_001567.3):c.1741C>T (p.(Arg581Trp)) - INPPL1_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1802A>G r.(?) p.(His601Arg) - VUS g.71943759A>G - INPPL1(NM_001567.4):c.1802A>G (p.(His601Arg)) - INPPL1_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.1893C>A r.(?) p.(Leu631=) - benign g.71943960C>A g.72232916C>A INPPL1(NM_001567.4):c.1893C>A (p.L631=) - INPPL1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/., -?/. 2 - c.1894C>A r.(?) p.(Leu632Ile) - benign, likely benign g.71943961C>A g.72232917C>A INPPL1(NM_001567.3):c.1894C>A (p.(Leu632Ile)), INPPL1(NM_001567.4):c.1894C>A (p.L632I) - INPPL1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
?/. 1 - c.2158C>T r.(?) p.(Pro720Ser) - VUS g.71944734C>T - INPPL1(NM_001567.3):c.2158C>T (p.P720S) - INPPL1_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.2177A>G r.(?) p.(Glu726Gly) - VUS g.71944753A>G - INPPL1(NM_001567.4):c.2177A>G (p.(Glu726Gly)) - INPPL1_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.2220A>G r.(?) p.(Ser740=) - benign g.71945332A>G g.72234288A>G INPPL1(NM_001567.4):c.2220A>G (p.S740=) - INPPL1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.2327-7A>C r.(=) p.(=) - likely benign g.71945564A>C g.72234520A>C INPPL1(NM_001567.3):c.2327-7A>C (p.(=)) - INPPL1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.2414C>T r.(?) p.(Thr805Met) - VUS g.71945658C>T - INPPL1(NM_001567.3):c.2414C>T (p.(Thr805Met)) - INPPL1_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.2438T>G r.(?) p.(Ile813Ser) - likely benign g.71946182T>G - INPPL1(NM_001567.4):c.2438T>G (p.(Ile813Ser)) - INPPL1_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.2504-7T>C r.(=) p.(=) - benign g.71946333T>C g.72235289T>C INPPL1(NM_001567.4):c.2504-7T>C - INPPL1_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.2633G>A r.(?) p.(Arg878His) - VUS g.71946469G>A - INPPL1(NM_001567.3):c.2633G>A (p.(Arg878His)) - INPPL1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.2845C>T r.(?) p.(Arg949*) - pathogenic g.71946996C>T - INPPL1(NM_001567.4):c.2845C>T (p.R949*) - INPPL1_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.2918C>T r.(?) p.(Ala973Val) - likely benign g.71948206C>T - INPPL1(NM_001567.3):c.2918C>T (p.(Ala973Val)) - INPPL1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.3238C>T r.(?) p.(Arg1080Cys) - VUS g.71948526C>T - INPPL1(NM_001567.4):c.3238C>T (p.(Arg1080Cys)) - INPPL1_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.3248C>G r.(?) p.(Ala1083Gly) - benign g.71948536C>G g.72237492C>G INPPL1(NM_001567.4):c.3248C>G (p.A1083G) - INPPL1_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.3317C>A r.(?) p.(Ala1106Asp) - likely benign g.71948605C>A g.72237561C>A INPPL1(NM_001567.3):c.3317C>A (p.(Ala1106Asp)) - INPPL1_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.3491G>A r.(?) p.(Arg1164Gln) - likely benign g.71948779G>A - INPPL1(NM_001567.3):c.3491G>A (p.(Arg1164Gln)) - INPPL1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.3506C>A r.(?) p.(Pro1169His) - VUS g.71948794C>A - INPPL1(NM_001567.4):c.3506C>A (p.(Pro1169His)) - INPPL1_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.3514C>T r.(?) p.(Arg1172Cys) - likely benign g.71948802C>T - INPPL1(NM_001567.3):c.3514C>T (p.(Arg1172Cys)) - INPPL1_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.3551_3552+1del r.spl? p.? - VUS g.71948839_71948841del - INPPL1(NM_001567.3):c.3547_3549del (p.(Glu1183del)) - INPPL1_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.3585G>T r.(?) p.(Gly1195=) - likely benign g.71949118G>T - INPPL1(NM_001567.3):c.3585G>T (p.G1195=) - INPPL1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.3651G>C r.(?) p.(Leu1217=) - likely benign g.71949184G>C g.72238140G>C INPPL1(NM_001567.3):c.3651G>C (p.L1217=) - INPPL1_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.*1781_*1796del r.(=) p.(=) - VUS g.71951178_71951193del - PHOX2A(NM_005169.3):c.455_470del (p.(Ala152GlyfsTer49)) - INPPL1_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.*2908G>A r.(=) p.(=) - likely benign g.71952305G>A - PHOX2A(NM_005169.3):c.246C>T (p.S82=) - INPPL1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.*2935C>T r.(=) p.(=) - likely benign g.71952332C>T - PHOX2A(NM_005169.3):c.219G>A (p.V73=) - INPPL1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.