Unique variants in gene KCNQ1

Information The variants shown are described using the NM_000218.2 transcript reference sequence.

523 entries on 6 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2 3 4 5 6     Next › Last »




AscendingDNA change (cDNA)     


RNA change     


DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







+/. 1 _1_1i c.-97652_386+22686del - r.0? p.0? 1 more item - - - KCNQ1_000750 complex rearrangement, see Fig.4 for details PubMed: Beygo 2016, Journal: Beygo 2016 - - Germline yes - - - - Jasmin Beygo
-/., -?/. 3 1 c.-5T>C benign, likely benign r.(=) p.(=) g.2466324T>C - 1-5T>C, KCNQ1:c.-5T>C - KCNQ1_000760 data copied from the Inherited arrhythmogenic diseases and cardiac ion channels database, 1 more item PubMed: Jongbloed 2002 - - Germline, CLASSIFICATION record - 0.10 - - - Johan den Dunnen, VKGL-NL_AMC, VKGL-NL_Utrecht
+?/. 1 11i c.1514+37100_1514+37140|bsrC - r.(=) p.(=) g.2720411_2720451||bsrC - KvDMR CG1-CG6 - KCNQ1_000000 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - - normal levels Johan den Dunnen
+?/. 1 11i c.1514+37100|bsrC - r.(=) p.(=) g.2720411||bsrC - KvDMR CG1 - KCNQ1_000345 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - - 0.49 (controls 0.49-0.66) Johan den Dunnen
+?/. 1 11i c.1514+37107|bsrC - r.(=) p.(=) g.2720418||bsrC - KvDMR CG2 - KCNQ1_000346 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - - 0.52 (controls 0.52-0.68) Johan den Dunnen
+?/. 1 11i c.1514+37119|bsrC - r.(=) p.(=) g.2720430||bsrC - KvDMR CG3 - KCNQ1_000347 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - - 0.44 (controls 0.41-0.54) Johan den Dunnen
+?/. 1 11i c.1514+37121|bsrC - r.(=) p.(=) g.2720432||bsrC - KvDMR CG4 - KCNQ1_000348 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - - 0.46 (controls 0.42-0.55) Johan den Dunnen
+?/. 1 11i c.1514+37133|bsrC - r.(=) p.(=) g.2720444||bsrC - KvDMR CG5 - KCNQ1_000349 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - - 0.55 (controls 0.55-0.72) Johan den Dunnen
+?/. 1 11i c.1514+37140|bsrC - r.(=) p.(=) g.2720451||bsrC - KvDMR CG6 - KCNQ1_000350 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - - 0.52 (controls 0.55-0.71) Johan den Dunnen
+/. 1 5 c.726C>R - r.(?) p.(Asp242Glu) g.2593285C>R - D242E - KCNQ1_000791 data from Inherited Arrhythmias web site AHA2001 meeting abstracts - - Germline - - - - - Johan den Dunnen
+/. 1 2 c.? - r.? p.? g.2549205C>T - S145L - KCNQ1_000000 data from Inherited Arrhythmias web site PubMed: Liu 2006 - - Germline - - - - - Johan den Dunnen
+/. 1 1 c.5C>T - r.(?) p.(Ala2Val) g.2466333C>T - C5T - KCNQ1_000802 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 1 c.19C>T - r.(?) p.(Pro7Ser) g.2466347C>T - C19T - KCNQ1_000803 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 - c.108insT - r.(?) p.(?) g.? - 108insT - DRD4_000002 1 more item PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
?/. 1 - c.113T>C VUS r.(?) p.(Leu38Pro) g.2466441T>C - KCNQ1:c.113T>C (L38P) - KCNQ1_001026 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.118C>T benign r.(=) p.(=) g.2466446C>T - KCNQ1:c.118C>T (=) - KCNQ1_001027 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/., +/. 2 1 c.136G>A VUS r.(?) p.(Ala46Thr) g.2466464G>A - KCNQ1:NM_000218.2:c.136G>A, G136A - KCNQ1_000804 VKGL data sharing initiative Nederland; correct HGVS to be checked, 1 more item PubMed: Napolitano 2005 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Leiden, Johan den Dunnen
?/. 1 - c.151_152insCGCGCCCAT VUS r.(?) p.(Leu50_Tyr51insSerArgPro) g.2466479_2466480insCGCGCCCAT - KCNQ1:c.160_168dupATCGCGCCC (I54_P56dup) - KCNQ1_001028 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 1 c.151_152insT - r.(?) p.(Tyr51Leufs*234) g.2466479_2466480insT - 151_152insT - KCNQ1_000805 1 more item PubMed: Napolitano 2005 - - Germline - - - - - Johan den Dunnen
+/. 1 1 c.153C>G - r.(?) p.(Tyr51*) g.2466481C>G - C153G - KCNQ1_000806 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - - - Johan den Dunnen
-/., -/-, ?/. 4 1 c.160_168dup VUS r.(?) p.(Ile54_Pro56dup) g.2466488_2466496dup - 160_168dup, dup160-168, KCNQ1:NM_000218.2:c.152_153insCGCGCCCAT - KCNQ1_000801 data from Inherited Arrhythmias web site, 1 more item PubMed: Ackerman 2003, PubMed: Abraham 2010 - - Germline, CLASSIFICATION record - 4/305 controls - - - Johan den Dunnen, VKGL-NL_Leiden
+/. 1 1 c.176delC - r.(?) p.(Pro59Glnfs*27) g.2466504delC - 176delC - KCNQ1_000807 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 1 c.190_210del - r.(?) p.(Pro64_Pro70del) g.2466518_2466538del - 190_210delCCTGCGTCCCCGGCCGCGCCC - KCNQ1_000761 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
-?/. 1 - c.194C>T likely benign r.(?) p.(Ala65Val) g.2466522C>T - KCNQ1:c.194C>T (A65V) - KCNQ1_001029 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 1 c.197C>T - r.(?) p.(Ser66Phe) g.2466525C>T - C197T - KCNQ1_000808 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 1 c.200_210del - r.(?) p.(Pro67Argfs*214) g.2466528_2466538del - 200_210delCGGCCGCGCCC - KCNQ1_000762 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
-/. 1 - c.207G>T benign r.(=) p.(=) g.2466535G>T - KCNQ1:c.207G>T (=) - KCNQ1_001030 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 3 1 c.211_219del - r.(?) p.(Ala71_Pro73del) g.2466539_2466547del - 211_219del, del 211–219, AAPdel71–73 - KCNQ1_000774 data from Inherited Arrhythmias web site PubMed: Ackerman 1999, PubMed: Tester 2005, PubMed: Choi 2004 - - Germline - - - - - Johan den Dunnen
?/., +/. 4 1 c.217C>A VUS r.(?) p.(Pro73Thr) g.2466545C>A g.2445315C>A KCNQ1:c.217C>A (P73T), C217A - KCNQ1_000239 VKGL data sharing initiative Nederland; correct HGVS to be checked, 1 more item PubMed: Tester 2005, PubMed: Riuro 2014 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_VUmc, VKGL-NL_AMC, Johan den Dunnen
+/. 1 1 c.220_221delCC - r.(?) p.(Pro74Serfs*210) g.2466548_2466549delCC g.2445318_2445319delCC 220_221delCC - KCNQ1_000746 - - - - Germline - - - - - Hideki Itoh
+/. 1 1 c.242_264delinsGCGCCCGCGG - r.(?) p.(Pro81Argfs*152) g.2466570_2466592delinsGCGCCCGCGG - 242_264delCGCGGCCGCCGGTGAGCCTAGACinsGCGCCCGCGG - KCNQ1_000763 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 1 c.273_299delinsTG - r.(?) p.(Ser92Glyfs*137) g.2466601_2466627delinsTG - 273_299delCTCCATCTACAGCACGCGCCGCCCGGTinsGG - KCNQ1_000764 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 1 c.287del - r.(?) p.(Thr96Serfs*141) g.2466615del - delC287 - KCNQ1_000809 - PubMed: Tester 2005 - - Germline - 1/541 cases LQT - - - Johan den Dunnen
+/. 1 1 c.298delG - r.(?) p.(Val100Cysfs*137) g.2466626delG g.2445396delG 298delG - KCNQ1_000745 - - - - Germline - - - - - Hideki Itoh
-/. 1 1 c.328A>G - r.(?) p.(?) g.2466656A>G - A328G - KCNQ1_000810 1 more item PubMed: Ackerman 2003 - - Germline - - - - - Johan den Dunnen
+/., -/- 3 1 c.328G>A - r.(?) p.(Val110Ile) g.2466656G>A g.2445426G>A - - KCNQ1_000756 - Sahlin et al, PubMed: Ackerman 2003 - - Germline ? 1/187 controls - - - Ellika Sahlin, Johan den Dunnen
+/. 5 1 c.332A>G pathogenic r.(?) p.(Tyr111Cys) g.2466660A>G g.2445430A>G KCNQ1:c.332A>G (Y111C), A332G - KCNQ1_000654 VKGL data sharing initiative Nederland; correct HGVS to be checked, 1 more item PubMed: Splawski 2000 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_AMC, Hideki Itoh, Johan den Dunnen
?/. 1 1 c.334_336dup - r.(?) p.(Asn112dup) g.2466662_2466664dup g.2445432_2445434dup - - KCNQ1_000655 - - - - Germline - - - - - Hideki Itoh
+/. 1 1 c.341T>C - r.(?) p.(Leu114Pro) g.2466669T>C - T341C - KCNQ1_000811 data from Inherited Arrhythmias web site PubMed: Jongbloed 2002 - - Germline - - - - - Johan den Dunnen
+/. 1 1 c.344A>G - r.(?) p.(Glu115Gly) g.2466672A>G - A344G - KCNQ1_000812 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - - - Johan den Dunnen
-/. 1 - c.345G>A benign r.(=) p.(=) g.2466673G>A - KCNQ1:c.345G>A (=) - KCNQ1_001057 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 2 1 c.350C>T - r.(?) p.(Pro117Leu) g.2466678C>T g.2445448C>T C350T - KCNQ1_000656 data from Inherited Arrhythmias web site PubMed: Schwartz 2001 - - Germline - - - - - Hideki Itoh, Johan den Dunnen
?/. 1 1 c.355G>C - r.(?) p.(Gly119Arg) g.2466683G>C g.2445453G>C - - KCNQ1_000657 - - - - Germline - - - - - Hideki Itoh
-/. 1 1 c.356G>A - r.(?) p.(Gly119Asp) g.2466684G>A - G356A - KCNQ1_000813 data from Inherited Arrhythmias web site PubMed: Koo SH 2006 - - Germline - - - - - Johan den Dunnen
+/. 1 1 c.365G>A - r.(?) p.(Cys122Tyr) g.2466693G>A - G365A - KCNQ1_000814 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - - - Johan den Dunnen
+/. 1 - c.365insT - r.(?) p.(?) g.? - 365insT - DRD4_000002 1 more item PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
?/. 1 1 c.376C>G - r.(?) p.(His126Asp) g.2466704C>G g.2445474C>G - - KCNQ1_000658 - - - - Germline - - - - - Hideki Itoh
+/. 1 1 c.381C>A - r.(?) p.(Phe127Leu) g.2466709C>A - C381A - KCNQ1_000815 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
-/., -/- 2 1 c.385G>A - r.(?) p.(Val129Ile) g.2466713G>A - G385A - KCNQ1_000816 data from Inherited Arrhythmias web site PubMed: Ackerman 2003 - - Germline - 1/305 controls - - - Johan den Dunnen
+/. 1 1i c.386+1G>A - r.spl? p.(?) g.2466715G>A - G386+1A - KCNQ1_000817 1 more item PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
?/. 1 1i c.386+5G>A - r.spl? p.? g.2466719G>A g.2445489G>A - - KCNQ1_000659 - - - - Germline - - - - - Hideki Itoh
+/. 1 - c.387-5T>A ACMG 5 r.spl? p.? g.2549153T>A g.2527923T>A - - KCNQ1_000754 - Trujillano et al., submitted - - Germline - - - - - Daniel Trujillano
-/. 1 2i c.387+217C>T - r.(?) p.(?) g.2549375C>T - 387+217C>T - KCNQ1_000829 1 more item PubMed: Jongbloed 2002 - - Germline - - - - - Johan den Dunnen
+/. 1 2 c.397G>A - r.(?) p.(Val133Ile) g.2549168G>A - G397A - KCNQ1_000818 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - - - Johan den Dunnen
+/. 1 2 c.401T>C - r.(?) p.(Leu134Pro) g.2549172T>C - T401C - KCNQ1_000819 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 2 c.403delG - r.(?) p.(Val135Serfs*102) g.2549174delG - 403delG - KCNQ1_000820 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 2 c.407G>T - r.(?) p.(Cys136Phe) g.2549178G>T - G407T - KCNQ1_000821 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - - - Johan den Dunnen
+/. 1 2 c.409C>T - r.(?) p.(Leu137Phe) g.2549180C>T - C409T - KCNQ1_000822 data from Inherited Arrhythmias web site PubMed: Napolitano 2005 - - Germline - - - - - Johan den Dunnen
+/. 1 2 c.418A>G - r.(?) p.(Ser140Gly) g.2549189A>G - A418G - KCNQ1_000823 data from Inherited Arrhythmias web site PubMed: Chen 2003 - - Germline - - - - - Johan den Dunnen
+/. 1 2 c.430A>G - r.(?) p.(Thr144Ala) g.2549201A>G - A430G - KCNQ1_000824 data from Inherited Arrhythmias web site PubMed: Zareba 2003 - - Germline - - - - - Johan den Dunnen
-/. 3 2 c.435C>T benign r.(=) p.(=) g.2549206C>T - C435T, KCNQ1:c.435C>T (=) - KCNQ1_000825 data from Inherited Arrhythmias web site, 1 more item PubMed: Itoh 1998, PubMed: Iwasa 2000 - - Germline, CLASSIFICATION record - - - - - Johan den Dunnen, VKGL-NL_AMC
+/. 1 2 c.436G>A - r.(?) p.(Glu146Lys) g.2549207G>A - G436A - KCNQ1_000826 data from Inherited Arrhythmias web site PubMed: Napolitano 2005 - - Germline - - - - - Johan den Dunnen
+/. 2 2 c.444T>A - r.(?) p.(Tyr148*) g.2549215T>A g.2527985T>A T444A - KCNQ1_000660 data from Inherited Arrhythmias web site PubMed: Gouas 2004 - - Germline - - - - - Hideki Itoh, Johan den Dunnen
+/. 1 2 c.451_452delCT - r.(?) p.(Leu151Glyfs*133) g.2549222_2549223delCT - 451_452delCT - KCNQ1_000827 data from Inherited Arrhythmias web site PubMed: Chen 1999 - - Germline - - - - - Johan den Dunnen
?/., +/. 2 2 c.458C>T - r.(?) p.(Thr153Met) g.2549229C>T g.2527999C>T NM_000218:c.C458T, C458T - KCNQ1_000606 data from Inherited Arrhythmias web site PubMed: Lopes 2013, Journal: Lopes 2013, PubMed: Kapplinger 2009 - - Germline - 1/223 cases HCM - - - Johan den Dunnen
-?/., -/. 3 - c.459G>A likely benign, benign r.(=) p.(=) g.2549230G>A - KCNQ1:c.459G>A (=) - KCNQ1_001058 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_AMC
-/. 1 2 c.459G>T - r.(?) p.(=) g.2549230G>T - G459G - KCNQ1_000769 data copied from the Inherited arrhythmogenic diseases and cardiac ion channels database PubMed: Gouas 2005 - - Germline - 0.00375 - - - Johan den Dunnen
+/. 1 2 c.470T>G - r.(?) p.(Phe157Cys) g.2549241T>G - T470G - KCNQ1_000828 data from Inherited Arrhythmias web site PubMed: Larsen 1999 - - Germline - - - - - Johan den Dunnen
+/., ?/. 8 2i c.477+1G>A pathogenic r.spl?, r.spl p.?, p.(?) g.2549249G>A g.2528019G>A KCNQ1:c.477+1G>A, 477+1G>A, M159sp - KCNQ1_000661 VKGL data sharing initiative Nederland; correct HGVS to be checked, 2 more items PubMed: Donger 1997, PubMed: Chouabe 2000, PubMed: Splaswki 2000, PubMed: Van Langen 2003, 2 more items - - CLASSIFICATION record, Germline - - - - - VKGL-NL_AMC, Hideki Itoh, Johan den Dunnen
+/., ?/. 4 2i c.477+5G>A - r.spl, r.spl? p.?, p.(?) g.2549253G>A g.2528023G>A 477+5G>A - KCNQ1_000662 1 more item PubMed: Tester 2005, PubMed: Millat 2006 - - Germline - 2/541 cases LQT - - - Johan den Dunnen, Hideki Itoh
+/. 2 2i c.477+5G>C - r.spl? p.?, p.(?) g.2549253G>C - 477+5G>C - KCNQ1_000775 data from Inherited Arrhythmias web site, 1 more item PubMed: Tester 2005, PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
-/. 1 - c.477+9C>T benign r.(=) p.(=) g.2549257C>T - KCNQ1:c.477+9C>T - KCNQ1_001059 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 2i c.477+20A>G - r.(?) p.(=) g.2549268A>G - 477+20A>T - KCNQ1_000770 data copied from the Inherited arrhythmogenic diseases and cardiac ion channels database PubMed: Gouas 2005 - - Germline - 0.00125 - - - Johan den Dunnen
-/. 1 2i c.477+79_477+80dup - r.(?) p.(=) g.2549327_2549328dup - 477+80insGG - KCNQ1_000768 data from Inherited Arrhythmias web site PubMed: Gouas 2005 - - Germline - 0.31 - - - Johan den Dunnen
-/. 1 - c.478-10G>A benign r.(=) p.(=) g.2591848G>A - KCNQ1:c.478-10G>A - KCNQ1_001031 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/., -/. 2 - c.478-8C>T likely benign, benign r.(=) p.(=) g.2591850C>T - KCNQ1:NM_000218.2:c.478-8C>T, KCNQ1:c.478-8C>T - KCNQ1_001032 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
?/. 1 2i c.478-2A>T - r.spl? p.? g.2591856A>T g.2570626A>T - - KCNQ1_000749 - - - - Germline - - - - - Hideki Itoh
+/. 2 3 c.478G>A - r.(?) p.(Glu160Lys) g.2591858G>A - G478A - KCNQ1_000830 data from Inherited Arrhythmias web site PubMed: Tester 2005, PubMed: Splaswki 2000 - - Germline - 1/541 cases LQT - - - Johan den Dunnen
+/. 1 3 c.479A>T - r.(?) p.(Glu160Val) g.2591859A>T - A479T - KCNQ1_000831 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 3 c.484G>A - r.(?) p.(Val162Met) g.2591864G>A - G484A - KCNQ1_000832 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 2 3 c.488del - r.(?) p.(Leu163Argfs*74) g.2591868del - delT488, V162fs/72 - KCNQ1_000777 data from Inherited Arrhythmias web site PubMed: Tester 2005, PubMed: Choi 2004 - - Germline - 1/541 cases LQT - - - Johan den Dunnen
+/. 1 3 c.500_502del - r.(?) p.(Phe167_Gly168delinsTrp) g.2591880_2591882del - 500_502del - KCNQ1_000833 data from Inherited Arrhythmias web site PubMed: Wang 1996 - - Germline - - - - - Johan den Dunnen
+/., +/? 10 3 c.502G>A - r.(?) p.(Gly168Arg) g.2591882G>A g.2570652G>A G502A - KCNQ1_000000 data from Inherited Arrhythmias web site PubMed: Tester 2005, PubMed: Donger 1997, PubMed: Jongbloed 2002, PubMed: Beery TA 2003, 3 more items - - Germline - 2/541 cases LQT - - - Johan den Dunnen, Hideki Itoh
+/. 1 3 c.502G>C - r.(?) p.(Gly168Arg) g.2591882G>C - G502C - KCNQ1_000834 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 3 c.504delG - r.(?) p.(Thr169Argfs*68) g.2591884delG - 504delG - KCNQ1_000835 data from Inherited Arrhythmias web site PubMed: Wei 2000 - - Germline - - - - - Johan den Dunnen
?/. 1 3 c.509A>G - r.(?) p.(Glu170Gly) g.2591889A>G g.2570659A>G - - KCNQ1_000747 - - - - Germline - - - - - Hideki Itoh
?/. 1 3 c.511T>A - r.(?) p.(Tyr171Asn) g.2591891T>A g.2570661T>A - - KCNQ1_000732 - - - - Germline - - - - - Hideki Itoh
+/. 2 3 c.513C>G - r.(?) p.(Tyr171*) g.2591893C>G - C513G - KCNQ1_000836 data from Inherited Arrhythmias web site PubMed: Tester 2005, PubMed: Piippo 2001 - - Germline - 1/541 cases LQT - - - Johan den Dunnen
+/., +?/. 2 3 c.514G>A - r.(?) p.(Val172Met) g.2591894G>A g.2570664G>A G514A - KCNQ1_000102 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen, Sofie Lindgren Christiansen
+/. 1 3 c.518T>A - r.(?) p.(Val173Asp) g.2591898T>A - T518A V173D - KCNQ1_000837 data from Inherited Arrhythmias web site PubMed: Napolitano 2005 - - Germline - - - - - Johan den Dunnen
+/. 8 3 c.520C>T - r.(?) p.(Arg174Cys) g.2591900C>T g.2570670C>T C520T - KCNQ1_000705 data from Inherited Arrhythmias web site PubMed: Tester 2005, PubMed: Donger 1997 - - Germline - 2/541 cases LQT - - - Johan den Dunnen, Hideki Itoh
?/., +/. 8 3 c.521G>A - r.(?) p.(Arg174His) g.2591901G>A g.2570671G>A G521A, R174H - KCNQ1_000706 data from Inherited Arrhythmias web site PubMed: Denjoy 1999, PubMed: Splawski 2000, PubMed: Lupoglazoff 2004 - - Germline - - - - - Hideki Itoh, Johan den Dunnen
+/. 1 3 c.521G>C - r.(?) p.(Arg174Pro) g.2591901G>C - G521C - KCNQ1_000838 data from Inherited Arrhythmias web site PubMed: Napolitano 2005 - - Germline - - - - - Johan den Dunnen
+/. 1 3 c.524_534delTCTGGTCCGCC - r.(?) p.(Leu175Argfs*106) g.2591904_2591914delTCTGGTCCGCC - 524_534delTCTGGTCCGCC - KCNQ1_000839 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - - - Johan den Dunnen
+/. 1 3 c.524_534dup - r.(?) p.(Gly179Serfs*62) g.2591904_2591914dup g.2570674_2570684dupTCTGGTCCGCC 524_534dup - KCNQ1_000707 data from Inherited Arrhythmias web site PubMed: Lupoglazoff 2004 - - Germline - - - - - Johan den Dunnen
+/. 2 3 c.524_534dupTCTGGTCCGCC - r.(?) p.(Gly179Serfs*62) g.2591904_2591914dup g.2570674_2570684dupTCTGGTCCGCC 524_534dupTCTGGTCCGCC - KCNQ1_000707 - - - - Germline - - - - - Hideki Itoh
+/. 1 3 c.528G>C - r.(?) p.(Trp176Cys) g.2591908G>C - G528C - KCNQ1_000840 data from Inherited Arrhythmias web site PubMed: Millat 2006 - - Germline - - - - - Johan den Dunnen
-?/. 1 - c.531C>T likely benign r.(=) p.(=) g.2591911C>T - KCNQ1:c.531C>T (S177=) - KCNQ1_001033 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., ?/. 2 3 c.532G>A - r.(?) p.(Ala178Thr) g.2591912G>A g.2570682G>A G532A - KCNQ1_000034 data from Inherited Arrhythmias web site PubMed: Tanaka 1997 - - Germline - - - - - Johan den Dunnen, Hideki Itoh
+/. 2 3 c.532G>C - r.(?) p.(Ala178Pro) g.2591912G>C - G532C - KCNQ1_000841 data from Inherited Arrhythmias web site PubMed: Shalaby 1997, PubMed: Wang 1996 - - Germline - - - - - Johan den Dunnen
Legend   « First ‹ Prev     1 2 3 4 5 6     Next › Last »