Unique variants in gene KMT2D

Information The variants shown are described using the NM_003482.3 transcript reference sequence.

815 entries on 9 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2 3 4 5 6 7 8 9     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. 1 2 c.96C>G - r.(?) p.(Asp32Glu) g.49448763G>C g.49054980G>C 96C>G, Asp32Glu - KMT2D_000535 - PubMed: Liu 2015 - - Germline yes - - - - Vincent Gatinois
-?/. 1 - c.163C>T likely benign r.(?) p.(Pro55Ser) g.49448696G>A - KMT2D(NM_003482.3):c.163C>T (p.(Pro55Ser)) - KMT2D_000831 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 4 2 c.166C>T - r.(?) p.(Gln56*) g.49448693G>A g.49054910G>A 166C>T, Gln56* - KMT2D_000534 inherited from affected parent submitted - - Germline yes, ? - - - - Vincent Gatinois, Nina Bögershausen
+/. 1 2i c.177-2A>C - r.177_400del p.Ser59Argfs*86 g.49448536T>G g.49054753T>G r.177_400del224 - KMT2D_000008 - PubMed: Micale 2014 - - De novo - - - - - B. Augello
+/. 2 2i c.177-2A>G - r.spl p.? g.49448536T>C g.49054753T>C 177-2A>G, (?) - KMT2D_000533 - submitted - - Germline ?, yes - - - - Vincent Gatinois, Nina Bögershausen
+?/. 1 - c.207T>A likely pathogenic r.(?) p.(Cys69*) g.49448504A>T - KMT2D(NM_003482.3):c.207T>A (p.(Cys69Ter)) - KMT2D_000830 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 3 3 c.248G>A benign r.(?) p.(Arg83Gln) g.49448463C>T g.49054680C>T KMT2D(NM_003482.3):c.248G>A (p.R83Q) - KMT2D_000105 VKGL data sharing initiative Nederland - - rs55865069 CLASSIFICATION record, Germline - up to 0.06 - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen, Andreas Laner
+/. 1 - c.303dup pathogenic r.(?) p.(Ser102Glufs*6) g.49448413dup - KMT2D(NM_003482.3):c.303dupG (p.S102Efs*6) - KMT2D_000719 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 3 c.346T>C - r.(?) p.(Ser116Pro) g.49448365A>G g.49054582A>G - - KMT2D_000007 - PubMed: Micale 2014 - - Germline ? - - - - B. Augello
+/. 1 3i c.400+1G>A - r.177_400del p.Ser59Argfs*86 g.49448310C>T g.49054527C>T - - KMT2D_000004 - PubMed: Micale 2014 - - Unknown ? - - - - B. Augello
+/. 2 3i c.400+2T>C - r.spl p.? g.49448309A>G g.49054526A>G 400+2T>C, (?) - KMT2D_000532 - submitted - - Germline yes, ? - - - - Nina Bögershausen, Vincent Gatinois
+/. 1 3i c.401-3A>G - r.400_401insag p.Gly134Glufs*75 g.49448202T>C g.49054419T>C - - KMT2D_000005 - PubMed: Micale 2014 - - De novo - - - - - B. Augello
?/. 1 - c.444C>T VUS r.(?) p.(=) g.49448156G>A - KMT2D(NM_003482.3):c.444C>T (p.G148=) - KMT2D_000698 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 4 c.472del - r.(?) p.(Cys158Valfs*50) g.49448128del g.49054345del 472delT, Cys158ValfsX50 - KMT2D_000531 - PubMed: Micale 2011 - - Germline ? - - - - Vincent Gatinois
-?/. 1 - c.507A>C likely benign r.(?) p.(=) g.49448093T>G - KMT2D(NM_003482.3):c.507A>C (p.S169=) - KMT2D_000861 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 4 c.509A>T - r.(?) p.(Gln170Leu) g.49448091T>A g.49054308T>A 509A>T, ? - KMT2D_000530 - PubMed: Makrythanasis 2013 - - Germline ? - - - - Vincent Gatinois
+/. 1 4 c.510G>A - r.(?) p.(=) g.49448090C>T g.49054307C>T 510G>A, ? - KMT2D_000529 - PubMed: Makrythanasis 2013 - - Germline yes - - - - Vincent Gatinois
-/., +/. 2 4 c.510G>C - r.(?) p.(Gln170His) g.49448090C>G g.49054307C>G 510G>C, ? - KMT2D_000006 - PubMed: Micale 2014, PubMed: Makrythanasis 2013 - - Germline ?, yes - - - - B. Augello, Vincent Gatinois
+/. 1 4i c.510+1G>A - r.spl p.? g.49448089C>T g.49054306C>T 510+1G>A, splice site - KMT2D_000528 - PubMed: Miyake 2013 - - Germline ? - - - - Vincent Gatinois
+?/. 1 4i c.511-1G>A pathogenic (dominant) r.spl p.? g.49447924C>T g.49054141C>T - - KMT2D_000720 - PubMed: de Billy 2019 - - De novo - - - - - Emanuele Agolini
-?/. 1 - c.554G>A likely benign r.(?) p.(Arg185His) g.49447880C>T - KMT2D(NM_003482.3):c.554G>A (p.R185H) - KMT2D_000829 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 5 c.588del - r.(?) p.(Cys197Alafs*11) g.49447846del g.49054063del 588del, (Cys197Alafs*11) - KMT2D_000527 - PubMed: Makrythanasis 2013 - - Germline yes - - - - Vincent Gatinois
+/. 1 5 c.589del - r.(?) p.(Cys197Alafs*11) g.49447845del g.49054062del 589del, (Cys197Alafs*11) - KMT2D_000526 - PubMed: Makrythanasis 2013 - - Germline ? - - - - Vincent Gatinois
?/. 1 5 c.626C>T - r.(?) p.(Thr209Ile) g.49447808G>A g.49054025G>A - - KMT2D_000071 - PubMed: Micale 2014 - - Unknown ? - - - - B. Augello
?/. 1 - c.658G>A VUS r.(?) p.(Gly220Arg) g.49447776C>T - - - KMT2D_000724 - Journal: Reynhout 2019 - - Germline - - - - - Johan den Dunnen
+/. 1 5 c.669T>G - r.(?) p.(Tyr223*) g.49447765A>C g.49053982A>C 669T>G, Tyr223X - KMT2D_000525 - PubMed: Micale 2011 - - Germline ? - - - - Vincent Gatinois
?/. 1 - c.674-7C>A VUS r.(=) p.(=) g.49447431G>T - KMT2D(NM_003482.3):c.674-7C>A - KMT2D_000860 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.696dup pathogenic r.(?) p.(Glu233*) g.49447402dup - KMT2D(NM_003482.3):c.696dupT (p.E233*) - KMT2D_000828 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 6 c.697G>T - r.(?) p.(Glu233*) g.49447401C>A g.49053618C>A 697G>T, E233X - KMT2D_000524 - PubMed: Banka 2012 - - Germline ? - - - - Vincent Gatinois
+/. 1 6 c.702del - r.(?) p.(Pro235Glnfs*26) g.49447396del g.49053613del 702delG, P235QfsX26 - KMT2D_000523 - PubMed: Hannibal 2011 - - Germline ? - - - - Vincent Gatinois
+/. 1 6 c.705del - r.(?) p.(Glu237Serfs*24) g.49447393del g.49053610del 705delA, Pro235ProfsX26 - KMT2D_000522 - PubMed: Micale 2011 - - Germline ? - - - - Vincent Gatinois
+/. 1 6 c.721del - r.(?) p.(Leu241Cysfs*20) g.49447377del g.49053594del 721del, (Leu241Cysfs*20) - KMT2D_000521 - PubMed: Dentici 2015 - - Germline yes - - - - Vincent Gatinois
+/. 2 6 c.741T>A - r.(?) p.(Cys247*) g.49447357A>T g.49053574A>T 741T>A, Cys247X - KMT2D_000520 - submitted - - De novo, Germline yes - - - - Nina Bögershausen, Vincent Gatinois
+/. 2 6 c.751dup - r.(?) p.(Tyr251Leufs*22) g.49447347dup g.49053564dup 751dupT, Tyr251LeufsX22 - KMT2D_000519 - submitted - - Germline yes, ? - - - - Nina Bögershausen, Vincent Gatinois
+/. 1 6i c.839+2T>A - r.spl p.? g.49447257A>T g.49053474A>T - - KMT2D_000571 - submitted - - De novo - - - - - Nina Bögershausen
?/. 1 6i c.839+69G>A - r.(=) p.(=) g.49447190C>T g.49053407C>T - - KMT2D_000104 - - - - Germline - - - - - Andreas Laner
+/. 1 6i c.840-1G>A - r.spl p.? g.49447105C>T g.49053322C>T 840-1G>A, - KMT2D_000518 - PubMed: Hannibal 2011 - - Germline ? - - - - Vincent Gatinois
?/. 1 7 c.859A>G - r.(?) p.(Lys287Glu) g.49447085T>C g.49053302T>C - - KMT2D_000103 PolyPhen-2 benign score 0.009 - - - Germline - - - - - Andreas Laner
+/. 1 7 c.859_860insT - r.(?) p.(Lys287Ilefs*6) g.49447084_49447085insA g.49053301_49053302insA 859_860insT, (Lys287Ilefs*6) - KMT2D_000517 - PubMed: Makrythanasis 2013 - - Germline yes - - - - Vincent Gatinois
-?/. 1 - c.879G>A likely benign r.(?) p.(=) g.49447065C>T - KMT2D(NM_003482.3):c.879G>A (p.T293=) - KMT2D_000827 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 7i c.954+1G>T - r.spl p.? g.49446989C>A g.49053206C>A 954+1G>T, - KMT2D_000516 - PubMed: Li 2011 - - Germline yes - - - - Vincent Gatinois
+/. 1 7i c.955-1G>A - r.spl? p.? g.49446856C>T g.49053073C>T - - KMT2D_000102 - - - - Germline - - - - - Andreas Laner
-?/., +/. 2 8 c.1010C>T likely benign r.(?) p.(Ser337Leu) g.49446800G>A g.49053017G>A KMT2D(NM_003482.3):c.1010C>T (p.S337L), 1010C>T, S337L - KMT2D_000515 VKGL data sharing initiative Nederland PubMed: Banka 2012 - - CLASSIFICATION record, Germline ? - - - - VKGL-NL, Vincent Gatinois
+/. 1 8 c.1012G>T - r.(?) p.(Glu338*) g.49446798C>A g.49053015C>A 1012G>T, (Glu338*) - KMT2D_000514 - PubMed: Makrythanasis 2013 - - Germline ? - - - - Vincent Gatinois
+/. 1 8 c.1035_1036del - r.(?) p.(Cys346Serfs*17) g.49446774_49446775del g.49052991_49052992del 1035_1036delCT, Leu345LeufsX18 - KMT2D_000513 - PubMed: Micale 2011 - - Germline ? - - - - Vincent Gatinois
?/. 1 - c.1040A>G VUS r.(?) p.(His347Arg) g.49446770T>C - KMT2D(NM_003482.3):c.1040A>G (p.H347R) - KMT2D_000826 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1042C>T VUS r.(?) p.(Arg348Cys) g.49446768G>A - KMT2D(NM_003482.3):c.1042C>T (p.R348C) - KMT2D_000697 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 2 9 c.1142_1143insACCC - r.(?) p.(Thr382Profs*3) g.49446462_49446463insGGGT g.49052679_49052680insGGGT 1142_1143insACCC, Pro381HisfsX3 - KMT2D_000512 - submitted - - Germline, De novo yes - - - - Vincent Gatinois, Nina Bögershausen
-?/. 1 - c.1149C>T likely benign r.(?) p.(=) g.49446456G>A - KMT2D(NM_003482.3):c.1149C>T (p.D383=) - KMT2D_000825 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 9 c.1187C>G - r.(?) p.(Pro396Arg) g.49446418G>C g.49052635G>C 1187C>G, Pro396Arg - KMT2D_000511 - - - - Germline ? - - - - Vincent Gatinois
?/. 1 - c.1190A>C VUS r.(?) p.(Lys397Thr) g.49446415T>G - KMT2D(NM_003482.3):c.1190A>C (p.K397T) - KMT2D_000859 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 2 - c.1258+5G>A likely pathogenic r.spl? p.? g.49446342C>T - KMT2D(NM_003482.3):c.1258+5G>A - KMT2D_000695 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_VUmc
+/. 1 10 c.1300del - r.(?) p.(Leu434*) g.49446166del g.49052383del 1300delC, Leu434* - KMT2D_000510 - PubMed: Miyake 2013 - - Germline ? - - - - Vincent Gatinois
+/. 1 10 c.1301del - r.(?) p.(Leu434Glnfs*496) g.49446165del g.49052382del 1301delT, Leu434GlnfsX496 - KMT2D_000509 - PubMed: Paulussen 2011 - - Germline yes - - - - Vincent Gatinois
-?/. 1 - c.1305C>T likely benign r.(?) p.(=) g.49446161G>A - KMT2D(NM_003482.3):c.1305C>T (p.N435=) - KMT2D_000694 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 2 10 c.1328del - r.(?) p.(Pro443Hisfs*487) g.49446138del g.49052355del 1328delC, Pro443Hisfs*487, 1324delC, P442HfsX487 - KMT2D_000508 - PubMed: Miyake 2013, PubMed: Ng 2010, PubMed: Hannibal 2011 - - Germline yes, ? - - - - Vincent Gatinois
+/. 2 10 c.1345_1346del - r.(?) p.(Leu449Valfs*5) g.49446120_49446121del g.49052337_49052338del 1345_1346delCT, Leu449ValfsX5, 1345_1346del, (Leu449Valfs*5) - KMT2D_000507 - PubMed: Micale 2011, PubMed: Dentici 2015 - - Germline ? - - - - Vincent Gatinois
+/. 2 10 c.1363del - r.(?) p.(Glu455Asnfs*475) g.49446103del g.49052320del 1363delG, Glu455Asnfs*475 - KMT2D_000506 - submitted - - Germline yes, ? - - - - Nina Bögershausen, Vincent Gatinois
+/. 2 10 c.1425del - r.(?) p.(Ala476Hisfs*454) g.49446041del g.49052258del 1425delC, Pro475ProfsX455 - KMT2D_000505 - submitted - - De novo, Germline yes - - - - Nina Bögershausen, Vincent Gatinois
+/. 1 10 c.1448dup - r.(?) p.(Leu483Phefs*17) g.49446018dup g.49052235dup 1446insT, L483FfsX17 - KMT2D_000504 - PubMed: Banka 2012 - - Germline ? - - - - Vincent Gatinois
+/. 1 10 c.1483_1486del - r.(?) p.(Ser495Argfs*434) g.49445980_49445983del g.49052197_49052200del 1483_1486delTCTC, S495RfsX434 - KMT2D_000503 - PubMed: Li 2011 - - Germline ? - - - - Vincent Gatinois
?/. 1 - c.1487C>T VUS r.(?) p.(Pro496Leu) g.49445979G>A - KMT2D(NM_003482.3):c.1487C>T (p.P496L) - KMT2D_000692 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 10 c.1503dupT - r.(?) p.(Pro502Serfs*7) g.49445963dup g.49052180dupA - - KMT2D_000003 - PubMed: Micale 2014 - - De novo - - - - - Giuseppe Merla
+/. 1 10 c.1512_1513del - r.(?) p.(Pro506Thrfs*2) g.49445953_49445954del g.49052170_49052171del 1512_1513delTC, P506TfsX2 - KMT2D_000502 - PubMed: Li 2011 - - Germline yes - - - - Vincent Gatinois
+/. 1 10 c.1530del pathogenic (dominant) r.(?) p.(Pro511Leufs*419) g.49445936del - 1530_1530delA - KMT2D_000721 - PubMed: Martinez 2017, Journal: Martinez 2017 - - De novo - - - - - Johan den Dunnen
+/. 2 10 c.1576_1577del - r.(?) p.(Ser526Thrfs*7) g.49445889_49445890del g.49052106_49052107del 1576_1577delTC, Ser526ThrfsX7 - KMT2D_000501 - submitted - - Germline yes, ? - - - - Nina Bögershausen, Vincent Gatinois
+/. 1 10 c.1628C>T - r.(?) p.(Ser543Leu) g.49445838G>A g.49052055G>A 1628C>T, S543L - KMT2D_000500 - PubMed: Li 2011 - - Germline no - - - - Vincent Gatinois
+/. 1 10 c.1634del - r.(?) p.(Leu545Argfs*385) g.49445832del g.49052049del 1634delT, L545RfsX - KMT2D_000499 - PubMed: Banka 2012 - - Germline ? - - - - Vincent Gatinois
?/. 1 10 c.1660T>A - r.(?) p.(Leu554Met) g.49445806A>T g.49052023A>T - - KMT2D_000101 - - - - Germline - - - - - Andreas Laner
./. 1 - c.1667C>T - r.(?) p.(Pro556Leu) g.49445799G>A g.49052016G>A - - KMT2D_000118 - PubMed: DDDS 2015, Journal: DDDS 2015 - - Germline - - - - - Johan den Dunnen
?/. 1 10 c.1668G>A - r.(=) p.(=) g.49445798C>T g.49052015C>T - - KMT2D_000100 - - - - Germline - - - - - Andreas Laner
-?/. 1 - c.1725A>T likely benign r.(?) p.(=) g.49445741T>A - KMT2D(NM_003482.3):c.1725A>T (p.P575=) - KMT2D_000823 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1762T>C likely benign r.(?) p.(Ser588Pro) g.49445704A>G - KMT2D(NM_003482.3):c.1762T>C (p.S588P) - KMT2D_000691 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 10 c.1781C>T - r.(?) p.(Pro594Leu) g.49445685G>A g.49051902G>A 1781C>T, Pro594Leu - KMT2D_000498 - - - - Germline no - - - - Vincent Gatinois
-?/. 1 - c.1793G>A likely benign r.(?) p.(Arg598His) g.49445673C>T - KMT2D(NM_003482.3):c.1793G>A (p.R598H) - KMT2D_000690 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1797G>A likely benign r.(?) p.(=) g.49445669C>T - KMT2D(NM_003482.3):c.1797G>A (p.L599=) - KMT2D_000858 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1850T>A likely benign r.(?) p.(Leu617His) g.49445616A>T - KMT2D(NM_003482.3):c.1850T>A (p.L617H) - KMT2D_000689 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 10 c.1921G>T - r.(?) p.(Glu641*) g.49445545C>A g.49051762C>A 1921G>T, Glu641X - KMT2D_000497 - PubMed: Micale 2011 - - Germline ? - - - - Vincent Gatinois
?/. 1 - c.1923A>C VUS r.(?) p.(Glu641Asp) g.49445543T>G - KMT2D(NM_003482.3):c.1923A>C (p.E641D) - KMT2D_000688 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1930A>C VUS r.(?) p.(Met644Leu) g.49445536T>G - KMT2D(NM_003482.3):c.1930A>C (p.(Met644Leu)) - KMT2D_000687 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/., +/. 3 10, 14 c.1940C>A likely benign r.(?) p.(Pro647Gln) g.49445526G>T g.49051743G>T KMT2D(NM_003482.3):c.1940C>A (p.P647Q), 1940C>A, P647Q, 1940C>A, (Pro647Gln) - KMT2D_000496 VKGL data sharing initiative Nederland PubMed: Li 2011, PubMed: Makrythanasis 2013 - - CLASSIFICATION record, Germline ?, yes - - - - VKGL-NL, Vincent Gatinois
-?/. 1 - c.1954C>T likely benign r.(?) p.(Arg652Cys) g.49445512G>A - KMT2D(NM_003482.3):c.1954C>T (p.R652C) - KMT2D_000857 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1965C>A likely benign r.(?) p.(=) g.49445501G>T - KMT2D(NM_003482.3):c.1965C>A (p.P655=) - KMT2D_000822 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 2 10 c.1966dup - r.(?) p.(Leu656Profs*12) g.49445500dup g.49051717dup 1966dupC, Leu656ProfsX11 - KMT2D_000495 - submitted - - Germline yes, ? - - - - Nina Bögershausen, Vincent Gatinois
?/. 1 - c.2038A>C VUS r.(?) p.(Thr680Pro) g.49445428T>G - KMT2D(NM_003482.3):c.2038A>C (p.T680P) - KMT2D_000686 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.2052T>A likely benign r.(?) p.(=) g.49445414A>T - KMT2D(NM_003482.3):c.2052T>A (p.P684=) - KMT2D_000685 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.2056G>A VUS r.(?) p.(Ala686Thr) g.49445410C>T - KMT2D(NM_003482.3):c.2056G>A (p.(Ala686Thr)) - KMT2D_000684 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.2074C>A likely benign r.(?) p.(Pro692Thr) g.49445392G>T - KMT2D(NM_003482.3):c.2074C>A (p.(Pro692Thr)) - KMT2D_000683 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 10 c.2110del - r.(?) p.(Asp704Thrfs*226) g.49445356del g.49051573del 2110delG, Asp704ThrfsX226 - KMT2D_000494 - PubMed: Paulussen 2011 - - Germline yes - - - - Vincent Gatinois
-/. 1 - c.2156C>T benign r.(?) p.(Pro719Leu) g.49445310G>A - KMT2D(NM_003482.3):c.2156C>T (p.P719L) - KMT2D_000821 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 2 10 c.2164del - r.(?) p.(Glu722Serfs*208) g.49445302del g.49051519del 2164delG, Glu722SerfsX208 - KMT2D_000493 - submitted - - De novo, Germline yes - - - - Nina Bögershausen, Vincent Gatinois
?/. 1 - c.2222C>T VUS r.(?) p.(Pro741Leu) g.49445244G>A - KMT2D(NM_003482.3):c.2222C>T (p.(Pro741Leu)) - KMT2D_000682 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 10 c.2232_2257del - r.(?) p.(Arg746Profs*3) g.49445209_49445234del g.49051426_49051451del - - KMT2D_000099 - - - - Germline - - - - - Andreas Laner
-?/. 1 - c.2236C>T likely benign r.(?) p.(Arg746Trp) g.49445230G>A - KMT2D(NM_003482.3):c.2236C>T (p.R746W) - KMT2D_000856 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.2250_2276del benign r.(?) p.(Arg755_Pro763del) g.49445207_49445233del - KMT2D(NM_003482.3):c.2250_2276delGCACCTGTCCCCCCGGCCTGAGGAGCC (p.R755_P763del) - KMT2D_000820 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.2256_2282del likely benign r.(?) p.(Arg755_Pro763del) g.49445189_49445215del - KMT2D(NM_003482.3):c.2256_2282del (p.(Arg755_Pro763del)) - KMT2D_000855 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 10 c.2272del - r.(?) p.(Glu758Serfs*172) g.49445194del g.49051411del 2272delG, Glu758SerfsX171 - KMT2D_000492 - PubMed: Paulussen 2011 - - Germline yes - - - - Vincent Gatinois
+/. 2 10 c.2345del - r.(?) p.(Val782Glyfs*148) g.49445121del g.49051338del 2345delT, Val782GlyfsX148 - KMT2D_000491 - submitted - - De novo, Germline yes - - - - Nina Bögershausen, Vincent Gatinois
+/. 1 10 c.2398C>T - r.(?) p.(Gln800*) g.49445068G>A g.49051285G>A - - KMT2D_000570 - submitted - - De novo - - - - - Nina Bögershausen
+/. 1 10 c.2433_2434insCA - r.(?) p.(Glu812Glnfs*119) g.49445032_49445033insTG g.49051249_49051250insTG 2433_2434insCA, Glu812Glnfs*119 - KMT2D_000490 - PubMed: Miyake 2013 - - Germline yes - - - - Vincent Gatinois
Legend   « First ‹ Prev     1 2 3 4 5 6 7 8 9     Next › Last »