Unique variants in gene NDUFA10

Information The variants shown are described using the NM_004544.3 transcript reference sequence.

15 entries on 1 page. Showing entries 1 - 15.
Legend  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. 1 - c.71G>T r.(?) p.(Arg24Leu) - VUS g.240964648C>A g.240025231C>A NDUFA10(NM_004544.3):c.71G>T (p.R24L) - NDUFA10_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.105A>G r.(?) p.(Lys35=) - benign g.240961728T>C g.240022311T>C NDUFA10(NM_004544.3):c.105A>G (p.K35=) - NDUFA10_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.404T>C r.(?) p.(Leu135Ser) - VUS g.240960670A>G g.240021253A>G - - NDUFA10_000016 3 heterozygous, no homozygous; Clinindb (India) Faruq 2020, submtted - rs140776586 Germline - 3/2794 individuals - - - Mohammed Faruq
-?/. 1 - c.745A>G r.(?) p.(Met249Val) - likely benign g.240951038T>C g.240011621T>C NDUFA10(NM_004544.3):c.745A>G (p.(Met249Val)) - NDUFA10_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.771A>G r.(?) p.(Gln257=) - benign g.240946766T>C g.240007349T>C NDUFA10(NM_004544.3):c.771A>G (p.Q257=) - NDUFA10_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.815A>G r.(?) p.(Asp272Gly) - VUS g.240944702T>C - NDUFA10(NM_004544.3):c.815A>G (p.D272G) - NDUFA10_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.844C>T r.(?) p.(Pro282Ser) - VUS g.240944673G>A g.240005256G>A - - NDUFA10_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.890+6991A>C r.(=) p.(=) - VUS g.240937636T>G g.239998219T>G - - NDUFA10_000001 - - - - Germline - - - - - Yu Sun
-/. 1 - c.999+6344G>A r.(=) p.(=) - benign g.240923147C>T g.239983730C>T NDUFA10(NM_004544.3):c.999+6344G>A - NDUFA10_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.999+6345A>G r.(=) p.(=) - benign g.240923146T>C g.239983729T>C NDUFA10(NM_004544.3):c.999+6345A>G - NDUFA10_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.999+6441G>A r.(=) p.(=) - benign g.240923050C>T g.239983633C>T NDUFA10(NM_004544.3):c.999+6441G>A - NDUFA10_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.1000-12385_1000-12365del r.(=) p.(=) - likely benign g.240913010_240913030del g.239973593_239973613del NDUFA10(NM_001322019.1):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_R370del) - NDUFA10_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.1000-5del r.spl? p.? - benign g.240900612del g.239961195del NDUFA10(NM_004544.3):c.1000-5delC - NDUFA10_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.1037A>C r.(?) p.(Glu346Ala) - likely benign g.240900566T>G g.239961149T>G NDUFA10(NM_004544.3):c.1037A>C (p.(Glu346Ala)) - NDUFA10_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 2 - c.*407C>T r.(=) p.(=) - likely benign g.240900128G>A g.239960711G>A - - NDUFA10_000015 34 heterozygous; Clinindb (India), 1 homozygous; Clinindb (India) Faruq 2020, submtted - rs74614612 Germline - 34/2793 individuals, 1/2793 individuals - - - Mohammed Faruq
Legend