Full data view for gene NDUFA10

Information The variants shown are described using the NM_004544.3 transcript reference sequence.

29 entries on 1 page. Showing entries 1 - 29.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
?/. - c.-4822T>C r.(?) p.(=) Unknown - VUS g.240969540A>G g.240030123A>G OR6B2(NM_001005853.1):c.307T>C (p.(Phe103Leu)) - OR6B2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-4743C>T r.(?) p.(=) Unknown - VUS g.240969461G>A - OR6B2(NM_001005853.1):c.386C>T (p.(Pro129Leu)) - NDUFA10_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.71G>T r.(?) p.(Arg24Leu) Unknown - VUS g.240964648C>A g.240025231C>A NDUFA10(NM_004544.4):c.71G>T (p.R24L) - NDUFA10_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.105A>G r.(?) p.(Lys35=) Unknown - benign g.240961728T>C g.240022311T>C NDUFA10(NM_004544.4):c.105A>G (p.K35=) - NDUFA10_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.109C>T r.(?) p.(Arg37Cys) Unknown - VUS g.240961724G>A - NDUFA10(NM_004544.3):c.109C>T (p.R37C) - NDUFA10_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.245-19C>T r.(=) p.(=) Unknown - benign g.240960848G>A - NDUFA10(NM_004544.4):c.245-19C>T - NDUFA10_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.404T>C r.(?) p.(Leu135Ser) Parent #1 - VUS g.240960670A>G g.240021253A>G - - NDUFA10_000016 3 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs140776586 Germline - 3/2794 individuals - - - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - - - - 3 Mohammed Faruq
?/. - c.404T>C r.(?) p.(Leu135Ser) Unknown - VUS g.240960670A>G - NDUFA10(NM_004544.3):c.404T>C (p.L135S) - NDUFA10_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.404T>C r.(?) p.(Leu135Ser) Parent #1 - VUS g.240960670A>G g.240021253A>G - - NDUFA10_000016 ACMG PM3, PP1, PP3, PP4, PubMed: Zheng 2024 - - Germline - - - - - DNA SEQ-NG - gene panel OPA F036P038II-1 PubMed: Zheng 2024 - M - China - - - - - 1 Johan den Dunnen
-?/. - c.548-9A>G r.(=) p.(=) Unknown - likely benign g.240954286T>C - NDUFA10(NM_004544.3):c.548-9A>G - NDUFA10_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.599C>T r.(?) p.(Pro200Leu) Unknown - VUS g.240954226G>A - NDUFA10(NM_004544.4):c.599C>T (p.(Pro200Leu)) - NDUFA10_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.712G>A r.(?) p.(Glu238Lys) Unknown - VUS g.240951071C>T - NDUFA10(NM_004544.3):c.712G>A (p.E238K) - NDUFA10_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.745A>G r.(?) p.(Met249Val) Unknown - likely benign g.240951038T>C g.240011621T>C NDUFA10(NM_004544.3):c.745A>G (p.(Met249Val)) - NDUFA10_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.763G>T r.(?) p.(Val255Phe) Unknown - VUS g.240946774C>A - NDUFA10(NM_004544.4):c.763G>T (p.(Val255Phe)) - NDUFA10_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.771A>G r.(?) p.(Gln257=) Unknown - benign g.240946766T>C g.240007349T>C NDUFA10(NM_004544.4):c.771A>G (p.Q257=) - NDUFA10_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.815A>G r.(?) p.(Asp272Gly) Unknown - VUS g.240944702T>C - NDUFA10(NM_004544.4):c.815A>G (p.D272G) - NDUFA10_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.844C>T r.(?) p.(Pro282Ser) Unknown - VUS g.240944673G>A g.240005256G>A - - NDUFA10_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.890+6991A>C r.(=) p.(=) Both (homozygous) - VUS g.240937636T>G g.239998219T>G - - NDUFA10_000001 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - - - - 1 Yu Sun
-/. - c.999+6344G>A r.(=) p.(=) Unknown - benign g.240923147C>T g.239983730C>T NDUFA10(NM_004544.4):c.999+6344G>A - NDUFA10_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.999+6345A>G r.(=) p.(=) Unknown - benign g.240923146T>C g.239983729T>C NDUFA10(NM_004544.4):c.999+6345A>G - NDUFA10_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.999+6441G>A r.(=) p.(=) Unknown - benign g.240923050C>T g.239983633C>T NDUFA10(NM_004544.4):c.999+6441G>A - NDUFA10_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1000-12409C>G r.(=) p.(=) Unknown - VUS g.240913012G>C - NDUFA10(NM_001322019.1):c.1066C>G (p.R356G) - NDUFA10_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1000-12385_1000-12365del r.(=) p.(=) Unknown - likely benign g.240913010_240913030del g.239973593_239973613del NDUFA10(NM_001322019.1):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_R370del), NDUFA10(NM_001322019.2):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_...) - NDUFA10_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1000-12385_1000-12365del r.(=) p.(=) Unknown - likely benign g.240913010_240913030del - NDUFA10(NM_001322019.1):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_R370del), NDUFA10(NM_001322019.2):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_...) - NDUFA10_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1000-12385_1000-12364del r.? p.? Parent #2 - pathogenic g.240912967_240912988del g.239973550_239973571del 1090_1110del CACGATCAGCTTCAAGGAGGGA (Ser364_Arg370del) - NDUFA10_000023 ACMG PS4, PM2, PM3, PM4PP1, PP4, PubMed: Zheng 2024 - - Germline - - - - - DNA SEQ-NG - gene panel OPA F036P038II-1 PubMed: Zheng 2024 - M - China - - - - - 1 Johan den Dunnen
-/. - c.1000-5del r.spl? p.? Unknown - benign g.240900612del g.239961195del NDUFA10(NM_004544.4):c.1000-5delC - NDUFA10_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1037A>C r.(?) p.(Glu346Ala) Unknown - likely benign g.240900566T>G g.239961149T>G NDUFA10(NM_004544.3):c.1037A>C (p.(Glu346Ala)) - NDUFA10_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.*407C>T r.(=) p.(=) Parent #1 - likely benign g.240900128G>A g.239960711G>A - - NDUFA10_000015 34 heterozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs74614612 Germline - 34/2793 individuals - - - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - - - - 34 Mohammed Faruq
-?/. - c.*407C>T r.(=) p.(=) Both (homozygous) - likely benign g.240900128G>A g.239960711G>A - - NDUFA10_000015 1 homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs74614612 Germline - 1/2793 individuals - - - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - - - - 1 Mohammed Faruq
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.