Legend
Please note that a short description of a certain column can be displayed when you move your mouse cursor over the column's header and hold it still. Below, a more detailed description is shown per column.
Effect: The variant's effect on the function of the gene/protein, displayed in the format 'R/C'. R is the value reported by the source (publication, submitter) and this classification may vary between records. C is the value concluded by the curator. Note that in some database the curator uses Summary records to give details on the classification of the variant.Values used: '+' indicating the variant affects function, '+?' probably affects function, '-' does not affect function, '-?' probably does not affect function, '?' effect unknown, '.' effect was not classified.
Exon: number of exon/intron containing variant; 2 = exon 2, 12i = intron 12, 2i_7i = from intron 2 to intron 7, 8i_9 = intron 8/exon 9 boundary, _1 = 5' to exon 1, 18_ = 3' of exon 18, _1_18_ = encompassing the entire 18-exon gene
DNA change (cDNA): description of variant at DNA level, based on a coding DNA reference sequence (following HGVS recommendations); e.g. c.123C>T, c.123_145del, c.123_126dup. For deletions/duplications extending beyond the reference transcript resp. {0}/{2} is used to replace del/dup. Extent of the deletion/duplication should be specified using the genomic description (g.). "-" indicates the variant described on genomic level does not affect the coding DNA reference sequence.
RNA change: description of variant at RNA level (following HGVS recommendations).
- r.123c>u
- r.? = unknown
- r.(?) = RNA not analysed but probably transcribed copy of DNA variant
- r.spl? = RNA not analysed but variant probably affects splicing
- r.(spl?) = RNA not analysed but variant may affect splicing
- r.0? = change expected to abolish transcription
Protein: description of variant at protein level (following HGVS recommendations).
- p.(Arg345Pro) = change predicted from DNA (RNA not analysed)
- p.Arg345Pro = change derived from RNA analysis
- p.? = unknown effect
- p.0? = probably no protein produced
Allele: On which allele is the variant located? Does not necessarily imply inheritance! 'Paternal' (confirmed or inferred), 'Maternal' (confirmed or inferred), 'Parent #1' or #2 for compound heterozygosity without having screened the parents, 'Unknown' for heterozygosity without having screened the parents, 'Both' for homozygozity.
Classification method: The method used for the clinical classification of this variant.
All options:
- ACMG
- ACGS
- EAHAD-CFDB
- ENIGMA
- IARC
- InSiGHT
- kConFab
- other
Clinical classification: Clinical classification of variant, preferably based on standardised criteria (e.g. ACMG), directed on the clinical consequences as published/submitted, indicated using an enriched system including inheritance: e.g. pathogenic, pathogenic (dominant), pathogenic (recessive), pathogenic (!), pathogenic (maternal), pathogenic (paternal). Standard inheritance is covered by dominant/recessive, imprinting by maternal/paternal. A '!' warns for exceptional circumstances to be explained in the 'Remarks' field (low penetrance, variants pathogenic in heterozygous state only, hypomorphic/hypermorphic variants, protective variants, etc.). Non-disease consequences (e.g. drug metabolism (pharmacogenetics), risk factor, blood group, tasting bitter) are indicated using additions to the benign classification; benign (dominant), benign (recessive), benign (!), etc. The value 'association' is used for variants associated with a phenotype and 'NA' for variants from in vitro/in silico records. NOTE: classification may differ from the opinion of the curator as given in a variant SUMMARY-record or the 'Functional effect concluded'). NOTE: pathogenic/likely pathogenic should go together with "variant (probably) affects function" In ClassFunctional.
All options:
- pathogenic
- pathogenic (dominant)
- pathogenic (recessive)
- pathogenic (!)
- pathogenic (maternal)
- pathogenic (paternal)
- likely pathogenic
- likely pathogenic (dominant)
- likely pathogenic (recessive)
- likely pathogenic (!)
- likely pathogenic (maternal)
- likely pathogenic (paternal)
- VUS
- VUS (!)
- likely benign
- likely benign (dominant)
- likely benign (recessive)
- likely benign (!)
- likely benign (maternal)
- likely benign (paternal)
- benign
- benign (dominant)
- benign (recessive)
- benign (!)
- benign (maternal)
- benign (paternal)
- conflicting
- association
- NA
DNA change (genomic) (hg19): HGVS description of variant at DNA level, based on the genomic (chromosomal) DNA reference sequence; e.g. g.12345678C>T, g.12345679del, g.12345678_12345890dup
DNA change (hg38): HGVS description of variant at DNA level, based on the hg38 genomic (chromosomal) eference sequence; e.g. g.12345678C>T, g.12345679del, g.12345678_12345890dup
Published as: listed only when different from "DNA change"; variant as reported originally (e.g. 521delT). Variants seen in animal models, tested in vitro, predicted from RNA analysis, etc. are described between brackets like c.(456C>G)
ISCN: description of the variant according to ISCN nomenclature
DB-ID: database ID of variant, grouping multiple observations of the same variant together, starting with the HGNC gene symbol, followed by an underscore (_) and a six digit number (e.g. DMD_012345). _000000 is used for variants where DNA was not analysed (change predicted from RNA analysis), variants seen in animal models or variants not seen in humans but functionally tested in vitro
Variant remarks: remarks regarding variant described, e.g. germline mosaicism in mother, 345 kb deletion, muscle RNA analysed, not in 200 control chromosomes tested, on founder haplotype, etc.
Reference: publication describing the variant submitted, incl. links to OMIM, PubMed or other source, e.g. "den Dunnen ASHG2003 P2346"
ClinVar ID: ID of variant in ClinVar database
dbSNP ID: the dbSNP ID
Origin: Origin of variant/record: Germline = in all cells, De novo = in all cells, but not in either parent, Germline/De novo (untested) = in all cells, parents not tested (use only when De novo is likely, e.g. isolated/sporadic cases with dominant disease), Somatic = present in a subset of cells, but not in either parent, Uniparental disomy = from parental disomy (maternal or paternal), CLASSIFICATION record = submitter only sharing variant classification (note another report may share Individual data), SUMMARY record = master summary record from curator (may link to another database), In vitro (cloned) = data resulting from in vitro functional assays, animal model = data from animal model, Artefact = false positive variant call, DUPLICATE record = variant already described on another chromosome (e.g. unbalanced translocation, duplicating transposition, 2nd fusion transcript, etc.)
All options:
- Germline
- De novo
- Germline/De novo (untested)
- Somatic
- Uniparental disomy
- Uniparental disomy, maternal allele
- Uniparental disomy, paternal allele
- CLASSIFICATION record
- SUMMARY record
- In vitro (cloned)
- In silico
- animal model
- Artefact
- DUPLICATE record
- Unknown
- Not applicable
Segregation: Indicates whether the variant segregates with the phenotype (yes), does not segregate with the phenotype (no) or segregation is unknown (?)
All options:
- ? = unknown
- yes = segregates with phenotype
- no = does not segregate with phenotype
- - = not applicable
Frequency: frequency in which the variant was found; e.g 5/760 chromosomes (in 5 of 760 chromosomes tested), 1/33 patients (in 1 of 33 patients analysed in study), 0.05 controls (in 5% of control cases tested)
Re-site: restriction enzyme recognition site created (+) or destroyed (-); e.g. BglII+;BamHI-
VIP: variant VIP-status was requested for matchmaking - need collaboration(s) to crack the case - please contact the submitter/curator.
NOTE: to get VIP status ask the curator.
Methylation: result of methylation test; GOM (gain of methylation), LOM (loss of methylation), 30% (30% methylated). NOTE: when several tests were done mention the method as well (e.g. MS-PCR 75%)
Template: Template(s) used to detect the sequence variant; DNA (genomic DNA), RNA (cDNA) or protein
All options:
- DNA
- RNA = RNA (cDNA)
- protein
- ? = unknown
Technique: technique(s) used to identify the sequence variant.
All options:
- ? = unknown
- ARMS = amplification refractory mutation system
- arrayCGH = array for Comparative Genomic Hybridisation
- arrayMET = array for methylation analysis
- arraySEQ = array for resequencing
- arraySNP = array for SNP typing
- arrayCNV = array for Copy Number Variation (SNP and CNV probes)
- ASO = allele-specific oligo hybridisation
- BESS = Base Excision Sequence Scanning
- CMC = Chemical Mismatch Cleavage
- COBRA = Combined Bisulfite Restriction Analysis
- CSCE = Conformation Sensitive Capillary Electrophoresis
- CSGE = Conformation Sensitive Gel Electrophoresis
- ddF = dideoxy Fingerprinting
- DGGE = Denaturing-Gradient Gel-Electrophoresis
- DHPLC = Denaturing High-Performance Liquid Chromatography
- DOVAM = Detection Of Virtually All Mutations (SSCA variant)
- DSCA = Double-Strand DNA Conformation Analysis
- DSDI = Detection Small Deletions and Insertions
- EMC = Enzymatic Mismatch Cleavage
- expr = expression analysis
- FISH = Fluorescent In-Situ Hybridisation
- FISHf = fiberFISH
- HD = HeteroDuplex analysis
- HPLC = High-Performance Liquid Chromatography
- IEF = IsoElectric Focussing
- IHC = Immuno-Histo-Chemistry
- Invader = Invader assay
- MAPH = Multiplex Amplifiable Probe Hybridisation
- MAQ = Multiplex Amplicon Quantification
- MCA = Melting Curve Analysis, high-resolution (HRMA)
- microscope = microscopic analysis (karyotype)
- microsat = microsatellite genotyping
- minigene = expression minigene construct
- MIP = Molecular Inversion Probe amplification
- MIPsm = single molecule Molecular Inversion Probe amplification
- MLPA = Multiplex Ligation-dependent Probe Amplification
- MLPA-ms = Multiplex Ligation-dependent Probe Amplification, methylation specific
- MS = mass spectrometry
- Northern = Northern blotting
- NUC = nuclease digestion (RNAseT1, S1)
- OM = optical mapping
- PAGE = Poly-Acrylamide Gel-Electrophoresis
- PCR = Polymerase Chain Reaction
- PCRdd = PCR, digital droplet
- PCRdig = PCR + restriction enzyme digestion
- PCRh = PCR, haloplex
- PCRlr = PCR, long-range
- PCRm = PCR, multiplex
- PCRms = PCR, methylation sensitive
- PCRq = PCR, quantitative (qPCR)
- PCRrp = PCR, repeat-primed (RP-PCR)
- PCRsqd = PCR, semi-quantitative duplex
- PE = primer extension (APEX, SNaPshot)
- PEms = primer extension, methylation-sensitive single-nucleotide
- PFGE = Pulsed-Field Gel-Electrophoresis (+Southern)
- PTT = Protein Truncation Test
- RFLP = Restriction Fragment Length Polymorphisms
- RT-PCR = Reverse Transcription and PCR
- RT-PCRq = Reverse Transcription and PCR, quantitative
- SBE = Single Base Extension
- SEQ = SEQuencing (Sanger)
- SEQb = bisulfite SEQuencing
- SEQp = pyroSequencing
- SEQms = sequencing, methylation specific
- SEQ-ON = next-generation sequencing - Oxford Nanopore
- SEQ-NG = next-generation sequencing
- SEQ-NG-RNA = next-generation sequencing RNA
- SEQ-NG-H = next-generation sequencing - Helicos
- SEQ-NG-I = next-generation sequencing - Illumina/Solexa
- SEQ-NG-IT = next-generation sequencing - Ion Torrent
- SEQ-NG-R = next-generation sequencing - Roche/454
- SEQ-NG-S = next-generation sequencing - SOLiD
- SEQ-PB = next-generation sequencing - Pacific Biosciences
- SNPlex = SNPlex
- Southern = Southern blotting
- SSCA = Single-Strand DNA Conformation polymorphism Analysis (SSCP)
- SSCAf = fluorescent SSCA (SSCP)
- STR = Short Tandem Repeat
- TaqMan = TaqMan assay
- Western = Western blotting
- - = not applicable
Tissue: tissue type used for analysis
Remarks: remarks regarding the screening like WGS (whole genome sequencing), WES (whole exome sequencing, gene panel (incl. a list of genes analysed), etc.
ID_report: ID of the individual that can be publically shared, e.g. as listed in a publication
Reference: reference to publication describing the individual/family, possibly giving more phenotypic details than listed in this database entry, incl. link to PubMed or other source, e.g. "den Dunnen ASHG2003 P2346"
Remarks: remarks about the individual
Gender: gender individual
All options:
- ? = unknown
- - = not applicable
- F = female
- M = male
- rF = raised as female
- rM = raised as male
Consanguinity: indicates whether the parents are related (consanguineous), not related (non-consanguineous) or whether consanguinity is not known (unknown)
All options:
- no = non-consanguineous parents
- yes = consanguineous parents
- likely = consanguinity likely
- ? = unknown
- - = not applicable
Country: where (country) does the individual live/recently came from. Give additional details (population, specific sub-group) and when parents come from different countries in "Population". Belgium = individual lives in/recently came from Belgium, (France) = reported by laboratory in France, individual's country of origin not sure
All options:
- ? (unknown)
- - (not applicable)
- Afghanistan
- (Afghanistan)
- Albania
- (Albania)
- Algeria
- (Algeria)
- American Samoa
- (American Samoa)
- Andorra
- (Andorra)
- Angola
- (Angola)
- Anguilla
- (Anguilla)
- Antarctica
- (Antarctica)
- Antigua and Barbuda
- (Antigua and Barbuda)
- Argentina
- (Argentina)
- Armenia
- (Armenia)
- Aruba
- (Aruba)
- Australia
- (Australia)
- Austria
- (Austria)
- Azerbaijan
- (Azerbaijan)
- Bahamas
- (Bahamas)
- Bahrain
- (Bahrain)
- Bangladesh
- (Bangladesh)
- Barbados
- (Barbados)
- Belarus
- (Belarus)
- Belgium
- (Belgium)
- Belize
- (Belize)
- Benin
- (Benin)
- Bermuda
- (Bermuda)
- Bhutan
- (Bhutan)
- Bolivia
- (Bolivia)
- Bosnia and Herzegovina
- (Bosnia and Herzegovina)
- Botswana
- (Botswana)
- Bouvet Island
- (Bouvet Island)
- Brazil
- (Brazil)
- British Indian Ocean Territory
- (British Indian Ocean Territory)
- Brunei Darussalam
- (Brunei Darussalam)
- Bulgaria
- (Bulgaria)
- Burkina Faso
- (Burkina Faso)
- Burundi
- (Burundi)
- Cambodia
- (Cambodia)
- Cameroon
- (Cameroon)
- Canada
- (Canada)
- Cape Verde
- (Cape Verde)
- Cayman Islands
- (Cayman Islands)
- Central African Republic
- (Central African Republic)
- Central Europe
- Chad
- (Chad)
- Chile
- (Chile)
- China
- (China)
- Christmas Island
- (Christmas Island)
- Cocos (Keeling Islands)
- (Cocos (Keeling Islands))
- Colombia
- (Colombia)
- Comoros
- (Comoros)
- Congo
- (Congo)
- Cook Islands
- (Cook Islands)
- Costa Rica
- (Costa Rica)
- Cote D'Ivoire (Ivory Coast)
- (Cote D'Ivoire (Ivory Coast))
- Croatia (Hrvatska)
- (Croatia (Hrvatska))
- Cuba
- (Cuba)
- Cyprus
- (Cyprus)
- Czech Republic
- (Czech Republic)
- Denmark
- (Denmark)
- Djibouti
- (Djibouti)
- Dominica
- (Dominica)
- Dominican Republic
- (Dominican Republic)
- East Timor
- (East Timor)
- Ecuador
- (Ecuador)
- Egypt
- (Egypt)
- El Salvador
- (El Salvador)
- England
- (England)
- Equatorial Guinea
- (Equatorial Guinea)
- Eritrea
- (Eritrea)
- Estonia
- (Estonia)
- Ethiopia
- (Ethiopia)
- Falkland Islands (Malvinas)
- (Falkland Islands (Malvinas))
- Faroe Islands
- (Faroe Islands)
- Fiji
- (Fiji)
- Finland
- (Finland)
- France
- (France)
- Gabon
- (Gabon)
- Gambia
- (Gambia)
- Georgia
- (Georgia)
- Germany
- (Germany)
- Ghana
- (Ghana)
- Gibraltar
- (Gibraltar)
- Greece
- (Greece)
- Greenland
- (Greenland)
- Grenada
- (Grenada)
- Guadeloupe
- (Guadeloupe)
- Guam
- (Guam)
- Guatemala
- (Guatemala)
- Guiana, French
- (Guiana, French)
- Guinea
- (Guinea)
- Guinea-Bissau
- (Guinea-Bissau)
- Guyana
- (Guyana)
- Haiti
- (Haiti)
- Heard and McDonald Islands
- (Heard and McDonald Islands)
- Honduras
- (Honduras)
- Hong Kong
- (Hong Kong)
- Hungary
- (Hungary)
- Iceland
- (Iceland)
- India
- (India)
- Indonesia
- (Indonesia)
- Iran
- (Iran)
- Iraq
- (Iraq)
- Ireland
- (Ireland)
- Israel
- (Israel)
- Italy
- (Italy)
- Jamaica
- (Jamaica)
- Japan
- (Japan)
- Jordan
- (Jordan)
- Kazakhstan
- (Kazakhstan)
- Kenya
- (Kenya)
- Kiribati
- (Kiribati)
- Korea
- (Korea)
- Korea, North (People's Republic)
- (Korea, North (People's Republic))
- Korea, South (Republic)
- (Korea, South (Republic))
- Kosovo
- (Kosovo)
- Kuwait
- (Kuwait)
- Kyrgyzstan (Kyrgyz Republic)
- (Kyrgyzstan (Kyrgyz Republic))
- Laos
- (Laos)
- Latvia
- (Latvia)
- Lebanon
- (Lebanon)
- Lesotho
- (Lesotho)
- Liberia
- (Liberia)
- Libya
- (Libya)
- Liechtenstein
- (Liechtenstein)
- Lithuania
- (Lithuania)
- Luxembourg
- (Luxembourg)
- Macau
- (Macau)
- Macedonia
- (Macedonia)
- Madagascar
- (Madagascar)
- Malawi
- (Malawi)
- Malaysia
- (Malaysia)
- Maldives
- (Maldives)
- Mali
- (Mali)
- Mallorca
- (Mallorca)
- Malta
- (Malta)
- Marshall Islands
- (Marshall Islands)
- Martinique
- (Martinique)
- Mauritania
- (Mauritania)
- Mauritius
- (Mauritius)
- Mayotte
- (Mayotte)
- Mexico
- (Mexico)
- Micronesia
- (Micronesia)
- Moldova
- (Moldova)
- Monaco
- (Monaco)
- Mongolia
- (Mongolia)
- Montserrat
- (Montserrat)
- Morocco
- (Morocco)
- Mozambique
- (Mozambique)
- Myanmar
- (Myanmar)
- Namibia
- (Namibia)
- Nauru
- (Nauru)
- Nepal
- (Nepal)
- Netherlands
- (Netherlands)
- Netherlands Antilles
- (Netherlands Antilles)
- Neutral Zone (Saudia Arabia/Iraq)
- (Neutral Zone (Saudia Arabia/Iraq))
- New Caledonia
- (New Caledonia)
- New Zealand
- (New Zealand)
- Nicaragua
- (Nicaragua)
- Niger
- (Niger)
- Nigeria
- (Nigeria)
- Niue
- (Niue)
- Norfolk Island
- (Norfolk Island)
- Northern Ireland
- (Northern Ireland)
- Northern Mariana Islands
- (Northern Mariana Islands)
- Norway
- (Norway)
- Oman
- (Oman)
- Pakistan
- (Pakistan)
- Palau
- (Palau)
- Palestine
- (Palestine)
- Panama
- (Panama)
- Papua New Guinea
- (Papua New Guinea)
- Paraguay
- (Paraguay)
- Peru
- (Peru)
- Philippines
- (Philippines)
- Pitcairn
- (Pitcairn)
- Poland
- (Poland)
- Polynesia, French
- (Polynesia, French)
- Portugal
- (Portugal)
- Puerto Rico
- (Puerto Rico)
- Qatar
- (Qatar)
- Reunion
- (Reunion)
- Romania
- (Romania)
- Russia
- (Russia)
- Russian Federation
- (Russian Federation)
- Rwanda
- (Rwanda)
- S. Georgia and S. Sandwich Isls.
- (S. Georgia and S. Sandwich Isls.)
- Saint Kitts and Nevis
- (Saint Kitts and Nevis)
- Saint Lucia
- (Saint Lucia)
- Saint Vincent and The Grenadines
- (Saint Vincent and The Grenadines)
- Samoa
- (Samoa)
- San Marino
- (San Marino)
- Sao Tome and Principe
- (Sao Tome and Principe)
- Saudi Arabia
- (Saudi Arabia)
- Scotland
- (Scotland)
- Senegal
- (Senegal)
- Serbia
- (Serbia)
- Seychelles
- (Seychelles)
- Sierra Leone
- (Sierra Leone)
- Singapore
- (Singapore)
- Slovakia (Slovak Republic)
- (Slovakia (Slovak Republic))
- Slovenia
- (Slovenia)
- Solomon Islands
- (Solomon Islands)
- Somalia
- (Somalia)
- South Africa
- (South Africa)
- Southern Territories, French
- (Southern Territories, French)
- Soviet Union (former)
- (Soviet Union (former))
- Spain
- (Spain)
- Sri Lanka
- (Sri Lanka)
- St. Helena, Ascension and Tristan da
- Cunha
- (St. Helena, Ascension and Tristan da
- Cunha)
- St. Pierre and Miquelon
- (St. Pierre and Miquelon)
- Sudan
- (Sudan)
- Sudan, South
- (Sudan, South)
- Suriname
- (Suriname)
- Svalbard and Jan Mayen Islands
- (Svalbard and Jan Mayen Islands)
- Swaziland
- (Swaziland)
- Sweden
- (Sweden)
- Switzerland
- (Switzerland)
- Syria
- (Syria)
- Taiwan
- (Taiwan)
- Tajikistan
- (Tajikistan)
- Tanzania
- (Tanzania)
- Thailand
- (Thailand)
- Togo
- (Togo)
- Tokelau
- (Tokelau)
- Tonga
- (Tonga)
- Trinidad and Tobago
- (Trinidad and Tobago)
- Tunisia
- (Tunisia)
- Turkey
- (Turkey)
- Turkmenistan
- (Turkmenistan)
- Turks and Caicos Islands
- (Turks and Caicos Islands)
- Tuvalu
- (Tuvalu)
- Uganda
- (Uganda)
- Ukraine
- (Ukraine)
- United Arab Emirates
- (United Arab Emirates)
- United Kingdom (Great Britain)
- (United Kingdom (Great Britain))
- United States
- (United States)
- Uruguay
- (Uruguay)
- US Minor Outlying Islands
- (US Minor Outlying Islands)
- Uzbekistan
- (Uzbekistan)
- Vanuatu
- (Vanuatu)
- Vatican City State (Holy See)
- (Vatican City State (Holy See))
- Venezuela
- (Venezuela)
- Viet Nam
- (Viet Nam)
- Virgin Islands (British)
- (Virgin Islands (British))
- Virgin Islands (US)
- (Virgin Islands (US))
- Wales
- (Wales)
- Wallis and Futuna Islands
- (Wallis and Futuna Islands)
- Western Sahara
- (Western Sahara)
- Yemen
- (Yemen)
- Yugoslavia
- (Yugoslavia)
- Zaire
- (Zaire)
- Zambia
- (Zambia)
- Zimbabwe
- (Zimbabwe)
Population: population the individual (or ancestors) belongs to; e.g. white, gypsy, Jewish-Ashkenazi, Africa-N, Sardinia, etc.
Age at death: age at which the individual deceased (when applicable):
- 35y = 35 years
- >43y = still alive at 43y
- 04y08m = 4 years and 8 months
- 00y00m01d12h = 1 day and 12 hours
- 18y? = around 18 years
- 30y-40y = between 30 and 40 years
- >54y = older than 54
- ? = unknown
VIP: individual/phenotype VIP-status was requested for matchmaking - need collaboration(s) to crack the case - please contact the submitter/curator.
NOTE: to get VIP status ask the curator.
Data_av: are additional data available upon request: e.g. pedigree (yes/no/?)
Treatment: treatment of patient

 Effect
|

 Exon
|

 DNA change (cDNA)
|

 RNA change
|

 Protein
|

 Allele
|

 Classification method
|

 Clinical classification
|

 DNA change (genomic) (hg19)
|

 DNA change (hg38)
|

 Published as
|

 ISCN
|

 DB-ID
|
 Variant remarks
|

 Reference
|

 ClinVar ID
|

 dbSNP ID
|

 Origin
|

 Segregation
|

 Frequency
|

 Re-site
|

 VIP
|

 Methylation
|

 Template
|

 Technique
|

 Tissue
|
 Remarks
|

 Disease
|

 ID_report
|

 Reference
|
 Remarks
|

 Gender
|

 Consanguinity
|

 Country
|

 Population
|

 Age at death
|

 VIP
|

 Data_av
|

 Treatment
|

 Panel size
|

 Owner
|
| ?/. |
- |
c.-4822T>C |
r.(?) |
p.(=) |
Unknown |
- |
VUS |
g.240969540A>G |
g.240030123A>G |
OR6B2(NM_001005853.1):c.307T>C (p.(Phe103Leu)) |
- |
OR6B2_000003 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.-4743C>T |
r.(?) |
p.(=) |
Unknown |
- |
VUS |
g.240969461G>A |
- |
OR6B2(NM_001005853.1):c.386C>T (p.(Pro129Leu)) |
- |
NDUFA10_000022 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.71G>T |
r.(?) |
p.(Arg24Leu) |
Unknown |
- |
VUS |
g.240964648C>A |
g.240025231C>A |
NDUFA10(NM_004544.4):c.71G>T (p.R24L) |
- |
NDUFA10_000008 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -/. |
- |
c.105A>G |
r.(?) |
p.(Lys35=) |
Unknown |
- |
benign |
g.240961728T>C |
g.240022311T>C |
NDUFA10(NM_004544.4):c.105A>G (p.K35=) |
- |
NDUFA10_000007 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.109C>T |
r.(?) |
p.(Arg37Cys) |
Unknown |
- |
VUS |
g.240961724G>A |
- |
NDUFA10(NM_004544.3):c.109C>T (p.R37C) |
- |
NDUFA10_000020 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -/. |
- |
c.245-19C>T |
r.(=) |
p.(=) |
Unknown |
- |
benign |
g.240960848G>A |
- |
NDUFA10(NM_004544.4):c.245-19C>T |
- |
NDUFA10_000021 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.404T>C |
r.(?) |
p.(Leu135Ser) |
Parent #1 |
- |
VUS |
g.240960670A>G |
g.240021253A>G |
- |
- |
NDUFA10_000016 |
3 heterozygous, no homozygous; Clinindb (India) |
PubMed: Narang 2020, Journal: Narang 2020 |
- |
rs140776586 |
Germline |
- |
3/2794 individuals |
- |
- |
- |
DNA |
arraySNP |
- |
Infinium Global Screening Array v1.0 |
? |
- |
PubMed: Narang 2020, Journal: Narang 2020 |
analysis 2794 individuals (India) |
- |
- |
India |
- |
- |
- |
- |
- |
3 |
Mohammed Faruq |
| ?/. |
- |
c.404T>C |
r.(?) |
p.(Leu135Ser) |
Unknown |
- |
VUS |
g.240960670A>G |
- |
NDUFA10(NM_004544.3):c.404T>C (p.L135S) |
- |
NDUFA10_000016 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.404T>C |
r.(?) |
p.(Leu135Ser) |
Parent #1 |
- |
VUS |
g.240960670A>G |
g.240021253A>G |
- |
- |
NDUFA10_000016 |
ACMG PM3, PP1, PP3, PP4, |
PubMed: Zheng 2024 |
- |
- |
Germline |
- |
- |
- |
- |
- |
DNA |
SEQ-NG |
- |
gene panel |
OPA |
F036P038II-1 |
PubMed: Zheng 2024 |
- |
M |
- |
China |
- |
- |
- |
- |
- |
1 |
Johan den Dunnen |
| ?/. |
- |
c.539G>A |
r.(?) |
p.(Arg180Gln) |
Unknown |
- |
VUS |
g.240957978C>T |
- |
NDUFA10(NM_004544.4):c.539G>A (p.(Arg180Gln)) |
- |
NDUFA10_000029 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -?/. |
- |
c.548-9A>G |
r.(=) |
p.(=) |
Unknown |
- |
likely benign |
g.240954286T>C |
- |
NDUFA10(NM_004544.3):c.548-9A>G |
- |
NDUFA10_000019 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.599C>T |
r.(?) |
p.(Pro200Leu) |
Unknown |
- |
VUS |
g.240954226G>A |
- |
NDUFA10(NM_004544.4):c.599C>T (p.(Pro200Leu)) |
- |
NDUFA10_000025 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.650G>A |
r.(?) |
p.(Arg217Gln) |
Unknown |
- |
VUS |
g.240954175C>T |
- |
NDUFA10(NM_004544.4):c.650G>A (p.(Arg217Gln)) |
- |
NDUFA10_000027 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.698A>G |
r.(?) |
p.(Tyr233Cys) |
Unknown |
- |
VUS |
g.240951085T>C |
- |
NDUFA10(NM_004544.4):c.698A>G (p.(Tyr233Cys)) |
- |
NDUFA10_000026 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.712G>A |
r.(?) |
p.(Glu238Lys) |
Unknown |
- |
VUS |
g.240951071C>T |
- |
NDUFA10(NM_004544.3):c.712G>A (p.E238K) |
- |
NDUFA10_000012 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -?/. |
- |
c.745A>G |
r.(?) |
p.(Met249Val) |
Unknown |
- |
likely benign |
g.240951038T>C |
g.240011621T>C |
NDUFA10(NM_004544.3):c.745A>G (p.(Met249Val)) |
- |
NDUFA10_000011 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.763G>T |
r.(?) |
p.(Val255Phe) |
Unknown |
- |
VUS |
g.240946774C>A |
- |
NDUFA10(NM_004544.4):c.763G>T (p.(Val255Phe)) |
- |
NDUFA10_000024 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -/. |
- |
c.771A>G |
r.(?) |
p.(Gln257=) |
Unknown |
- |
benign |
g.240946766T>C |
g.240007349T>C |
NDUFA10(NM_004544.4):c.771A>G (p.Q257=) |
- |
NDUFA10_000006 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.815A>G |
r.(?) |
p.(Asp272Gly) |
Unknown |
- |
VUS |
g.240944702T>C |
- |
NDUFA10(NM_004544.4):c.815A>G (p.D272G) |
- |
NDUFA10_000017 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.844C>T |
r.(?) |
p.(Pro282Ser) |
Unknown |
- |
VUS |
g.240944673G>A |
g.240005256G>A |
- |
- |
NDUFA10_000009 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.890+6991A>C |
r.(=) |
p.(=) |
Both (homozygous) |
- |
VUS |
g.240937636T>G |
g.239998219T>G |
- |
- |
NDUFA10_000001 |
- |
- |
- |
- |
Germline |
- |
- |
- |
- |
- |
DNA |
SEQ-NG-I |
- |
- |
CHTE |
- |
PubMed: Sun 2011, Journal: Sun 2011 |
- |
M |
no |
Netherlands |
- |
- |
- |
- |
- |
1 |
Yu Sun |
| -/. |
- |
c.999+6344G>A |
r.(=) |
p.(=) |
Unknown |
- |
benign |
g.240923147C>T |
g.239983730C>T |
NDUFA10(NM_004544.4):c.999+6344G>A |
- |
NDUFA10_000005 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -/. |
- |
c.999+6345A>G |
r.(=) |
p.(=) |
Unknown |
- |
benign |
g.240923146T>C |
g.239983729T>C |
NDUFA10(NM_004544.4):c.999+6345A>G |
- |
NDUFA10_000004 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -/. |
- |
c.999+6441G>A |
r.(=) |
p.(=) |
Unknown |
- |
benign |
g.240923050C>T |
g.239983633C>T |
NDUFA10(NM_004544.4):c.999+6441G>A |
- |
NDUFA10_000003 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.1000-12409C>G |
r.(=) |
p.(=) |
Unknown |
- |
VUS |
g.240913012G>C |
- |
NDUFA10(NM_001322019.1):c.1066C>G (p.R356G) |
- |
NDUFA10_000018 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -?/. |
- |
c.1000-12385_1000-12365del |
r.(=) |
p.(=) |
Unknown |
- |
likely benign |
g.240913010_240913030del |
g.239973593_239973613del |
NDUFA10(NM_001322019.1):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_R370del), NDUFA10(NM_001322019.2):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_...) |
- |
NDUFA10_000014 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -?/. |
- |
c.1000-12385_1000-12365del |
r.(=) |
p.(=) |
Unknown |
- |
likely benign |
g.240913010_240913030del |
- |
NDUFA10(NM_001322019.1):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_R370del), NDUFA10(NM_001322019.2):c.1090_1110delTCCCTCCTTGAAGCTGATCGT (p.S364_...) |
- |
NDUFA10_000014 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| ?/. |
- |
c.1000-12385_1000-12365dup |
r.(=) |
p.(=) |
Unknown |
- |
VUS |
g.240913010_240913030dup |
- |
NDUFA10(NM_001322019.2):c.1090_1110dup (p.(Ser364_Arg370dup)) |
- |
NDUFA10_000028 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| +/. |
- |
c.1000-12385_1000-12364del |
r.? |
p.? |
Parent #2 |
- |
pathogenic |
g.240912967_240912988del |
g.239973550_239973571del |
1090_1110del CACGATCAGCTTCAAGGAGGGA (Ser364_Arg370del) |
- |
NDUFA10_000023 |
ACMG PS4, PM2, PM3, PM4PP1, PP4, |
PubMed: Zheng 2024 |
- |
- |
Germline |
- |
- |
- |
- |
- |
DNA |
SEQ-NG |
- |
gene panel |
OPA |
F036P038II-1 |
PubMed: Zheng 2024 |
- |
M |
- |
China |
- |
- |
- |
- |
- |
1 |
Johan den Dunnen |
| -/. |
- |
c.1000-5del |
r.spl? |
p.? |
Unknown |
- |
benign |
g.240900612del |
g.239961195del |
NDUFA10(NM_004544.4):c.1000-5delC |
- |
NDUFA10_000002 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -?/. |
- |
c.1037A>C |
r.(?) |
p.(Glu346Ala) |
Unknown |
- |
likely benign |
g.240900566T>G |
g.239961149T>G |
NDUFA10(NM_004544.3):c.1037A>C (p.(Glu346Ala)) |
- |
NDUFA10_000010 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
| -?/. |
- |
c.*407C>T |
r.(=) |
p.(=) |
Parent #1 |
- |
likely benign |
g.240900128G>A |
g.239960711G>A |
- |
- |
NDUFA10_000015 |
34 heterozygous; Clinindb (India) |
PubMed: Narang 2020, Journal: Narang 2020 |
- |
rs74614612 |
Germline |
- |
34/2793 individuals |
- |
- |
- |
DNA |
arraySNP |
- |
Infinium Global Screening Array v1.0 |
? |
- |
PubMed: Narang 2020, Journal: Narang 2020 |
analysis 2794 individuals (India) |
- |
- |
India |
- |
- |
- |
- |
- |
34 |
Mohammed Faruq |
| -?/. |
- |
c.*407C>T |
r.(=) |
p.(=) |
Both (homozygous) |
- |
likely benign |
g.240900128G>A |
g.239960711G>A |
- |
- |
NDUFA10_000015 |
1 homozygous; Clinindb (India) |
PubMed: Narang 2020, Journal: Narang 2020 |
- |
rs74614612 |
Germline |
- |
1/2793 individuals |
- |
- |
- |
DNA |
arraySNP |
- |
Infinium Global Screening Array v1.0 |
? |
- |
PubMed: Narang 2020, Journal: Narang 2020 |
analysis 2794 individuals (India) |
- |
- |
India |
- |
- |
- |
- |
- |
1 |
Mohammed Faruq |