Unique variants in the NPPA gene

Information The variants shown are described using the NM_006172.3 transcript reference sequence.

28 entries on 1 page. Showing entries 1 - 28.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. 1 - c.-792259_*2706065del r.0? p.0? - likely pathogenic g.9200001_12700000del g.9100001_12500000del CGH array deletion in Cr1p36.22 involving NMNAT1 gene, - MTHFR_000084 am apparent homozygous NMNAT1 mutation was found, probably on the other allele PubMed: Ruberto 2020 - - Unknown ? - - - - LOVD
-?/. 1 - c.-14T>C r.(?) p.(=) - likely benign g.11907755A>G - NPPA(NM_006172.4):c.-14T>C - MTHFR_000115 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.83T>C r.(?) p.(Met28Thr) - benign g.11907659A>G g.11847602A>G NPPA(NM_006172.4):c.83T>C (p.M28T) - NPPA_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.94G>A r.(?) p.(Val32Met) - benign g.11907648C>T g.11847591C>T NPPA(NM_006172.4):c.94G>A (p.V32M), NPPA-AS1(NR_037806.1):n.1637C>T - NPPA_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.123+16C>T r.(=) p.(=) - benign g.11907603G>A g.11847546G>A NPPA(NM_006172.4):c.123+16C>T, NPPA-AS1(NR_037806.1):n.1592G>A - NPPA_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.123+17G>A r.(=) p.(=) - benign g.11907602C>T g.11847545C>T NPPA(NM_006172.4):c.123+17G>A - NPPA_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 2 - c.128T>C r.(?) p.(Leu43Ser) - VUS g.11907492A>G - NPPA(NM_006172.4):c.128T>C (p.L43S) - MTHFR_000104 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
-/. 1 - c.135C>T r.(?) p.(Asp45=) - benign g.11907485G>A g.11847428G>A NPPA(NM_006172.4):c.135C>T (p.D45=) - MTHFR_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.171C>T r.(?) p.(Val57=) - benign g.11907449G>A g.11847392G>A NPPA(NM_006172.4):c.171C>T (p.V57=) - NPPA_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/., -?/. 5 - c.190A>C r.(?) p.(Ser64Arg) - benign, likely benign g.11907430T>G g.11847373T>G 1 more item - NPPA_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_AMC
-/. 1 - c.198G>A r.(?) p.(Pro66=) - benign g.11907422C>T g.11847365C>T NPPA(NM_006172.4):c.198G>A (p.P66=) - NPPA_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.209C>T r.(?) p.(Ala70Val) - VUS g.11907411G>A - NPPA(NM_006172.4):c.209C>T (p.A70V) - MTHFR_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.209_210del r.(?) p.(Ala70GlyfsTer9) - VUS g.11907411_11907412del g.11847354_11847355del NPPA(NM_006172.4):c.209_210delCG (p.A70Gfs*9) - NPPA_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.292G>A r.(?) p.(Gly98Arg) - likely benign g.11907328C>T g.11847271C>T NPPA(NM_006172.4):c.292G>A (p.G98R) - MTHFR_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.338G>C r.(?) p.(Ser113Thr) - VUS g.11907282C>G g.11847225C>G NPPA(NM_006172.4):c.338G>C (p.S113T) - MTHFR_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.347G>A r.(?) p.(Arg116Lys) - VUS g.11907273C>T g.11847216C>T NPPA(NM_006172.4):c.347G>A (p.R116K) - NPPA_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.351G>A r.(?) p.(Ala117=) - likely benign g.11907269C>T g.11847212C>T - - MTHFR_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.377G>A r.(?) p.(Arg126Gln) - VUS g.11907243C>T - NPPA(NM_006172.3):c.377G>A (p.(Arg126Gln)) - MTHFR_000117 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 - c.388T>C r.(?) p.(Cys130Arg) - likely pathogenic g.11907232A>G g.11847175A>G - - MTHFR_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 1 - c.441C>T r.(?) p.(Asn147=) - benign g.11907179G>A g.11847122G>A NPPA(NM_006172.4):c.441C>T (p.N147=), NPPA-AS1(NR_037806.1):n.1480-312G>A - NPPA_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 3 - c.448C>T r.(?) p.(Arg150Trp) - VUS g.11907172G>A g.11847115G>A NPPA(NM_006172.4):c.448C>T (p.(Arg150Trp), p.R150W) - MTHFR_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen, VKGL-NL_Nijmegen
-/. 1 - c.454T>C r.(?) p.(Ter152ArgextTer2) - benign g.11906068A>G g.11846011A>G NPPA(NM_006172.4):c.454T>C (p.*152Rext*2), NPPA-AS1(NR_037806.1):n.1479+245A>G - NPPA_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.*5840G>T r.(=) p.(=) - VUS g.11900226C>A - CLCN6(NM_001286.5):c.2556C>A (p.(Asn852Lys)) - MTHFR_000144 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*7344C>T r.(=) p.(=) - VUS g.11898722G>A - CLCN6(NM_001286.3):c.2529+5G>A (p.?) - MTHFR_000131 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.*7465G>A r.(=) p.(=) - likely benign g.11898601C>T - CLCN6(NM_001286.5):c.2413C>T (p.(Pro805Ser)) - MTHFR_000152 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*8596G>A r.(=) p.(=) - VUS g.11897470C>T - - - MTHFR_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.*8859_*8887dup r.(=) p.(=) - VUS g.11897186_11897214dup - CLCN6(NM_001286.3):c.2111_2138+1dupACCTCCTGCAGCAGATGCTGGAAAGGAGG (p.?) - MTHFR_000130 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*10002C>T r.(=) p.(=) - VUS g.11896064G>A - CLCN6(NM_001286.5):c.1834G>A (p.(Val612Ile)) - MTHFR_000143 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.