Unique variants in the PACS1 gene

Information The variants shown are described using the NM_018026.3 transcript reference sequence.

64 entries on 1 page. Showing entries 1 - 64.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 1 - c.-2346T>C r.(?) p.(=) - likely benign g.65835612T>C - SF3B2(NM_006842.3):c.2431-7T>C - PACS1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.-2283G>A r.(?) p.(=) - benign g.65835675G>A - SF3B2(NM_006842.3):c.2487G>A (p.A829=) - PACS1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.-2147G>A r.(?) p.(=) - likely benign g.65835811G>A - SF3B2(NM_006842.2):c.2616+7G>A (p.?) - PACS1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.101C>A r.(?) p.(Pro34Gln) - likely benign g.65838058C>A - PACS1(NM_018026.4):c.101C>A (p.(Pro34Gln)) - PACS1_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.102G>A r.(?) p.(=) - likely benign g.65838059G>A - PACS1(NM_018026.4):c.102G>A (p.(Pro34=)) - PACS1_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 2 - c.104A>C r.(?) p.(Gln35Pro) - likely benign g.65838061A>C g.66070590A>C PACS1(NM_018026.3):c.104A>C (p.Q35P, p.(Gln35Pro)) - PACS1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
?/. 1 - c.104_124dup r.(?) p.(Gln35_Pro41dup) - VUS g.65838061_65838081dup - PACS1(NM_018026.4):c.104_124dupAGCAGCAGCAGCAGCAGCCGC (p.Q35_P41dup) - PACS1_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.116_121dup r.(?) p.(Gln39_Gln40dup) - likely benign g.65838073_65838078dup g.66070602_66070607dup PACS1(NM_018026.3):c.101_102insGCAGCA (p.(Gln39_Gln40dup)) - PACS1_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.119_121del r.(?) p.(Gln40del) - likely benign g.65838076_65838078del - PACS1(NM_018026.3):c.119_121delAGC (p.(Gln40del)) - PACS1_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.139C>A r.(?) p.(Pro47Thr) - likely benign g.65838096C>A - PACS1(NM_018026.3):c.139C>A (p.(Pro47Thr)) - PACS1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.158C>T r.(?) p.(Ala53Val) - likely benign g.65838115C>T - PACS1(NM_018026.3):c.158C>T (p.(Ala53Val)) - PACS1_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.206C>T r.(?) p.(Ser69Phe) - VUS g.65838163C>T - PACS1(NM_018026.4):c.206C>T (p.S69F) - PACS1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. 1 - c.272G>C r.(?) p.(Gly91Ala) - likely benign g.65838229G>C g.66070758G>C PACS1(NM_018026.3):c.272G>C (p.(Gly91Ala)) - PACS1_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.277G>C r.(?) p.(Gly93Arg) - likely benign g.65838234G>C - PACS1(NM_018026.4):c.277G>C (p.(Gly93Arg)) - PACS1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.306C>A r.(?) p.(Asn102Lys) - VUS g.65838263C>A g.66070792C>A PACS1(NM_018026.3):c.306C>A (p.N102K) - PACS1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.349G>A r.(?) p.(Val117Met) - VUS g.65838306G>A - PACS1(NM_018026.3):c.349G>A (p.(Val117Met)) - PACS1_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.356+17634A>G r.(=) p.(=) - likely benign g.65855947A>G - PACS1(NM_018026.4):c.356+17634A>G - PACS1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.356+34234A>G r.(=) p.(=) - likely benign g.65872547A>G - PACS1(NM_018026.4):c.356+34234A>G - PACS1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.357-5499C>T r.(=) p.(=) - likely benign g.65955458C>T - PACS1(NM_018026.4):c.357-5499C>T - PACS1_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.357-1G>T r.spl? p.? - VUS g.65960956G>T - - - PACS1_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.430G>A r.(?) p.(Ala144Thr) - VUS g.65961030G>A - PACS1(NM_018026.4):c.430G>A (p.A144T) - PACS1_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. 1 - c.490A>G r.(?) p.(Ser164Gly) - likely benign g.65977878A>G - PACS1(NM_018026.4):c.490A>G (p.(Ser164Gly)) - PACS1_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.535-5C>T r.spl? p.? - likely benign g.65978600C>T - PACS1(NM_018026.3):c.535-5C>T (p.?) - PACS1_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 2 - c.535-4G>A r.spl? p.? - likely benign g.65978601G>A g.66211130G>A PACS1(NM_018026.3):c.535-4G>A (p.?) - PACS1_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
?/. 1 - c.553C>T r.(?) p.(Arg185*) - VUS g.65978623C>T - PACS1(NM_018026.4):c.553C>T (p.(Arg185*)) - PACS1_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.589A>G r.(?) p.(Arg197Gly) - VUS g.65978659A>G - - - PACS1_000028 - - - - Unknown - - - - - MobiDetails
+/., ./. 19 - c.607C>T r.(?) p.(Arg203Trp) ACMG pathogenic, pathogenic (dominant) g.65978677C>T g.66211206C>T PACS1(NM_018026.3):c.607C>T (p.R203W, p.(Arg203Trp)), PACS1(NM_018026.4):c.607C>T (p.R203W) - PACS1_000001 variants reported seperately, unknown if mono-allelic or bi-allelic, 1 more item PubMed: DDDS 2015, Journal: DDDS 2015, PubMed: Helbig 2016, PubMed: Hong 2020, PubMed: Retterer 2016, 2 more items - rs398123009 CLASSIFICATION record, De novo, Germline, Unknown - - - - - Johan den Dunnen, VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_VUmc, MobiDetails
-?/. 1 - c.637G>A r.(?) p.(Val213Met) - likely benign g.65978707G>A g.66211236G>A PACS1(NM_018026.3):c.637G>A (p.(Val213Met)) - PACS1_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 2 - c.661-5C>G r.spl? p.? - likely benign g.65983585C>G g.66216114C>G PACS1(NM_018026.3):c.661-5C>G (p.?) - PACS1_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
?/. 1 - c.661-1G>C r.spl? p.? - VUS g.65983589G>C - PACS1(NM_018026.3):c.661-1G>C - PACS1_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.742A>C r.(?) p.(Ile248Leu) - likely benign g.65983671A>C g.66216200A>C - - PACS1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.939G>C r.(?) p.(Lys313Asn) - likely benign g.65984207G>C - PACS1(NM_018026.3):c.939G>C (p.(Lys313Asn)) - PACS1_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.978+359C>T r.(=) p.(=) - VUS g.65984605C>T - PACS1(NM_018026.4):c.978+359C>T - PACS1_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1003G>A r.(?) p.(Val335Met) - VUS g.65987241G>A - PACS1(NM_018026.4):c.1003G>A (p.(Val335Met)) - PACS1_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1066C>T r.(?) p.(Arg356Cys) - likely benign g.65988129C>T - PACS1(NM_018026.4):c.1066C>T (p.(Arg356Cys)) - PACS1_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 2 - c.1067G>A r.(?) p.(Arg356His) - VUS g.65988130G>A g.66220659G>A PACS1(NM_018026.3):c.1067G>A (p.(Arg356His)), PACS1(NM_018026.4):c.1067G>A (p.R356H) - PACS1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen
-?/. 1 - c.1098G>C r.(?) p.(Leu366Phe) - likely benign g.65988161G>C g.66220690G>C PACS1(NM_018026.3):c.1098G>C (p.(Leu366Phe)) - PACS1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1238C>T r.(?) p.(Thr413Met) - VUS g.65988663C>T - PACS1(NM_018026.4):c.1238C>T (p.T413M) - PACS1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.1259G>T r.(?) p.(Ser420Ile) - VUS g.65988684G>T g.66221213G>T PACS1(NM_018026.3):c.1259G>T (p.S420I) - PACS1_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1269C>A r.(?) p.(Ser423Arg) - VUS g.65988694C>A - PACS1(NM_018026.3):c.1269C>A (p.(Ser423Arg)) - PACS1_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1294-217G>A r.(=) p.(=) - likely benign g.65994758G>A - PACS1(NM_018026.4):c.1294-217G>A - PACS1_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1375-200C>G r.(=) p.(=) - likely benign g.65997819C>G - PACS1(NM_018026.4):c.1375-200C>G - PACS1_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1408A>G r.(?) p.(Ser470Gly) - likely benign g.65998052A>G - PACS1(NM_018026.4):c.1408A>G (p.(Ser470Gly)) - PACS1_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1489A>C r.(?) p.(Ser497Arg) - VUS g.65998133A>C - PACS1(NM_018026.4):c.1489A>C (p.(Ser497Arg)) - PACS1_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1586C>G r.(?) p.(Ser529Cys) - VUS g.65998371C>G - PACS1(NM_018026.3):c.1586C>G (p.(Ser529Cys)) - PACS1_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1595A>G r.(?) p.(Glu532Gly) - VUS g.65998380A>G - PACS1(NM_018026.4):c.1595A>G (p.(Glu532Gly)) - PACS1_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1612G>A r.(?) p.(Gly538Ser) - likely benign g.65998397G>A - PACS1(NM_018026.3):c.1612G>A (p.(Gly538Ser)) - PACS1_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1732-3C>T r.spl? p.? - likely benign g.66000428C>T - - - PACS1_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.1876G>T r.(?) p.(Val626Leu) - VUS g.66001293G>T - PACS1(NM_018026.4):c.1876G>T (p.(Val626Leu)) - PACS1_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.1993+8C>T r.(=) p.(=) - benign g.66001418C>T g.66233947C>T - - PACS1_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.2020G>C r.(?) p.(Gly674Arg) - VUS g.66001629G>C - PACS1(NM_018026.4):c.2020G>C (p.(Gly674Arg)) - PACS1_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.2029G>A r.(?) p.(Asp677Asn) - VUS g.66001638G>A - PACS1(NM_018026.3):c.2029G>A (p.(Asp677Asn)) - PACS1_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.2116G>A r.(?) p.(Val706Met) - VUS g.66002783G>A - PACS1(NM_018026.4):c.2116G>A (p.(Val706Met)) - PACS1_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.2207+10A>T r.(=) p.(=) - likely benign g.66002884A>T - PACS1(NM_018026.4):c.2207+10A>T - PACS1_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.2220C>G r.(?) p.(Asp740Glu) - VUS g.66003381C>G - PACS1(NM_018026.3):c.2220C>G (p.(Asp740Glu)) - PACS1_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.2239C>T r.(?) p.(Pro747Ser) - VUS g.66003400C>T - PACS1(NM_018026.4):c.2239C>T (p.(Pro747Ser)) - PACS1_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.2250+1G>T r.spl? p.? - VUS g.66003412G>T - - - PACS1_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.2250+431C>T r.(=) p.(=) - likely benign g.66003842C>T - PACS1(NM_018026.4):c.2250+431C>T - PACS1_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.2293+6G>C r.(=) p.(=) - benign g.66006323G>C g.66238852G>C - - PACS1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.2579G>A r.(?) p.(Arg860His) - VUS g.66009047G>A - PACS1(NM_018026.3):c.2579G>A (p.(Arg860His)) - PACS1_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.2593G>C r.(?) p.(Gly865Arg) - likely benign g.66009061G>C - PACS1(NM_018026.4):c.2593G>C (p.G865R) - PACS1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.2777-3T>C r.spl? p.? - benign g.66010633T>C g.66243162T>C - - PACS1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.2888_2889insTGTCTC r.(?) p.(*964Valext*2) - VUS g.66010747_66010748insTGTCTC - PACS1(NM_018026.4):c.2888_2889insTGTCTC (p.(Thr963_*964insValSer)) - PACS1_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*103C>T r.(=) p.(=) - VUS g.66010854C>T - PACS1(NM_018026.4):c.*103C>T - PACS1_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.