Unique variants in the PAH gene

Information The variants shown are described using the NM_000277.1 transcript reference sequence.

181 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 1 - c.-81C>T r.(?) p.(=) - likely benign g.103310989G>A g.102917211G>A - - PAH_000172 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.1A>G r.(?) p.(Met1?) - pathogenic g.103310908T>C g.102917130T>C - - PAH_000178 1 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs62514891 Germline - 1/2795 individuals - - - Mohammed Faruq
+/. 4 - c.1A>T r.(?) p.? - pathogenic (recessive) g.103310908T>A g.102917130T>A - - PAH_000217 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - Germline - - - - - Liliana Fernández
+/. 1 1 c.23del r.(?) p.(Asn8Thrfs*30) ACMG pathogenic (recessive) g.103310889del g.102917111del - - PAH_000192 - - - - Unknown - 1/142 patients - - - Liliana Fernández
-?/. 1 - c.30C>G r.(?) p.(Gly10=) - likely benign g.103310879G>C g.102917101G>C PAH(NM_000277.1):c.30C>G (p.G10=) - PAH_000142 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.47_48del r.(?) p.(Ser16Ter) - pathogenic g.103310865_103310866del g.102917087_102917088del PAH(NM_000277.1):c.46_47delCT (p.S16*) - PAH_000141 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 27 - c.60+5G>T r.spl, r.spl? p.? - pathogenic, pathogenic (recessive) g.103310844C>A g.102917066C>A PAH(NM_000277.3):c.60+5G>T - PAH_000139 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Utrecht, Liliana Fernández
-/. 2 - c.60+62C>T r.(=) p.(=) - benign g.103310787G>A g.102917009G>A PAH(NM_000277.3):c.60+62C>T - PAH_000167 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-/. 1 - c.61-907T>C r.(=) p.(=) - benign g.103307583A>G g.102913805A>G PAH(NM_000277.3):c.61-907T>C - PAH_000138 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 1 - c.116_118del r.(?) p.(Phe39del) - pathogenic (recessive) g.103306622_103306624del g.102912844_102912846del - - PAH_000216 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - Germline - - - - - Liliana Fernández
+/. 3 - c.117C>G r.(?) p.(Phe39Leu) - pathogenic (recessive) g.103306620G>C g.102912842G>C - - PAH_000182 - PubMed: Roman 2020, Journal: Roman 2020, PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - Germline - - - - - Johan den Dunnen, Liliana Fernández
+/. 1 - c.142T>C r.(?) p.(Leu48=) - pathogenic g.103306595A>G g.102912817A>G PAH(NM_000277.1):c.142T>C (p.L48=) - PAH_000137 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.143T>C r.(?) p.(Leu48Ser) - pathogenic g.103306594A>G g.102912816A>G PAH(NM_000277.3):c.143T>C (p.L48S) - PAH_000136 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/., ?/. 3 - c.158G>A r.(?) p.(Arg53His) - pathogenic, VUS g.103306579C>T g.102912801C>T PAH(NM_000277.1):c.158G>A (p.R53H) - PAH_000134 13 heterozygous, no homozygous; Clinindb (India), VKGL data sharing initiative Nederland PubMed: Narang 2020, Journal: Narang 2020 - rs118092776 CLASSIFICATION record, Germline - 13/2795 individuals - - - VKGL-NL_Rotterdam, Belen Perez, Mohammed Faruq
+?/. 1 - c.162A>T r.(?) p.(Leu54Phe) - likely pathogenic g.103306575T>A g.102912797T>A - - PAH_000170 - - - - Germline - - - - - Ana Chiesa
+/. 2 - c.165del r.(?) p.(Phe55LeufsTer6) - pathogenic (recessive) g.103306574del g.102912796del - - PAH_000215 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - Germline - - - - - Liliana Fernández
+/. 1 - c.165T>G r.(?) p.(Phe55Leu) - pathogenic (recessive) g.103306572A>C g.102912794A>C - - PAH_000214 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - Germline - - - - - Liliana Fernández
+/. 2 - c.168+5G>C r.spl, r.spl? p.? - pathogenic, pathogenic (recessive) g.103306564C>G g.102912786C>G PAH(NM_000277.3):c.168+5G>C - PAH_000132 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Utrecht, Liliana Fernández
-/. 3 - c.168+19T>C r.(=) p.(=) - benign g.103306550A>G g.102912772A>G PAH(NM_000277.3):c.168+19T>C - PAH_000130 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
+/., +?/. 12 - c.194T>C r.(?) p.(Ile65Thr) - likely pathogenic, likely pathogenic (recessive), pathogenic, pathogenic (recessive) g.103288671A>G g.102894893A>G PAH(NM_000277.3):c.194T>C (p.I65T) - PAH_000145 VKGL data sharing initiative Nederland PubMed: Roman 2020, Journal: Roman 2020, PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - CLASSIFICATION record, Germline - - - - - Johan den Dunnen, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, Alejandro Brea-Fernández, Liliana Fernández
+/. 4 - c.204A>T r.(?) p.(Arg68Ser) - pathogenic, pathogenic (recessive) g.103288661T>A g.102894883T>A PAH(NM_000277.3):c.204A>T (p.R68S) - PAH_000128 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Utrecht, Liliana Fernández
+/. 4 - c.208_210del r.(?) p.(Ser70del) - pathogenic (recessive) g.103288657_103288659del g.102894879_102894881del - - PAH_000191 - PubMed: Jin 2021, PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - Germline yes - - - - Johan den Dunnen, Liliana Fernández
?/. 1 - c.212G>A r.(?) p.(Arg71His) - VUS g.103288653C>T g.102894875C>T - - PAH_000177 conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs62508695 Germline - 1/2795 individuals - - - Mohammed Faruq
+/. 1 - c.223G>A r.(?) p.(Asp75Asn) - pathogenic g.103288642C>T g.102894864C>T PAH(NM_000277.3):c.223G>A (p.D75N) - PAH_000127 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/., +?/. 3 - c.261C>A r.(?) p.(Ser87Arg) - likely pathogenic, pathogenic g.103288604G>T g.102894826G>T PAH(NM_000277.1):c.261C>A (p.S87R), PAH(NM_000277.3):c.261C>A (p.S87R) - PAH_000166 1 heterozygous, no homozygous; Clinindb (India), VKGL data sharing initiative Nederland PubMed: Narang 2020, Journal: Narang 2020 - rs62516151 CLASSIFICATION record, Germline - 1/2795 individuals - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, Mohammed Faruq
+/. 1 - c.284_286del r.(?) p.(Ile95del) - pathogenic (recessive) g.103288579_103288581del - - - PAH_000181 - PubMed: Roman 2020, Journal: Roman 2020 - - Germline - - - - - Johan den Dunnen
-?/. 1 - c.289A>C r.(?) p.(Ile97Leu) - likely benign g.103288576T>G g.102894798T>G PAH(NM_000277.1):c.289A>C (p.I97L) - PAH_000165 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.293T>C r.(?) p.(Leu98Ser) - pathogenic g.103288572A>G g.102894794A>G PAH(NM_000277.3):c.293T>C (p.L98S) - PAH_000126 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.299A>G r.(?) p.(His100Arg) - likely benign g.103288566T>C g.102894788T>C PAH(NM_000277.1):c.299A>G (p.H100R) - PAH_000164 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 - c.311C>A r.(?) p.(Ala104Asp) - pathogenic g.103288554G>T g.102894776G>T PAH(NM_000277.3):c.311C>A (p.A104D) - PAH_000123 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
+/. 1 - c.320A>C r.(?) p.(His107Pro) - pathogenic g.103288545T>G g.102894767T>G PAH(NM_000277.3):c.320A>C (p.H107P) - PAH_000122 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 2 - c.331C>T r.(?) p.(Arg111Ter) - pathogenic g.103288534G>A g.102894756G>A PAH(NM_000277.3):c.331C>T (p.R111*) - PAH_000121 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-/. 1 - c.353-22C>T r.(=) p.(=) - benign g.103271350G>A g.102877572G>A - - PAH_000163 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.355C>T r.(?) p.(Pro119Ser) - pathogenic g.103271326G>A g.102877548G>A PAH(NM_000277.3):c.355C>T (p.P119S) - PAH_000119 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+?/. 1 - c.385G>T r.(?) p.(Asp129Tyr) - likely pathogenic g.103271296C>A g.102877518C>A - - PAH_000176 2 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs199475606 Germline - 2/2795 individuals - - - Mohammed Faruq
+/. 2 - c.439C>T r.(?) p.(Pro147Ser) - pathogenic (recessive) g.103271242G>A g.102877464G>A - - PAH_000213 - 1 more item - - Germline - - - - - Liliana Fernández
+/., ?/? 2 4i c.441+1G>A r.spl? p.? - pathogenic g.103271239C>T g.102877461C>T PAH(NM_000277.3):c.441+1G>A - PAH_000009 VKGL data sharing initiative Nederland PubMed: Sterl 2013 - - CLASSIFICATION record, Unknown yes - - - - Johan den Dunnen, VKGL-NL_Utrecht
+/., +?/. 13 - c.441+5G>T r.spl, r.spl? p.? - likely pathogenic, pathogenic (recessive) g.103271235C>A g.102877457C>A - - PAH_000144 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Nijmegen, Liliana Fernández
+/. 1 - c.442-5C>G r.spl? p.? - pathogenic g.103260446G>C g.102866668G>C PAH(NM_000277.3):c.442-5C>G - PAH_000162 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+?/. 1 - c.451del r.(?) p.(Asp151Ilefs*44) - likely pathogenic g.103260432del g.102866654del 451delG - PAH_000168 - - - - Germline - - - - - Ana Chiesa
+/. 1 - c.472C>T r.(?) p.(Arg158Trp) - pathogenic (recessive) g.103260411G>A g.102866633G>A - - PAH_000212 - 1 more item - - Germline - - - - - Liliana Fernández
+/. 4 - c.473G>A r.(?) p.(Arg158Gln) - pathogenic, pathogenic (recessive) g.103260410C>T g.102866632C>T PAH(NM_000277.1):c.473G>A (p.R158Q), PAH(NM_000277.3):c.473G>A (p.R158Q) - PAH_000115 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, Liliana Fernández
-/., ?/. 3 - c.500A>G r.(?) p.(Asn167Ser) - benign, VUS g.103260383T>C g.102866605T>C PAH(NM_000277.1):c.500A>G (p.N167S) - PAH_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - Gerard C.P. Schaafsma, VKGL-NL_Rotterdam
?/. 1 - c.505C>G r.(?) p.(Arg169Gly) - VUS g.103260378G>C g.102866600G>C PAH(NM_000277.3):c.505C>G (p.R169G) - PAH_000114 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 2 - c.506G>A r.(?) p.(Arg169His) - VUS g.103260377C>T g.102866599C>T PAH(NM_000277.1):c.506G>A (p.R169H) - PAH_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
+/. 4 - c.508C>G r.(?) p.(His170Asp) - pathogenic (recessive) g.103260375G>C g.102866597G>C - - PAH_000211 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - Germline - - - - - Liliana Fernández
+/. 1 - c.511G>C r.(?) p.(Gly171Arg) - pathogenic g.103249109C>G g.102855331C>G - - PAH_000147 - - - - Germline - - - - - Belen Perez
?/. 1 - c.521T>A r.(?) p.(Ile174Asn) - VUS g.103249099A>T g.102855321A>T PAH(NM_000277.3):c.521T>A (p.I174N) - PAH_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.521T>C r.(?) p.(Ile174Thr) - pathogenic g.103249099A>G g.102855321A>G PAH(NM_000277.3):c.521T>C (p.I174T) - PAH_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 3 - c.526C>T r.(?) p.(Arg176Ter) - pathogenic, pathogenic (recessive) g.103249094G>A g.102855316G>A PAH(NM_000277.1):c.526C>T (p.R176*), PAH(NM_000277.3):c.526C>T (p.R176*) - PAH_000108 VKGL data sharing initiative Nederland 1 more item - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, Liliana Fernández
+/. 1 - c.527G>T r.(?) p.(Arg176Leu) - pathogenic (recessive) g.103249093C>A g.102855315C>A - - PAH_000210 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - Germline - - - - - Liliana Fernández
+/. 7 - c.533A>G r.(?) p.(Glu178Gly) - pathogenic, pathogenic (recessive) g.103249087T>C g.102855309T>C PAH(NM_000277.1):c.533A>G (p.E178G), PAH(NM_000277.3):c.533A>G (p.E178G) - PAH_000107 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, Liliana Fernández
+/. 1 - c.560G>A r.(?) p.(Trp187Ter) - pathogenic g.103249060C>T g.102855282C>T PAH(NM_000277.1):c.560G>A (p.W187*) - PAH_000106 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 4 - c.561G>A r.(?) p.(Trp187Ter) - pathogenic g.103249059C>T g.102855281C>T PAH(NM_000277.1):c.561G>A (p.W187*), PAH(NM_000277.3):c.561G>A (p.W187*) - PAH_000105 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
+/. 1 - c.569T>C r.(?) p.(Val190Ala) - pathogenic g.103249051A>G g.102855273A>G PAH(NM_000277.3):c.569T>C (p.V190A) - PAH_000104 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.578C>T r.(?) p.(Thr193Ile) - pathogenic g.103249042G>A g.102855264G>A PAH(NM_000277.3):c.578C>T (p.T193I) - PAH_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 2 - c.592_613del r.(?) p.(Tyr198Serfs*136) - pathogenic g.103249009_103249030del g.102855231_102855252del 592_613del22, 592_613delTATAAAACCCATGCTTGCTATG - PAH_000146 - - - - Germline - - - - - Belen Perez
+/. 1 - c.608G>A r.(?) p.(Cys203Tyr) - pathogenic g.103249012C>T g.102855234C>T PAH(NM_000277.3):c.608G>A (p.C203Y) - PAH_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.609C>T r.(?) p.(Cys203=) - likely benign g.103249011G>A - PAH(NM_001354304.1):c.609C>T (p.C203=) - PAH_000219 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 6 c.625_626insC r.(?) p.(Ile209Thrfs*6) ACMG pathogenic (recessive) g.103248994_103248995insG g.102855216_102855217insG 625_626insC - PAH_000194 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - Germline - - - - - Liliana Fernández
?/. 1 - c.631C>A r.(?) p.(Pro211Thr) - VUS g.103248989G>T g.102855211G>T PAH(NM_000277.3):c.631C>A (p.P211T) - PAH_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.649T>G r.(?) p.(Cys217Gly) - pathogenic g.103248971A>C g.102855193A>C PAH(NM_000277.3):c.649T>G (p.C217G) - PAH_000100 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.665A>G r.(?) p.(Asp222Gly) - pathogenic g.103248955T>C g.102855177T>C PAH(NM_000277.3):c.665A>G (p.D222G) - PAH_000099 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 3 - c.673C>A r.(?) p.(Pro225Thr) - pathogenic (recessive) g.103248947G>T g.102855169G>T - - PAH_000209 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - Germline - - - - - Liliana Fernández
+/., +?/., ?/. 6 - c.688G>A r.(?) p.(Val230Ile) - likely pathogenic, pathogenic, pathogenic (recessive), VUS g.103248932C>T g.102855154C>T PAH(NM_000277.3):c.688G>A (p.V230I), PAH(NM_001354304.1):c.688G>A (p.V230I) - PAH_000006 3 heterozygous, no homozygous; Clinindb (India), VKGL data sharing initiative Nederland PubMed: Narang 2020, Journal: Narang 2020, PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - rs62516152 CLASSIFICATION record, Germline - 3/2795 individuals - - - Gerard C.P. Schaafsma, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, Mohammed Faruq, Liliana Fernández
+/. 1 - c.691T>C r.(?) p.(Ser231Pro) - pathogenic g.103248929A>G g.102855151A>G PAH(NM_000277.3):c.691T>C (p.S231P) - PAH_000097 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.692C>T r.(?) p.(Ser231Phe) - pathogenic g.103248928G>A g.102855150G>A PAH(NM_000277.3):c.692C>T (p.S231F) - PAH_000161 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.694C>T r.(?) p.(Gln232Ter) - pathogenic (recessive) g.103248926G>A g.102855148G>A - - PAH_000190 - PubMed: Jin 2021 - - Germline - - - - - Johan den Dunnen
-/. 1 - c.695A>G r.(?) p.(Gln232Arg) - benign g.103248925T>C g.102855147T>C PAH(NM_000277.1):c.695A>G (p.Q232R) - PAH_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.706+368T>C r.(706_707ins706+335_706+647) p.? - pathogenic (recessive) g.103248546A>G g.102854768A>G - - PAH_000189 1 more item PubMed: Jin 2021 - - Germline - - - - - Johan den Dunnen
+?/. 1 - c.707-12_711del r.spl p.? - likely pathogenic g.103246725_103246741del g.102852947_102852963del 707-12_711del17 - PAH_000169 - - - - Germline - - - - - Ana Chiesa
+/. 1 - c.712A>G r.(?) p.(Thr238Ala) - pathogenic g.103246723T>C g.102852945T>C PAH(NM_000277.3):c.712A>G (p.T238A) - PAH_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.720C>T r.(?) p.(Phe240=) - pathogenic g.103246715G>A g.102852937G>A PAH(NM_000277.1):c.720C>T (p.F240=) - PAH_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 3 - c.721C>T r.(?) p.(Arg241Cys) - pathogenic, pathogenic (recessive) g.103246714G>A g.102852936G>A PAH(NM_000277.3):c.721C>T (p.R241C) - PAH_000160 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen, Liliana Fernández
+/. 6 - c.722G>A r.(?) p.(Arg241His) - pathogenic, pathogenic (recessive) g.103246713C>T g.102852935C>T PAH(NM_000277.3):c.722G>A (p.R241H) - PAH_000090 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Utrecht, Liliana Fernández
+/. 1 - c.722G>T r.(?) p.(Arg241Leu) - pathogenic g.103246713C>A g.102852935C>A PAH(NM_000277.3):c.722G>T (p.R241L) - PAH_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.726C>T r.(?) p.(Leu242=) - pathogenic g.103246709G>A g.102852931G>A PAH(NM_000277.1):c.726C>T (p.L242=) - PAH_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 5 - c.727C>T r.(?) p.(Arg243Ter) - pathogenic, pathogenic (recessive) g.103246708G>A g.102852930G>A PAH(NM_000277.1):c.727C>T (p.R243*), PAH(NM_000277.3):c.727C>T (p.R243*) - PAH_000088 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, Liliana Fernández
+/. 8 - c.728G>A r.(?) p.(Arg243Gln) - pathogenic, pathogenic (recessive) g.103246707C>T g.102852929C>T PAH(NM_000277.3):c.728G>A (p.R243Q) - PAH_000086 VKGL data sharing initiative Nederland PubMed: Jin 2021, PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - CLASSIFICATION record, Germline yes - - - - Johan den Dunnen, VKGL-NL_Utrecht, Liliana Fernández
+/. 1 - c.728G>T r.(?) p.(Arg243Leu) - pathogenic g.103246707C>A g.102852929C>A PAH(NM_000277.3):c.728G>T (p.R243L) - PAH_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/., +?/. 3 - c.734T>C r.(?) p.(Val245Ala) - likely pathogenic, pathogenic g.103246701A>G g.102852923A>G PAH(NM_000277.3):c.734T>C (p.V245A), PAH(NM_001354304.1):c.734T>C (p.V245A) - PAH_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht
-/. 3 - c.735G>A r.(?) p.(Val245=) - benign g.103246700C>T g.102852922C>T PAH(NM_000277.3):c.735G>A (p.V245=) - PAH_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
+/. 1 - c.743T>C r.(?) p.(Leu248Pro) - pathogenic g.103246692A>G g.102852914A>G PAH(NM_000277.3):c.743T>C (p.L248P) - PAH_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 3 - c.754C>T r.(?) p.(Arg252Trp) - pathogenic (recessive) g.103246681G>A g.102852903G>A - - PAH_000208 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - Germline - - - - - Liliana Fernández
+/., ?/. 2 - c.755G>A r.(?) p.(Arg252Gln) - pathogenic, VUS g.103246680C>T g.102852902C>T PAH(NM_000277.3):c.755G>A (p.R252Q) - PAH_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - Gerard C.P. Schaafsma, VKGL-NL_Utrecht
+/. 1 - c.763T>C r.(?) p.(Leu255=) - pathogenic g.103246672A>G g.102852894A>G PAH(NM_000277.1):c.763T>C (p.L255=) - PAH_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.772C>T r.(?) p.(Leu258=) - likely benign g.103246663G>A g.102852885G>A PAH(NM_000277.3):c.772C>T (p.L258=) - PAH_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/. 2 - c.776C>T r.(?) p.(Ala259Val) - likely pathogenic g.103246659G>A g.102852881G>A - - PAH_000175 1 homozygous; Clinindb (India), no heterozygous ; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs118203921 Germline - 0/2795 individuals, 1/2795 individuals - - - Mohammed Faruq
+/. 4 - c.781C>T r.(?) p.(Arg261Ter) - pathogenic, pathogenic (recessive) g.103246654G>A g.102852876G>A PAH(NM_000277.3):c.781C>T (p.R261*) - PAH_000159 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Utrecht, Liliana Fernández
+/. 13 - c.782G>A r.(?) p.(Arg261Gln) - pathogenic, pathogenic (recessive) g.103246653C>T g.102852875C>T PAH(NM_000277.3):c.782G>A (p.R261Q), PAH(NM_001354304.1):c.782G>A (p.R261Q) - PAH_000076 no variant 2nd chromosome, VKGL data sharing initiative Nederland PubMed: Jin 2021, PubMed: Roman 2020, Journal: Roman 2020, 2 more items - - CLASSIFICATION record, Germline - - - - - Johan den Dunnen, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, Liliana Fernández
+/. 2 - c.782G>C r.(?) p.(Arg261Pro) - pathogenic g.103246653C>G g.102852875C>G PAH(NM_000277.3):c.782G>C (p.R261P) - PAH_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
+/. 2 - c.791A>G r.(?) p.(His264Arg) - pathogenic (recessive) g.103246644T>C g.102852866T>C - - PAH_000196 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - Germline - - - - - Liliana Fernández
+/. 6 - c.809G>A r.(?) p.(Arg270Lys) - pathogenic (recessive) g.103246626C>T g.102852848C>T - - PAH_000207 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - Germline - - - - - Liliana Fernández
+/. 5 - c.814G>T r.(?) p.(Gly272*), p.(Gly272Ter) - pathogenic, pathogenic (recessive) g.103246621C>A g.102852843C>A PAH(NM_000277.3):c.814G>T (p.G272*), PAH(NM_001354304.1):c.814G>T (p.G272*) - PAH_000075 VKGL data sharing initiative Nederland PubMed: Roman 2020, Journal: Roman 2020, PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - CLASSIFICATION record, Germline - - - - - Johan den Dunnen, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, Liliana Fernández
-?/. 1 - c.820A>G r.(?) p.(Lys274Glu) - likely benign g.103246615T>C g.102852837T>C PAH(NM_000277.1):c.820A>G (p.(Lys274Glu)) - PAH_000158 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.825C>T r.(?) p.(Pro275=) - likely benign g.103246610G>A g.102852832G>A PAH(NM_000277.3):c.825C>T (p.P275=) - PAH_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 2 - c.829T>G r.(?) p.(Tyr277Asp) - pathogenic, pathogenic (recessive) g.103246606A>C g.102852828A>C PAH(NM_000277.3):c.829T>G (p.Y277D) - PAH_000073 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Utrecht, Liliana Fernández
+/. 2 - c.830A>G r.(?) p.(Tyr277Cys) - pathogenic (recessive) g.103246605T>C g.102852827T>C - - PAH_000206 - PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021 - - Germline - - - - - Liliana Fernández
-?/. 1 - c.837C>T r.(?) p.(Pro279=) - likely benign g.103246598G>A g.102852820G>A PAH(NM_000277.3):c.837C>T (p.P279=) - PAH_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 6 - c.838G>A r.(?) p.(Glu280Lys) - pathogenic, pathogenic (recessive) g.103246597C>T g.102852819C>T PAH(NM_000277.2):c.838G>A (p.E280K), PAH(NM_000277.3):c.838G>A (p.E280K) - PAH_000157 VKGL data sharing initiative Nederland PubMed: Vela-Amieva 2021, Journal: Vela-Amieva 2021, 1 more item - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_VUmc, Liliana Fernández
Legend   How to query   « First ‹ Prev     1 2     Next › Last »