Unique variants in the PHF21A gene

Information The variants shown are described using the NM_001101802.1 transcript reference sequence.

42 entries on 1 page. Showing entries 1 - 42.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. 1 - c.(-1_*1)::[NM_013427.2:(-1_*1)] r.? p.? - pathogenic g.pter_(45955518_46105771)delins[NC_000023.10:pter_(11156982_11682949)] - - t(X;11)(p22.3;p12) PHF21A_000012 - PubMed: Fantes 2008 - - De novo - - - - - Johan den Dunnen
+/. 5 _1_18_ c.0 r.0 p.0 - pathogenic g.(31000000_31009420)_(46204605_46500000)del, g.(33000000_33430130)_(47276580_48000000)del, 3 more items - t(X;11)(q11.1;p11.2)dn del(11)(p11.2p12) del(11)(p11.12p12), del(11)(p11.2p12), del(11)(p11.2p13) PHF21A_000013 11.9 MB deletion, 13.8 Mb deletion, 15.2 Mb deletion, 5.6 Mb deletion, 1 more item PubMed: Hyung-Goo 2012 - - De novo, Germline, Unknown - - - - - Johan den Dunnen
+/. 1 14i c.1449+2321::[NM_001419.2:657-1442] r.? p.? - pathogenic g.[NC_000019.9:pter_8030132]delinspter_45965064 - - t(11;19)(p11.2;p13.2)dn PHF21A_000009 - PubMed: Hyung-Goo 2012 - - DUPLICATE record - - - - - Johan den Dunnen
+/. 1 5i c.153+34607::? r.? p.? - pathogenic (dominant) g.pter_46063697delins[CTCCAAAT;NC_000001.10:106964377_qter] - - t(1;11)(p21.1;p11.2)dn PHF21A_000010 - PubMed: Hyung-Goo 2012 - - De novo - - - - - Johan den Dunnen
+/. 1 5i c.?::insATTTGGAG;153+34610 r.? p.? - pathogenic g.[NC_000001.10:pter_106964376]delins46063698_qter - - t(1;11)(p21.1;p11.2)dn PHF21A_000011 - PubMed: Hyung-Goo 2012 - - DUPLICATE record - - - - - Johan den Dunnen
+/. 1 14i c.[NM_001419.2:657-1435]::1449+2321 r.? p.? - pathogenic (dominant) g.pter_45965069delins[NC_000019.9:pter_8030126] - - t(11;19)(p11.2;p13.2)dn PHF21A_000008 - PubMed: Hyung-Goo 2012 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.270dup r.(?) p.(Pro91Thrfs*82) ACMG pathogenic (dominant) g.46001402dup g.45979851dup - - PHF21A_000031 ACMG: PVS1, PS2_SUP, PM2_SUP; confirmed de novo in trio-exome - - - De novo - - - - - Andreas Laner
+?/. 1 - c.657_658insAA r.(?) p.(Pro220Asnfs*48) - likely pathogenic (dominant) g.45991407_45991408insTT g.45969856_45969857insTT - - PHF21A_000007 - - - - De novo yes - - - - Kohei Hamanaka
+?/. 1 - c.956_959del r.(?) p.(Gln319LeufsTer53) - likely pathogenic g.45986901_45986904del g.45965350_45965353del PHF21A(NM_016621.3):c.959_962del (p.(Gln320LeufsTer53)) - PHF21A_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 - c.961del r.(?) p.(Val321TyrfsTer52) - likely pathogenic g.45986898del g.45965347del PHF21A(NM_016621.3):c.964del (p.(Val322TyrfsTer52)) - PHF21A_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 - c.965dup r.(?) p.(Leu323AlafsTer2) - likely pathogenic g.45986894dup g.45965343dup PHF21A(NM_016621.3):c.968dup (p.(Leu324AlafsTer2)) - PHF21A_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.993+2T>C r.spl? p.? - VUS g.45986864A>G - PHF21A(NM_001101802.2):c.993+2T>C - PHF21A_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. 2 - c.1042A>G r.(?) p.(Thr348Ala) - VUS g.45975128T>C g.45953577T>C PHF21A(NM_001101802.1):c.1042A>G (p.T348A, p.(Thr348Ala)) - PHF21A_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
?/. 1 - c.1144+1G>A r.spl? p.? - VUS g.45971756C>T g.45950205C>T PHF21A(NM_016621.3):c.1147+1G>A (p.?) - PHF21A_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 - c.1144+2T>G r.spl? p.? - likely pathogenic g.45971755A>C - - - PHF21A_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.1220dup r.(?) p.(Glu408Argfs*3) - likely pathogenic (dominant) g.45970958dup g.45949407dup 1223dupC - PHF21A_000006 - - - - De novo yes - - - - Kohei Hamanaka
-?/. 1 - c.1408C>T r.(?) p.(Pro470Ser) - likely benign g.45967432G>A g.45945881G>A PHF21A(NM_001101802.1):c.1408C>T (p.(Pro470Ser)) - PHF21A_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1666A>G r.(?) p.(Ile556Val) - likely benign g.45958060T>C - - - PHF21A_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.1676_1681+15del r.spl? p.? - pathogenic g.45958032_45958052del - PHF21A(NM_001352025.3):c.1679_1684+15delAAGCAGGTAAGGAGTTATCCA - PHF21A_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-/. 1 - c.1682-7_1682-3del r.spl? p.? - benign g.45957311_45957315del - PHF21A(NM_016621.5):c.1544-7_1544-3delTTTTT - PHF21A_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.1682-6_1682-3del r.spl? p.? - benign g.45957312_45957315del g.45935761_45935764del PHF21A(NM_001352025.3):c.1685-6_1685-3delTTTT - PHF21A_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.1682-5_1682-3del r.spl? p.? - likely benign g.45957313_45957315del g.45935762_45935764del PHF21A(NM_001101802.1):c.1682-6_1682-4del (p.?) - PHF21A_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1682-4_1682-3del r.spl? p.? - likely benign g.45957314_45957315del g.45935763_45935764del PHF21A(NM_001101802.1):c.1682-6_1682-5del (p.?) - PHF21A_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1682-3_1682-2del r.spl? p.? - VUS g.45957292_45957293del - PHF21A(NM_001352025.1):c.1685-3_1685-2delTA - PHF21A_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 3 - c.1738C>T r.(?) p.(Arg580*), p.(Arg580Ter) - likely pathogenic, likely pathogenic (dominant) g.45957234G>A g.45935683G>A PHF21A(NM_001101802.2):c.1738C>T (p.R580*), PHF21A(NM_001352025.1):c.1741C>T (p.R581*) - PHF21A_000002 de novo in patient, VKGL data sharing initiative Nederland - - - CLASSIFICATION record, De novo yes - - - - Kohei Hamanaka, VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/., ?/. 2 - c.1810A>G r.(?) p.(Ile604Val) - likely benign, VUS g.45955752T>C g.45934201T>C PHF21A(NM_001101802.1):c.1810A>G (p.I604V), PHF21A(NM_001101802.3):c.1810A>G (p.I604V) - PHF21A_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/. 1 - c.1851G>A r.(?) p.(Lys617=) - likely benign g.45955711C>T g.45934160C>T PHF21A(NM_001101802.1):c.1851G>A (p.K617=) - PHF21A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., ?/. 2 - c.1956del r.(?) p.(Ala653ProfsTer103) - pathogenic, VUS g.45955606del g.45934055del 1 more item - GYLTL1B_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht
-?/. 1 - c.*5259C>T r.(=) p.(=) - likely benign g.45950260G>A g.45928709G>A GYLTL1B(NM_152312.3):c.2030G>A (p.(Arg677His)) - GYLTL1B_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*5265C>T r.(=) p.(=) - VUS g.45950254G>A g.45928703G>A GYLTL1B(NM_152312.3):c.2024G>A (p.(Arg675His)) - GYLTL1B_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.*5774C>T r.(=) p.(=) - likely benign g.45949745G>A g.45928194G>A GYLTL1B(NM_152312.3):c.1772G>A (p.(Arg591Gln)) - GYLTL1B_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*7140G>A r.(=) p.(=) - VUS g.45948379C>T g.45926828C>T GYLTL1B(NM_152312.3):c.1282C>T (p.(Arg428Trp)) - GYLTL1B_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*7146dup r.(?) p.(=) - VUS g.45948379dup g.45926828dup GYLTL1B(NM_152312.3):c.1275_1276insC (p.(Arg428ProfsTer68)) - GYLTL1B_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*7154del r.(?) p.(=) - VUS g.45948366del g.45926815del LARGE2(NM_152312.4):c.1269delA (p.E423Dfs*35) - GYLTL1B_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.*7466G>A r.(=) p.(=) - likely benign g.45948053C>T g.45926502C>T GYLTL1B(NM_152312.3):c.1069C>T (p.(Arg357Cys)) - GYLTL1B_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*7470_*7472del r.(=) p.(=) - VUS g.45948050_45948052del - LARGE2(NM_001300721.2):c.1066_1068delTTC (p.F356del) - GYLTL1B_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.*7746C>G r.(=) p.(=) - VUS g.45947773G>C g.45926222G>C GYLTL1B(NM_152312.3):c.883G>C (p.(Asp295His)) - GYLTL1B_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*7834T>C r.(=) p.(=) - VUS g.45947685A>G g.45926134A>G GYLTL1B(NM_152312.3):c.865A>G (p.(Thr289Ala)) - GYLTL1B_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.*9170G>A r.(=) p.(=) - likely benign g.45946349C>T g.45924798C>T LARGE2(NM_152312.4):c.678C>T (p.I226=) - GYLTL1B_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.*9180G>A r.(=) p.(=) - VUS g.45946339C>T - LARGE2(NM_001300721.2):c.668C>T (p.T223M) - GYLTL1B_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.*9368C>T r.(=) p.(=) - likely benign g.45946151G>A g.45924600G>A GYLTL1B(NM_152312.3):c.587G>A (p.(Arg196His)) - GYLTL1B_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.*9440T>C r.(=) p.(=) - VUS g.45946079A>G g.45924528A>G GYLTL1B(NM_152312.3):c.515A>G (p.(Asn172Ser)) - GYLTL1B_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
Legend   How to query