Unique variants in the PMS2 gene


PMS2 variants classified by the InSiGHT consortium: criteria used for classification are available here. We encourage submission of relevant unpublished information to assist in the classification of variants via LOVD or this template which can be emailed to the curator.
Information The variants shown are described using the NM_000535.6 transcript reference sequence.

1033 entries on 11 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6 7 8 9 10 11     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. 1 5i_6i c.(537+1_538-1)_(705+1_706-1) r.? p? - pathogenic g.(6037055_6038738)_(6038907_6042083)del - - - PMS2_000293 - - - - Germline - - - - - José Luis Soto
-/-, ?/. 2 _1 c.-2559T>A r.(=), r.(?) p.(=) - benign, VUS g.6051209A>T g.6011578A>T - - PMS2_000158 -2472 from transcription start site, Insight class: 1 PubMed: Jeske 2008 - - Germline, SUMMARY record - - - - - InSiGHT - John-Paul Plazzer, Michael Woods
-/-, ?/. 2 _1 c.-2146C>A r.(=), r.(?) p.(=) - benign, VUS g.6050796G>T g.6011165G>T - - PMS2_000136 -2059 from the transcription start site, Insight class: 1 PubMed: Jeske 2008 - - Germline, SUMMARY record - - - - - InSiGHT - John-Paul Plazzer, Michael Woods
?/., ?/? 2 _1 c.-963A>G r.(?) p.(=) - VUS g.6049613T>C g.6009982T>C - - PMS2_000199 Insight class: 3, 1 more item PubMed: Jeske 2008 - - Germline, SUMMARY record - - - - - InSiGHT - John-Paul Plazzer, Michael Woods
?/., ?/? 2 _1 c.-340G>T r.(?) p.(=) - VUS g.6048990C>A g.6009359C>A - - PMS2_000001 Insight class: 3 PubMed: Hendriks 2006 - - Germline, SUMMARY record - - - - - Juul Wijnen, InSiGHT - John-Paul Plazzer
-/-, ?/. 2 _1 c.-323G>T r.(=), r.(?) p.(=) - benign, VUS g.6048973C>A g.6009342C>A - - PMS2_000002 Insight class: 1 PubMed: Hendriks 2006 - - Germline, SUMMARY record - - - - - Juul Wijnen, InSiGHT - John-Paul Plazzer
-/-, ?/. 3 _1 c.-195T>C r.(=), r.(?) p.(=) - benign, VUS g.6048845A>G g.6009214A>G - - PMS2_000003 Insight class: 1 PubMed: Hendriks 2006, PubMed: Thompson 2004 - - Germline, SUMMARY record - - - - - Juul Wijnen, InSiGHT - John-Paul Plazzer, Michael Woods
-/-, -/., ?/. 9 1, _1 c.-154C>G r.(=), r.(?) p.(=) - benign, VUS g.6048804G>C g.6009173G>C - - PMS2_000004 Insight class: 1 contributed by Dept. of Dr Vaccaro, PubMed: Hendriks 2006, PubMed: Thompson 2004 - - Germline, SUMMARY record - - - - - Juul Wijnen, InSiGHT - John-Paul Plazzer, Michael Woods, CEMIC - Genotyping - Angela Solano, Carlos Vaccaro
?/. 1 _1 c.-120del r.(?) p.(=) - VUS g.6048773del g.6009142del - - PMS2_000052 - PubMed: Miyaki 1997 - - Somatic - - - - - Michael Woods
?/., ?/? 2 _1 c.-101A>G r.(?) p.(=) - VUS g.6048751T>C g.6009120T>C - - PMS2_000005 Insight class: 3 PubMed: Hendriks 2006 - - Germline, SUMMARY record - - - - - Juul Wijnen, InSiGHT - John-Paul Plazzer
-/-, -?/. 2 _1 c.-93G>A r.(=), r.(?) p.(=) - benign, likely benign g.6048743C>T g.6009112C>T - - PMS2_000241 allele is trancsribed, Insight class: 1 - - - Germline, SUMMARY record - - - - - Carli Tops, InSiGHT - John-Paul Plazzer
-/., -?/. 3 1 c.-93G>C r.(?) p.(=) - benign, likely benign g.6048743C>G g.6009112C>G PMS2(NM_000535.7):c.-93G>C - PMS2_000448 VKGL data sharing initiative Nederland contributed by Dept. of Dr Vaccaro - - CLASSIFICATION record, Germline - - - - - CEMIC - Genotyping - Angela Solano, VKGL-NL_Nijmegen, VKGL-NL_NKI
-/. 1 - c.-93G>T r.(?) p.(=) - benign g.6048743C>A - - - AIMP2_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/+, +/. 2 1, 1i_2i c.(?_-87)_(23+1_24-1)del r.(?), r.0? p.0?, p.? - pathogenic g.(6045663_6048627)_(6048737_?)del - Deletion of Exon 1 - PMS2_000044 Insight class: 5 PubMed: Senter 2008 - - Germline, SUMMARY record - - - - - InSiGHT - John-Paul Plazzer, Michael Woods
+/+, +/. 3 _1_10i c.(?_-87)_(1144+1_1145-1)del r.(?), r.0? p.0?, p.? - pathogenic g.(6027252_6029430)_(6048737_?)del - del ex01-10, ex01_ex10del - PMS2_000179 Insight class: 5 - - - Germline, SUMMARY record - - - - - InSiGHT - John-Paul Plazzer, Peter Propping, Prof. Dr. med., Beate Dr. Betz
+/. 1 _1_12i c.(?_-87)_(2174+1_2175-1)del r.? p.? - pathogenic g.(6018328_6022454)_(6048737_?)del - c.-87-?_2174+?del/Del exon 1-12 - PMS2_000366 - - - - Germline - - - - - Thomas Hansen
+/. 1 _1_14i c.(?_-87)_(2445+1_2446-1)del r.? p.? - pathogenic g.(6013174_6017218)_(6048737_?)del - c.-87-?_2445+?del /Deletion af exon 1-14 - PMS2_000367 - - - - Germline - - - - - Thomas Hansen
+/+, +/. 10 _1_15_ c.(?_-87)_(*160_?)del r.(?), r.0?, r.? p.0?, p.? - pathogenic g.(?_6012870)_(6048737_?)del - c.1-?_2586+?del Whole gene deletion, del ex 1-15, dupPMS2CL, del ex1_15, Deletion of Exon 1-15, 4 more items - PMS2_000007 Insight class: 5 Mark Jenkins, PubMed: Hendriks 2006, PubMed: Lagerstedt-Robinson 2016, PubMed: van der Klift 2010, 4 more items - - Germline, SUMMARY record - - - - - Kristina Lagerstedt Robinson, Juul Wijnen, Carli Tops, InSiGHT - John-Paul Plazzer, Michael Woods, INSiGHT group, Mark Jenkins
?/. 1 1 c.-77del r.(?) p.(=) - VUS g.6048727del g.6009096del - - PMS2_000374 - - - - Unknown - - - - - Barbara Luisa Soares
-/., ?/. 2 1 c.-53G>A r.(=), r.(?) p.(=) - benign, VUS g.6048703C>T g.6009072C>T c.-53G>A - PMS2_000375 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - Thomas Hansen, VKGL-NL_Nijmegen
-?/. 1 - c.-43A>G r.(?) p.(=) - likely benign g.6048693T>C g.6009062T>C - - AIMP2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.(?_-1)_(903+1_?)del r.0? p.0? - pathogenic g.(?_6035164)_(6048651_?)del g.(?_5995533)_(6009020_?)del c.(1-?)_(903+?)del - PMS2_001066 - Yuen (unpublished) - - Germline - - - - - Jeanette Yuen
+?/. 1 10i_15_ c.(1144+1_1145-1)_*160{0} r.? p.? ACMG likely pathogenic g.(?_5996249)_(6027252_6029430)del g.(?_5956618)_(5987621_5989799)del del ex11-15 - PMS2_000512 deletion PMS2 NG_008466.1(NM_000535.5):c.(1144+1_1145-1)_(*16781_?)del PubMed: Arnold 2020 - - Germline ? - - - - Andreas Laner
+?/. 1 _1_10i c.-87_(1144+1_1145-1){0} r.0? p.0? ACMG likely pathogenic g.(6027252_6029430)_(6078750_?)del g.(5987621_5989799)_(6039119_?)del del ex 1-10 c.(?_-30100)_(144+1_145-1)del - PMS2_001010 - PubMed: Arnold 2020 - - Germline ? - - - - Andreas Laner
+/+?, +/., +?/., ?/. 17 1 c.1A>G r.(?), r.? p.(Met1?), p.0?, p.?, p.Met1Val - likely pathogenic, NA, pathogenic, VUS g.6048650T>C g.6009019T>C c.1A>G, chr7_6048650_T_C, 1 more item - PMS2_000256 ICCON data, Westmead, NSW, VKGL data sharing initiative Nederland, Insight class: 4, 1 more item Ian Berry, Leeds Genetics Laboratory, Mark Jenkins; John Hopper, Mark Jenkins; John Hopper, 3 more items - rs587779333 CLASSIFICATION record, Germline, Germline/De novo (untested), Unknown - 3/53461 controls, 6/60466 cases - - - Arjen Mensenkamp, InSiGHT - John-Paul Plazzer, Michael Woods, INSiGHT group, Gabriel Capella, Ian Berry, Thomas Hansen, VKGL-NL_Rotterdam, Grigorij Yanus, VKGL-NL_Groningen, VKGL-NL_Nijmegen, MobiDetails, BRIDGES consortium
+/., +?/+?, +?/., ?/. 7 1 c.2T>A r.(?), r.? p.(Met1?), p.0?, p.?, p.Met1? ACMG likely pathogenic, NA, pathogenic, VUS g.6048649A>T g.6009018A>T chr7_6048649_A_T, PMS2(NM_000535.7):c.2T>A (p.M1?) - PMS2_000017 VKGL data sharing initiative Nederland, 3 more items PubMed: Dorling 2021, Journal: Dorling 2021, PubMed: Haraldsdottir 2018 - rs587780059 CLASSIFICATION record, Germline ? 2/60466 cases - - - Andreas Laner, VKGL-NL_Groningen, VKGL-NL_Nijmegen, Sigurdis Haraldsdottir, BRIDGES consortium
?/. 2 - c.2T>C r.? p.? - NA g.6048649A>G - chr7_6048649_A_G - PMS2_000995 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls, 1/60466 cases - - - BRIDGES consortium
+?/. 1 1 c.2T>G r.(2T>G) p.(Met1?) ACMG pathogenic g.6048649A>C g.6009018A>C - - PMS2_001072 - - - - Germline ? - - - - Harsh Sheth
+/. 1 1 c.3G>A r.0? p.0? - pathogenic g.6048648C>T g.6009017C>T - - PMS2_000388 - - - - Germline - - - - - Andreas Laner
?/. 1 - c.4dup r.(?) p.(Glu2Glyfs*4) - NA g.6048648dup - chr7_6048646_T_TC - PMS2_000994 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
?/. 1 - c.4G>A r.(?) p.(Glu2Lys) - NA g.6048647C>T - chr7_6048647_C_T - PMS2_000993 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
?/. 1 - c.4G>C r.(?) p.(Glu2Gln) - NA g.6048647C>G - chr7_6048647_C_G - PMS2_000992 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
?/. 1 - c.8G>A r.(?) p.(Arg3Gln) - NA g.6048643C>T - chr7_6048643_C_T - PMS2_000991 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
?/. 3 1 c.11C>G r.(?) p.(Ala4Gly) - NA, VUS g.6048640G>C g.6009009G>C chr7_6048640_G_C - PMS2_000018 Carrier frequency in Iceland (%): 0.04; Odds ratio for CRC (95%CI): 2.64 (0.62-11.2), 1 more item PubMed: Dorling 2021, Journal: Dorling 2021, PubMed: Haraldsdottir 2018 - - Germline - 0.04, 1/53461 controls, 1/60466 cases - - - Sigurdis Haraldsdottir, BRIDGES consortium
?/. 2 - c.20C>G r.(?) p.(Ser7Trp) - NA g.6048631G>C - chr7_6048631_G_C - PMS2_000990 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls, 2/60466 cases - - - BRIDGES consortium
?/. 1 - c.20C>T r.(?) p.(Ser7Leu) - NA g.6048631G>A - chr7_6048631_G_A - PMS2_000989 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
-?/. 1 - c.21G>C r.(?) p.(Ser7=) - likely benign g.6048630C>G g.6008999C>G PMS2(NM_000535.7):c.21G>C (p.S7=) - PMS2_000424 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.22A>C r.(?) p.(Ser8Arg) - VUS g.6048629T>G - - - AIMP2_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.22A>G r.(?) p.(Ser8Gly) - NA g.6048629T>C - chr7_6048629_T_C - PMS2_000988 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
+?/. 1 - c.23+1G>C r.spl? p.? - likely pathogenic g.6048627C>G - PMS2(NM_000535.5):c.23+1G>C (p.?) - AIMP2_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.23+2T>G r.spl? p.? - NA g.6048626A>C - chr7_6048626_A_C - PMS2_000987 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls - - - BRIDGES consortium
-/., -?/. 8 1i c.23+10G>C r.(=) p.(=) - benign, likely benign g.6048618C>G g.6008987C>G c.23+10G>C, PMS2(NM_000535.5):c.23+10G>C (p.(=)), PMS2(NM_000535.7):c.23+10G>C - PMS2_000340 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - Thomas Hansen, VKGL-NL_Leiden, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_VUmc, VKGL-NL_AMC, VKGL-NL_NKI
-/. 1 1i c.23+12T>C r.(=) p.(=) - benign g.6048616A>G g.6008985A>G - - PMS2_000387 - - - - Germline - - - - - Andreas Laner
-?/. 1 - c.23+46C>T r.(=) p.(=) - likely benign g.6048582G>A g.6008951G>A PMS2(NM_000535.5):c.23+46C>T - AIMP2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_NKI
-/., ?/. 13 1i c.23+72C>T r.(=), r.(?) p.(=) - benign, VUS g.6048556G>A g.6008925G>A c.23+72C>T, PMS2(NM_000535.5):c.23+72C>T - PMS2_000423 VKGL data sharing initiative Nederland, 1 more item contributed by Dept. of Dr Vaccaro, InSiGHT, PubMed: Rossi 2017 - - CLASSIFICATION record, Germline - - - - - Mev Dominguez Valentin, CEMIC - Genotyping - Angela Solano, VKGL-NL_NKI, Carlos Vaccaro
+/. 1 - c.24-12_60del r.(?) p.(Ser8_Asn862delinsArgAsnIle) - pathogenic g.6045626_6045674del - PMS2(NM_000535.5):c.24-12_60del (p.?) - AIMP2_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/+, +/. 10 1i_2 c.24-12_107delinsAAAT r.(?), r.24_163del, r.?, r.spl? p.?, p.?/(p.Ser8ArgfsX5), p.Ser8Argfs*5 - pathogenic g.6045579_6045674delinsATTT g.6005948_6006043delinsATTT c.24-12_107delinsAAAT, PMS2:c.24-12_107delinsAAAT - PMS2_000205 96bp deletion acros intron1-exon2 border, 96bp deletion across intron1-exon2 border, 1 more item Carli Tops, Carli Tops, Carli Tops, Carli Tops, Carli Tops, Fiona Lalloo, PubMed: van der Klift 2010 - - Germline, Germline/De novo (untested) - gnomAD: NA - - - Carli Tops, InSiGHT - John-Paul Plazzer, INSiGHT group, Treena Cranston
-?/. 1 - c.24-4C>T r.spl? p.? - likely benign g.6045666G>A - - - AIMP2_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/+, +/. 2 1i_2i c.(23+1_24-1)_(163+1_164-1)del r.(?), r.? p.(Ser8Argfs*5) - pathogenic g.(6043690_6045522)_(6045663_6048627)del - Deletion of Exon 2 - PMS2_000148 Insight class: 5 PubMed: Senter 2008 - - Germline, SUMMARY record - - - - - InSiGHT - John-Paul Plazzer, Michael Woods
+/. 1 - c.(23+1_24-1)_(353+1_354-1)del r.? p.? - pathogenic g.(6042268_6043320)_(6045663_6048627)del - (6048627_6045663)_(6043320_6042268)del - PMS2_001036 - - - - Germline - - - - - Richarda M de Voer
+/. 4 - c.24-?_988+?del r.(?) p.? - pathogenic g.6031604_6045662del - Deletion exons 2–9 - PMS2_000457 1 more item PubMed: Lagerstedt-Robinson 2016 - - Germline - - - - - Kristina Lagerstedt Robinson
-?/. 1 - c.31C>G r.(?) p.(Pro11Ala) - likely benign g.6045655G>C g.6006024G>C - - AIMP2_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.33T>A r.(?) p.(Pro11=) - likely benign g.6045653A>T - - - AIMP2_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.47A>G r.(?) p.(Lys16Arg) - NA g.6045639T>C - chr7_6045639_T_C - PMS2_000986 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
?/. 1 - c.50C>G r.(?) p.(Pro17Arg) - NA g.6045636G>C - chr7_6045636_G_C - PMS2_000985 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
-/., -?/-?, -?/., ?/. 23 2 c.52A>G r.(?) p.(Ile18Val), p.Ile18Val - benign, likely benign, VUS g.6045634T>C g.6006003T>C 780G>C, 780G>C (S260S), 1621G>A (E541K), 780G>C (Ser260Ser), c.354-1G>A + c.52A>G, 2 more items - PMS2_000009 based on population freq, VKGL data sharing initiative Nederland, Insight class: 2, 3 more items Mark Jenkins; John Hopper, Mensenkamp and Ligtenberg, Mensenkamp and Ligtenberg, PubMed: Drost 2013, 3 more items - - CLASSIFICATION record, Germline, SUMMARY record, Unknown - 1.73 - - - Juul Wijnen, Carli Tops, InSiGHT - John-Paul Plazzer, Michael Woods, INSiGHT group, Thomas Hansen, VKGL-NL_Leiden, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_VUmc, VKGL-NL_AMC, VKGL-NL_NKI, Sigurdis Haraldsdottir, Jack Ji
-?/., ?/. 5 2 c.53T>C r.(?) p.(Ile18Thr) - likely benign, NA, VUS g.6045633A>G g.6006002A>G c.53T>C, chr7_6045633_A_G, PMS2(NM_000535.7):c.53T>C (p.I18T) - PMS2_000295 VKGL data sharing initiative Nederland, 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - CLASSIFICATION record, Germline - 13/53461 controls, 8/60466 cases - - - Carli Tops, VKGL-NL_VUmc, VKGL-NL_AMC, BRIDGES consortium
?/. 1 - c.55G>C r.(?) p.(Asp19His) - NA g.6045631C>G - chr7_6045631_C_G - PMS2_000984 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
?/. 1 - c.58C>G r.(?) p.(Arg20Gly) - NA g.6045628G>C - chr7_6045628_G_C - PMS2_000982 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 3/53461 controls - - - BRIDGES consortium
?/. 3 - c.58C>T r.(?) p.(Arg20Trp) - NA, VUS g.6045628G>A - chr7_6045628_G_A, PMS2(NM_000535.5):c.58C>T (p.(Arg20Trp)) - PMS2_000983 VKGL data sharing initiative Nederland, 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - CLASSIFICATION record, Germline - 1/53461 controls, 3/60466 cases - - - VKGL-NL_Leiden, BRIDGES consortium
-/-, -/., -?/., ?/. 50 2 c.59G>A r.(=), r.(?) p.(Arg20Gln), p.Arg20Gln - benign, likely benign, NA, VUS g.6045627C>T g.6005996C>T 1621G>A (E541K), 780G>C (Ser260Ser), c.59G>A, CAG described as Glu (glutamic acid), 3 more items - PMS2_000008 VKGL data sharing initiative Nederland, Insight class: 1, 2 more items contributed by Dept. of Dr Vaccaro, PubMed: Clendenning 2006, PubMed: Drost 2013, PubMed: Viel 1998, 4 more items - rs10254120 CLASSIFICATION record, Germline, In vitro (cloned), SUMMARY record, Unknown - 0.11 - - - Juul Wijnen, InSiGHT - John-Paul Plazzer, Michael Woods, INSiGHT group, Gabriel Capella, Thomas Hansen, CEMIC - Genotyping - Angela Solano, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC, VKGL-NL_NKI, Jack Ji
?/. 1 2 c.59G>C r.(?) p.(Arg20Pro) - VUS g.6045627C>G g.6005996C>G - - PMS2_000372 - - - - Unknown ? - - - - Sira Moreno
+?/. 1 2 c.60_61dup r.(?) p.(Lys21Argfs*14) - likely pathogenic g.6045625_6045626dup g.6005994_6005995dup - - PMS2_000386 - - - - Germline - - - - - Gemeinschaftspraxis für Humangenetik Dresden
?/. 1 - c.64T>C r.(?) p.(Ser22Pro) - NA g.6045622A>G - chr7_6045622_A_G - PMS2_000981 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
?/. 2 - c.82T>C r.(?) p.(Ser28Pro) - NA g.6045604A>G - chr7_6045604_A_G - PMS2_000980 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls, 1/60466 cases - - - BRIDGES consortium
-?/., ?/. 7 2 c.86G>C r.(?) p.(Gly29Ala) - likely benign, NA, VUS g.6045600C>G g.6005969C>G c.86C>G, chr7_6045600_C_G, PMS2(NM_000535.7):c.86G>C (p.G29A) - PMS2_000370 VKGL data sharing initiative Nederland, 4 more items InSiGHT Variant Interpretation Committee April 2016, PubMed: Dorling 2021, Journal: Dorling 2021 - - CLASSIFICATION record, Germline - 48/53461 controls, 70/60466 cases - - - Elke Holinski-Feder, VKGL-NL_Groningen, VKGL-NL_Nijmegen, BRIDGES consortium
?/. 1 - c.89A>G r.(?) p.(Gln30Arg) - NA g.6045597T>C - chr7_6045597_T_C - PMS2_000979 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls - - - BRIDGES consortium
?/. 1 - c.100A>G r.(?) p.(Ser34Gly) - NA g.6045586T>C - chr7_6045586_T_C - PMS2_000978 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls - - - BRIDGES consortium
?/. 2 - c.101G>T r.(?) p.(Ser34Ile) - NA, VUS g.6045585C>A - chr7_6045585_C_A, PMS2(NM_000535.5):c.101G>T (p.(Ser34Ile)) - PMS2_000977 VKGL data sharing initiative Nederland, 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - CLASSIFICATION record, Germline - 5/60466 cases - - - VKGL-NL_Leiden, BRIDGES consortium
?/. 1 - c.103C>G r.(?) p.(Leu35Val) - NA g.6045583G>C - chr7_6045583_G_C - PMS2_000976 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls - - - BRIDGES consortium
?/. 1 - c.106A>C r.(?) p.(Ser36Arg) - NA g.6045580T>G - chr7_6045580_T_G - PMS2_000975 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 4/60466 cases - - - BRIDGES consortium
?/. 1 - c.107G>A r.(?) p.(Ser36Asn) - NA g.6045579C>T - chr7_6045579_C_T - PMS2_000974 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 2/60466 cases - - - BRIDGES consortium
?/. 1 - c.110C>T r.(?) p.(Thr37Ile) - NA g.6045576G>A - chr7_6045576_G_A - PMS2_000973 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls - - - BRIDGES consortium
?/. 1 - c.112G>T r.(?) p.(Ala38Ser) - NA g.6045574C>A - chr7_6045574_C_A - PMS2_000972 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls - - - BRIDGES consortium
?/. 2 - c.113C>T r.(?) p.(Ala38Val) - NA g.6045573G>A - chr7_6045573_G_A - PMS2_000971 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 2/53461 controls, 3/60466 cases - - - BRIDGES consortium
?/. 1 - c.119A>G r.(?) p.(Lys40Arg) - NA g.6045567T>C - chr7_6045567_T_C - PMS2_000970 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls - - - BRIDGES consortium
?/. 1 2 c.122A>C r.(?) p.(Glu41Ala) - VUS g.6045564T>G g.6005933T>G c.122A>C - PMS2_000290 1 more item PubMed: Drost 2013 - - Unknown - - - - - INSiGHT group
?/. 1 - c.128T>C r.(?) p.(Val43Ala) - NA g.6045558A>G - chr7_6045558_A_G - PMS2_000969 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
?/., ?/? 5 2 c.137G>A r.(?) p.(Ser46Asn) - VUS g.6045549C>T g.6005918C>T c.137G>A - PMS2_000060 Insight class: 3, 2 more items PubMed: Drost 2013, PubMed: Jackson 2008, PubMed: Jackson 2008; PubMed: Holter 2011, 1 more item - - Germline, SUMMARY record, Unknown - - - - - InSiGHT - John-Paul Plazzer, Michael Woods, INSiGHT group
+/., +?/+?, +?/., ?/. 40 2 c.137G>T r.(?), r.137g>u p.(Ser46Ile), p.Ser46Ile ACMG likely pathogenic, NA, pathogenic g.6045549C>A g.6005918C>A 161G>T, 780G>C (S260S), 1621G>A (E541K), c.137G>T, chr7_6045549_C_A, 2 more items - PMS2_000061 Gene conversion, ICCON data, Royal Prince Alfred/Liverpool, NSW, ICCON data, Westmead, NSW, 6 more items Ian Berry, Leeds Genetics Laboratory, Gabriel Capell‡ and Ignacio Blanco, Mark Jenkins; John Hopper, 14 more items - rs121434629 CLASSIFICATION record, Germline, Germline/De novo (untested), Unknown - 17/60466 cases, 20/53461 controls, gnomAD: ALL:0.017% - - - Kathleen Claes, Carli Tops, InSiGHT - John-Paul Plazzer, Michael Woods, INSiGHT group, Gabriel Capella, Ian Berry, Demetra Georgiou, Andreas Laner, VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC, ICCon, Treena Cranston, Stephanie Baert-Desurmont, BRIDGES consortium
?/. 2 - c.139C>G r.(?) p.(Leu47Val) - NA g.6045547G>C - chr7_6045547_G_C - PMS2_000968 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 2/53461 controls, 6/60466 cases - - - BRIDGES consortium
?/. 1 2 c.139C>T r.= p.(=) - VUS g.6045547G>A g.6005916G>A p.(Leu47Leu) - PMS2_000298 patient RNA: no effect on splicing. Minigene: no effect on splicing PubMed: van der Klift 2015 - - Unknown - - - - - Carli Tops
?/. 1 - c.149G>T r.(?) p.(Gly50Val) - NA g.6045537C>A - chr7_6045537_C_A - PMS2_000967 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 2/60466 cases - - - BRIDGES consortium
?/. 1 - c.152C>T r.(?) p.(Ala51Val) - VUS g.6045534G>A g.6005903G>A PMS2(NM_000535.7):c.152C>T (p.A51V) - PMS2_000422 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/., ?/. 2 - c.154A>C r.(?) p.(Thr52Pro) - likely benign, NA g.6045532T>G g.6005901T>G chr7_6045532_T_G - PMS2_000442 VKGL data sharing initiative Nederland, 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - CLASSIFICATION record, Germline - 1/60466 cases - - - VKGL-NL_Nijmegen, BRIDGES consortium
?/. 1 - c.161T>C r.(?) p.(Ile54Thr) - NA g.6045525A>G - chr7_6045525_A_G - PMS2_000966 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
?/. 1 - c.163G>C r.(?) p.(Asp55His) - NA g.6045523C>G - chr7_6045523_C_G - PMS2_000965 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls - - - BRIDGES consortium
+/. 1 - c.163+1G>A r.spl? p.? - pathogenic g.6045522C>T - - - AIMP2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/., +?/+? 5 2i c.163+2T>C r.24_163del, r.spl? p.?, p.Ser8Argfs*5 - likely pathogenic, pathogenic g.6045521A>G g.6005890A>G PMS2(NM_000535.5):c.163+2T>C (p.?) - PMS2_000206 VKGL data sharing initiative Nederland, Insight class: 4, 1 more item PubMed: van der Klift 2010, PubMed: van der Klift 2015 - - CLASSIFICATION record, Germline, SUMMARY record - - - - - Carli Tops, InSiGHT - John-Paul Plazzer, VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
+?/. 1 - c.163+4A>G r.spl? p.? - likely pathogenic g.6045519T>C g.6005888T>C - - AIMP2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 2i c.163+5G>A r.spl? p.? - pathogenic g.6045518C>T g.6005887C>T c.163+5G>A - PMS2_000341 - - - - Germline - - - - - Thomas Hansen
?/. 1 - c.163+5G>C r.(?) p.(?) ACMG VUS g.6045518C>G g.6005887C>G - - PMS2_000534 1 more item - - - Germline - - - - - Andreas Laner
+/+, +/. 7 2i_7i c.164-518_803+252delinsCG r.(?), r.164_803del p.? - pathogenic g.6036705_6044207delinsCG g.5997074_6004576delinsCG c.164-518_803+252del7501insCG, del ex 3-7 - PMS2_000208 del ex 3-7, Insight class: 5 Carli Tops, Carli Tops, Carli Tops, Carli Tops, Carli Tops, PubMed: van der Klift 2010 - - Germline, SUMMARY record - - - - - Carli Tops, InSiGHT - John-Paul Plazzer, INSiGHT group
-/., ?/. 16 2i c.164-108G>C r.(=) p.(=) - benign, VUS g.6043797C>G g.6004166C>G PMS2(NM_000535.5):c.164-108G>C - PMS2_000336 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - VKGL-NL_NKI, Jack Ji
+/. 1 - c.164-9A>G r.(=) p.(=) - pathogenic g.6043698T>C - - - PMS2_001019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.164-9_178delinsGATCC r.? p.? - NA g.6043675_6043698delinsGGATC - chr7_6043675_CCTTAAGCTTTAGATCTAGAAAGT_GGATC - PMS2_000961 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/60466 cases - - - BRIDGES consortium
+?/+?, +?/. 3 2i c.164-2A>G r.164_171del, r.spl? p.?, p.Asp55Alafs*2 - likely pathogenic g.6043691T>C g.6004060T>C c.[164-2A>G;384G>A] - PMS2_000244 1 heterozygous, no homozygous; Clinindb (India), Insight class: 4 PubMed: Borras 2013, PubMed: Narang 2020, Journal: Narang 2020 - rs587779324 Germline, SUMMARY record - 1/2795 individuals - - - InSiGHT - John-Paul Plazzer, Gabriel Capella, Mohammed Faruq
+?/., ?/. 2 - c.164-1G>A r.(?), r.spl? p.? - likely pathogenic, NA g.6043690C>T g.6004059C>T chr7_6043690_C_T - PMS2_000466 1 more item PubMed: Baert-Desurmont 2018, PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls - - - Stephanie Baert-Desurmont, BRIDGES consortium
+/., ?/. 4 2i_7i c.(163+1_164-1)_(803+1_804-1)del p.(?), r.(?) p.(?), p.? - pathogenic, VUS g.(6035265_6036956)_(6043690_6045522)del - (6045522_6043690)_(6036956_6035265)del, del ex 3-7 - PMS2_000266 del ex 3-7 Carli Tops, Carli Tops, Carli Tops - - Germline - - - - - INSiGHT group, Richarda M de Voer
?/. 1 - c.164A>T r.(?) p.(Asp55Val) - NA g.6043689T>A - chr7_6043689_T_A - PMS2_000964 1 more item PubMed: Dorling 2021, Journal: Dorling 2021 - - Germline - 1/53461 controls - - - BRIDGES consortium
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6 7 8 9 10 11     Next › Last »


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.