All transcript variants in gene POLG

Information The variants shown are described using the transcript reference sequence.

365 entries on 4 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2 3 4     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. - c.-957del r.(=) p.(=) - VUS g.89878703del g.89335472del - - POLG_000006 c.-200delG - - - Germline - - - 0 - Andreas Laner
-/. - c.-874C>T r.(=) p.(=) - benign g.89878618G>A g.89335387G>A - - POLG_000005 - - - rs182136781 Germline - MAF 0,001 - 0 - Andreas Laner
?/. - c.-3_1del r.(?) p.(Met1?) - VUS g.89876989_89876992del g.89333758_89333761del POLG(NM_002693.2):c.-3_1del (p.?) - POLG_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.32G>A r.(?) p.(Gly11Asp) - VUS g.89876954C>T g.89333723C>T POLG(NM_002693.2):c.32G>A (p.G11D) - POLG_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
?/. - c.32G>A r.(?) p.(Gly11Asp) - VUS g.89876954C>T g.89333723C>T POLG(NM_002693.2):c.32G>A (p.G11D) - POLG_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.47C>T r.(?) p.(Pro16Leu) ACMG VUS g.89876939G>A g.89333708G>A - - POLG_000204 ACMG grading: BP4,PM2 Loke et al. 2019. J Pain Res 27: 1977 - - Germline - - - 0 - Andreas Laner
-?/. - c.125G>A r.(?) p.(Arg42Gln) - likely benign g.89876861C>T g.89333630C>T POLG(NM_002693.2):c.125G>A (p.R42Q) - POLG_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.125_127dup r.(?) p.(Arg42dup) - likely benign g.89876867_89876869dup g.89333636_89333638dup POLG(NM_002693.2):c.125_127dupGGC (p.R42dup) - POLG_000180 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.125_127dup r.(?) p.(Arg42dup) - VUS g.89876867_89876869dup g.89333636_89333638dup POLG(NM_002693.2):c.125_127dupGGC (p.R42dup) - POLG_000180 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.127CAG(8_12) r.(=) p.(gln55(8_12)) - benign g.89876859CAG(8_12) - - - POLG_000004 c.127GCA[8]+[10]+[11]+[12] = c.156-158dupGCA = c.158-159insGCAGCA, GCAs - - rs35424491 Germline - - - 0 - Andreas Laner
-/. - c.127_128insGGCAGC r.(?) p.(Arg42_Gln43insArgGln) - benign g.89876860_89876861insTGCCGC g.89333629_89333630insTGCCGC POLG(NM_002693.2):c.127_128insGGCAGC (p.R42_Q43insRQ) - POLG_000179 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.128A>G r.(?) p.(Gln43Arg) - VUS g.89876858T>C g.89333627T>C POLG(NM_002693.2):c.128A>G (p.Q43R) - POLG_000107 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.134A>G r.(?) p.(Gln45Arg) - benign g.89876852T>C g.89333621T>C - - POLG_000003 - - - - Germline - - - 0 - Andreas Laner
-/. - c.137A>G r.(?) p.(Gln46Arg) - benign g.89876849T>C g.89333618T>C - - POLG_000030 - - - - Germline - - - 0 - Andreas Laner
-?/. - c.138_158dup r.(?) p.(Gln49_Gln55dup) - likely benign g.89876840_89876860dup g.89333609_89333629dup POLG(NM_002693.2):c.138_158dupGCAGCAGCAGCAGCAGCAGCA (p.Q49_Q55dup) - POLG_000192 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.141_158del r.(?) p.(Gln50_Gln55del) - VUS g.89876843_89876860del g.89333612_89333629del POLG(NM_002693.2):c.141_158delGCAGCAGCAGCAGCAGCA (p.Q50_Q55del) - POLG_000098 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.144_158del r.(?) p.(Gln51_Gln55del) - likely benign g.89876846_89876860del g.89333615_89333629del POLG(NM_002693.2):c.144_158delGCAGCAGCAGCAGCA (p.Q51_Q55del) - POLG_000097 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.147_158del r.(?) p.(Gln52_Gln55del) - VUS g.89876849_89876860del g.89333618_89333629del POLG(NM_002693.2):c.147_158delGCAGCAGCAGCA (p.Q52_Q55del) - POLG_000177 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.147_158del r.(?) p.(Gln52_Gln55del) - likely benign g.89876849_89876860del g.89333618_89333629del POLG(NM_002693.2):c.147_158delGCAGCAGCAGCA (p.Q52_Q55del) - POLG_000177 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.150_158del r.(?) p.(Gln53_Gln55del) - likely benign g.89876852_89876860del g.89333621_89333629del POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del) - POLG_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.150_158del r.(?) p.(Gln53_Gln55del) - benign g.89876852_89876860del g.89333621_89333629del POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del) - POLG_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.150_158del r.(?) p.(Gln53_Gln55del) - likely benign g.89876852_89876860del g.89333621_89333629del POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del) - POLG_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.150_158del r.(?) p.(Gln53_Gln55del) - likely benign g.89876852_89876860del g.89333621_89333629del POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del) - POLG_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.150_158dup r.(?) p.(Gln53_Gln55dup) - likely benign g.89876852_89876860dup g.89333621_89333629dup POLG(NM_002693.2):c.150_158dupGCAGCAGCA (p.Q53_Q55dup) - POLG_000178 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.153_158del r.(?) p.(Gln54_Gln55del) - VUS g.89876855_89876860del g.89333624_89333629del - - POLG_000029 - - - - Germline - - - 0 - Andreas Laner
-/. - c.153_158del r.(?) p.(Gln54_Gln55del) - benign g.89876855_89876860del g.89333624_89333629del POLG(NM_001126131.1):c.153_158del (p.(Gln54_Gln55del)), POLG(NM_002693.2):c.153_158delGCAGCA (p.Q54_Q55del) - POLG_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.153_158del r.(?) p.(Gln54_Gln55del) - likely benign g.89876855_89876860del g.89333624_89333629del POLG(NM_001126131.1):c.153_158del (p.(Gln54_Gln55del)), POLG(NM_002693.2):c.153_158delGCAGCA (p.Q54_Q55del) - POLG_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.153_158del r.(?) p.(Gln54_Gln55del) - likely benign g.89876855_89876860del g.89333624_89333629del POLG(NM_001126131.1):c.153_158del (p.(Gln54_Gln55del)), POLG(NM_002693.2):c.153_158delGCAGCA (p.Q54_Q55del) - POLG_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.153_158dup r.(?) p.(Gln54_Gln55dup) - benign g.89876855_89876860dup g.89333624_89333629dup POLG(NM_002693.2):c.125delGinsGGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.147_152dupGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGCA (p...) - POLG_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.153_158dup r.(?) p.(Gln54_Gln55dup) - likely benign g.89876855_89876860dup g.89333624_89333629dup POLG(NM_002693.2):c.125delGinsGGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.147_152dupGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGCA (p...) - POLG_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.153_158dup r.(?) p.(Gln54_Gln55dup) - likely benign g.89876855_89876860dup g.89333624_89333629dup POLG(NM_002693.2):c.125delGinsGGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.147_152dupGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGCA (p...) - POLG_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.153_158dup r.(?) p.(Gln54_Gln55dup) - benign g.89876855_89876860dup g.89333624_89333629dup POLG(NM_002693.2):c.125delGinsGGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.147_152dupGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGCA (p...) - POLG_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.156G>A r.(?) p.(Gln52=) - likely benign g.89876830C>T g.89333599C>T POLG(NM_002693.2):c.156G>A (p.Q52=) - POLG_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.156_158del r.(?) p.(Gln55del) - benign g.89876858_89876860del g.89333627_89333629del POLG(NM_002693.2):c.156_158delGCA (p.Q55del) - POLG_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.156_158del r.(?) p.(Gln55del) - benign g.89876858_89876860del g.89333627_89333629del POLG(NM_002693.2):c.156_158delGCA (p.Q55del) - POLG_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.156_158del r.(?) p.(Gln55del) - benign g.89876858_89876860del g.89333627_89333629del POLG(NM_002693.2):c.156_158delGCA (p.Q55del) - POLG_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
-/. - c.156_158del r.(?) p.(Gln55del) - benign g.89876858_89876860del g.89333627_89333629del POLG(NM_002693.2):c.156_158delGCA (p.Q55del) - POLG_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.156_158del r.(?) p.(Gln55del) - benign g.89876858_89876860del g.89333627_89333629del POLG(NM_002693.2):c.156_158delGCA (p.Q55del) - POLG_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.156_158dup r.(?) p.(Gln55dup) - benign g.89876858_89876860dup g.89333627_89333629dup POLG(NM_001126131.1):c.153_155dup (p.(Gln53dup)), POLG(NM_001126131.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.2):c.125delGinsGGCA (p.Q55dup), P... - POLG_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.156_158dup r.(?) p.(Gln55dup) - likely benign g.89876858_89876860dup g.89333627_89333629dup POLG(NM_001126131.1):c.153_155dup (p.(Gln53dup)), POLG(NM_001126131.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.2):c.125delGinsGGCA (p.Q55dup), P... - POLG_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.156_158dup r.(?) p.(Gln55dup) - benign g.89876858_89876860dup g.89333627_89333629dup POLG(NM_001126131.1):c.153_155dup (p.(Gln53dup)), POLG(NM_001126131.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.2):c.125delGinsGGCA (p.Q55dup), P... - POLG_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.156_158dup r.(?) p.(Gln55dup) - benign g.89876858_89876860dup g.89333627_89333629dup POLG(NM_001126131.1):c.153_155dup (p.(Gln53dup)), POLG(NM_001126131.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.2):c.125delGinsGGCA (p.Q55dup), P... - POLG_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.156_158dup r.(?) p.(Gln55dup) - benign g.89876858_89876860dup g.89333627_89333629dup POLG(NM_001126131.1):c.153_155dup (p.(Gln53dup)), POLG(NM_001126131.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.2):c.125delGinsGGCA (p.Q55dup), P... - POLG_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-/. - c.156_158dup r.(?) p.(Gln55dup) - benign g.89876858_89876860dup g.89333627_89333629dup POLG(NM_001126131.1):c.153_155dup (p.(Gln53dup)), POLG(NM_001126131.2):c.156_158dupGCA (p.Q55dup), POLG(NM_002693.2):c.125delGinsGGCA (p.Q55dup), P... - POLG_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.159_161dup r.(?) p.(Gln55dup) - VUS g.89876827_89876829dup g.89333596_89333598dup - - POLG_000028 - - - - Germline - - - 0 - Andreas Laner
-?/. - c.253G>C r.(?) p.(Glu85Gln) - likely benign g.89876733C>G g.89333502C>G POLG(NM_001126131.1):c.253G>C (p.(Glu85Gln)) - POLG_000172 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.264C>T r.(?) p.(Phe88=) - likely benign g.89876722G>A g.89333491G>A POLG(NM_002693.2):c.264C>T (p.F88=) - POLG_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.264C>T r.(?) p.(Phe88=) - likely benign g.89876722G>A g.89333491G>A POLG(NM_002693.2):c.264C>T (p.F88=) - POLG_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+?/. - c.276_298dup r.(?) p.(Val100GlyfsTer174) - likely pathogenic g.89876690_89876712dup g.89333459_89333481dup POLG(NM_002693.2):c.276_298dupGGAGATGCCTGGCGAGGCCGCGG (p.V100Gfs*174) - POLG_000171 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. - c.293C>T r.(?) p.(Ala98Val) - likely benign g.89876693G>A g.89333462G>A POLG(NM_002693.2):c.293C>T (p.A98V) - POLG_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.488C>T r.(?) p.(Pro163Leu) - VUS g.89876498G>A g.89333267G>A POLG(NM_002693.2):c.488C>T (p.P163L) - POLG_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.488C>T r.(?) p.(Pro163Leu) - VUS g.89876498G>A g.89333267G>A - - POLG_000090 conflicting interpretations of pathogenicity; 4 heterozygous, no homozygous; Clinindb (India) Faruq 2020, submtted - rs752892262 Germline - 4/2777 individuals - 0 - Mohammed Faruq
?/. - c.547G>C r.(?) p.(Glu183Gln) - VUS g.89876439C>G g.89333208C>G - - POLG_000170 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.659+11G>T r.(=) p.(=) - benign g.89876316C>A g.89333085C>A - - POLG_000027 - - - rs3087379 Germline - frequency up to 1,3% - 0 - Andreas Laner
?/. - c.659+46G>C r.(=) p.(=) - VUS g.89876281C>G g.89333050C>G - - POLG_000026 - - - - Germline - - - 0 - Andreas Laner
-/. - c.659+91G>T r.(=) p.(=) - benign g.89876236C>A g.89333005C>A - - POLG_000025 - - - rs2283430 Germline - global frequency uo to 50% - 0 - Andreas Laner
?/. - c.659+161T>C r.(=) p.(=) - VUS g.89876166A>G g.89332935A>G - - POLG_000024 - - - - Germline - - - 0 - Andreas Laner
-?/. - c.678G>C r.(?) p.(Gln226His) - likely benign g.89873489C>G g.89330258C>G POLG(NM_002693.2):c.678G>C (p.Q226H) - POLG_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.678G>C r.(?) p.(Gln226His) - likely benign g.89873489C>G g.89330258C>G POLG(NM_002693.2):c.678G>C (p.Q226H) - POLG_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.693G>C r.(?) p.(Glu231Asp) - likely benign g.89873474C>G g.89330243C>G POLG(NM_001126131.1):c.693G>C (p.(Glu231Asp)) - POLG_000169 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. - c.695G>A r.(?) p.(Arg232His) - pathogenic g.89873472C>T g.89330241C>T - - POLG_000023 - - - - Germline - - - 0 - Andreas Laner
+?/. - c.752C>T r.(?) p.(Thr251Ile) - likely pathogenic g.89873415G>A g.89330184G>A - - POLG_000047 - Castiglioni, submitted - - Germline yes - - 0 - Fabiana Fattori
+?/. - c.752C>T r.(?) p.(Thr251Ile) - likely pathogenic g.89873415G>A g.89330184G>A - - POLG_000047 - Castiglioni, submitted - - Germline - - - 0 - Fabiana Fattori
+/. - c.752C>T r.(?) p.(Thr251Ile) - pathogenic g.89873415G>A g.89330184G>A - - POLG_000046 variant associated with CPEO phenotype - - - Germline - - - 0 - André Militão
+/. - c.752C>T r.(?) p.(Thr251Ile) - pathogenic g.89873415G>A g.89330184G>A - - POLG_000046 - PubMed: Dohrn 2017, Journal: Dohrn 2017 - - Germline - 1/612 cases - 0 - Johan den Dunnen
+/. - c.752C>T r.(?) p.(Thr251Ile) - pathogenic g.89873415G>A g.89330184G>A p.(Val855Leu) - POLG_000046 - PubMed: Dohrn 2017, Journal: Dohrn 2017 - - Germline - 1/612 cases - 0 - Johan den Dunnen
+/. - c.752C>T r.(?) p.(Thr251Ile) - pathogenic g.89873415G>A g.89330184G>A POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000194 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. - c.752C>T r.(?) p.(Thr251Ile) - pathogenic g.89873415G>A g.89330184G>A POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000194 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.752C>T r.(?) p.(Thr251Ile) - pathogenic g.89873415G>A g.89330184G>A POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000194 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - c.752C>T r.(?) p.(Thr251Ile) - pathogenic g.89873415G>A g.89330184G>A POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000194 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.752C>T r.(?) p.(Thr251Ile) - pathogenic g.89873415G>A g.89330184G>A POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000194 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. - c.798G>T r.(?) p.(Val266=) - likely benign g.89873369C>A g.89330138C>A POLG(NM_002693.2):c.798G>T (p.V266=) - POLG_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.798G>T r.(?) p.(Val266=) - likely benign g.89873369C>A g.89330138C>A POLG(NM_002693.2):c.798G>T (p.V266=) - POLG_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.803G>C r.(?) p.(Gly268Ala) - VUS g.89873364C>G g.89330133C>G POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A) - POLG_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.803G>C r.(?) p.(Gly268Ala) - VUS g.89873364C>G g.89330133C>G POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A) - POLG_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.803G>C r.(?) p.(Gly268Ala) - likely benign g.89873364C>G g.89330133C>G POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A) - POLG_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.803G>C r.(?) p.(Gly268Ala) - likely benign g.89873364C>G g.89330133C>G POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A) - POLG_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.803G>C r.(?) p.(Gly268Ala) ACMG likely benign g.89873364C>G g.89330133C>G - - POLG_000087 variant in Cruz 2017. Muscle&Nerve 56: 868 - - rs61752784 Germline - - - 0 - Andreas Laner
?/. - c.803G>C r.(?) p.(Gly268Ala) - VUS g.89873364C>G g.89330133C>G - - POLG_000087 conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; Clinindb (India) Faruq 2020, submtted - rs61752784 Germline - 2/2791 individuals - 0 - Mohammed Faruq
+/. - c.824G>A r.(?) p.(Arg275Gln) - pathogenic (dominant) g.89873343C>T g.89330112C>T - - POLG_000117 - Papuc et al., submitted - - Germline yes - - 0 - Anaïs Begemann
-?/. - c.852C>T r.(?) p.(Ile284=) - likely benign g.89873315G>A g.89330084G>A POLG(NM_002693.2):c.852C>T (p.I284=) - POLG_000168 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.856-5_856-3del r.spl? p.? - likely benign g.89872356_89872358del g.89329125_89329127del POLG(NM_002693.2):c.856-5_856-3delCTC - POLG_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.856-5_856-3del r.spl? p.? - likely benign g.89872356_89872358del g.89329125_89329127del POLG(NM_002693.2):c.856-5_856-3delCTC - POLG_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.856-5_856-3del r.spl? p.? - likely benign g.89872356_89872358del g.89329125_89329127del POLG(NM_002693.2):c.856-5_856-3delCTC - POLG_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - c.911T>G r.(?) p.(Leu304Arg) ACMG pathogenic g.89872286A>C g.89329055A>C - - POLG_000042 - Trujillano et al., submitted - - Germline - - - 0 - Daniel Trujillano
?/. - c.926G>A r.(?) p.(Arg309His) - VUS g.89872271C>T g.89329040C>T POLG(NM_001126131.1):c.926G>A (p.(Arg309His)) - POLG_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.948G>A r.(=) p.(=) - benign g.89872249C>T g.89329018C>T - - POLG_000022 - - - rs17566401 Germline - - - 0 - Andreas Laner
-?/. - c.948G>A r.(?) p.(Lys316=) - likely benign g.89872249C>T g.89329018C>T POLG(NM_001126131.2):c.948G>A (p.K316=), POLG(NM_002693.2):c.948G>A (p.K316=) - POLG_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.948G>A r.(?) p.(Lys316=) - benign g.89872249C>T g.89329018C>T POLG(NM_001126131.2):c.948G>A (p.K316=), POLG(NM_002693.2):c.948G>A (p.K316=) - POLG_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.948G>A r.(?) p.(Lys316=) - likely benign g.89872249C>T g.89329018C>T POLG(NM_001126131.2):c.948G>A (p.K316=), POLG(NM_002693.2):c.948G>A (p.K316=) - POLG_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.948G>A r.(?) p.(Lys316=) - benign g.89872249C>T g.89329018C>T POLG(NM_001126131.2):c.948G>A (p.K316=), POLG(NM_002693.2):c.948G>A (p.K316=) - POLG_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.970C>A r.(?) p.(Pro324Thr) - likely benign g.89872227G>T g.89328996G>T POLG(NM_002693.2):c.970C>A (p.P324T) - POLG_000166 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.970C>A r.(?) p.(Pro324Thr) - VUS g.89872227G>T g.89328996G>T POLG(NM_002693.2):c.970C>A (p.P324T) - POLG_000166 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.970C>A r.(?) p.(Pro324Thr) - likely benign g.89872227G>T g.89328996G>T POLG(NM_002693.2):c.970C>A (p.P324T) - POLG_000166 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.970C>T r.(?) p.(Pro324Ser) - likely benign g.89872227G>A g.89328996G>A POLG(NM_002693.2):c.970C>T (p.P324S) - POLG_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.970C>T r.(?) p.(Pro324Ser) - benign g.89872227G>A g.89328996G>A POLG(NM_002693.2):c.970C>T (p.P324S) - POLG_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.970C>T r.(?) p.(Pro324Ser) - likely benign g.89872227G>A g.89328996G>A POLG(NM_002693.2):c.970C>T (p.P324S) - POLG_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.975C>A r.(?) p.(Pro325=) - - g.89872222G>T - POLG(NM_001126131.2):c.975C>A (p.P325=) - POLG_000206 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. - c.975del r.(?) p.(Thr326GlnfsTer39) - pathogenic g.89872227del g.89328996del POLG(NM_002693.2):c.975delC (p.T326Qfs*39) - POLG_000167 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.1091dup r.(?) p.(Gly365ArgfsTer23) - pathogenic g.89871995dup g.89328764dup POLG(NM_002693.2):c.1091dupT (p.G365Rfs*23) - POLG_000165 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
Legend   « First ‹ Prev     1 2 3 4     Next › Last »