All transcript variants in gene POLG

Information The variants shown are described using the transcript reference sequence.

288 entries on 3 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2 3     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. - c.-3_1del VUS r.(?) p.(=) g.89876989_89876992del - POLG(NM_002693.2):c.-3_1del (p.?) - POLG_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.32G>A VUS r.(?) p.(Gly11Asp) g.89876954C>T - POLG(NM_002693.2):c.32G>A (p.G11D) - POLG_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
?/. - c.32G>A VUS r.(?) p.(Gly11Asp) g.89876954C>T - POLG(NM_002693.2):c.32G>A (p.G11D) - POLG_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.125G>A likely benign r.(?) p.(Arg42Gln) g.89876861C>T - POLG(NM_002693.2):c.125G>A (p.R42Q) - POLG_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.125_127dup likely benign r.(?) p.(Arg42dup) g.89876867_89876869dup - POLG(NM_002693.2):c.125_127dupGGC (p.R42dup) - POLG_000180 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.125_127dup VUS r.(?) p.(Arg42dup) g.89876867_89876869dup - POLG(NM_002693.2):c.125_127dupGGC (p.R42dup) - POLG_000180 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.127_128insGGCAGC benign r.(?) p.(Arg42_Gln43insArgGln) g.89876860_89876861insTGCCGC - POLG(NM_002693.2):c.127_128insGGCAGC (p.R42_Q43insRQ) - POLG_000179 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.128A>G VUS r.(?) p.(Gln43Arg) g.89876858T>C - POLG(NM_002693.2):c.128A>G (p.Q43R) - POLG_000107 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.138_158dup likely benign r.(?) p.(Gln49_Gln55dup) g.89876840_89876860dup - POLG(NM_002693.2):c.138_158dupGCAGCAGCAGCAGCAGCAGCA (p.Q49_Q55dup) - POLG_000192 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.141_158del VUS r.(?) p.(Gln50_Gln55del) g.89876843_89876860del - POLG(NM_002693.2):c.141_158delGCAGCAGCAGCAGCAGCA (p.Q50_Q55del) - POLG_000098 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.144_158del likely benign r.(?) p.(Gln51_Gln55del) g.89876846_89876860del - POLG(NM_002693.2):c.144_158delGCAGCAGCAGCAGCA (p.Q51_Q55del) - POLG_000097 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.147_158del VUS r.(?) p.(Gln52_Gln55del) g.89876849_89876860del - POLG(NM_002693.2):c.147_158delGCAGCAGCAGCA (p.Q52_Q55del) - POLG_000177 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.147_158del likely benign r.(?) p.(Gln52_Gln55del) g.89876849_89876860del - POLG(NM_002693.2):c.147_158delGCAGCAGCAGCA (p.Q52_Q55del) - POLG_000177 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.150_158del benign r.(?) p.(Gln53_Gln55del) g.89876852_89876860del - POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del) - POLG_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.150_158del likely benign r.(?) p.(Gln53_Gln55del) g.89876852_89876860del - POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del) - POLG_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.150_158del likely benign r.(?) p.(Gln53_Gln55del) g.89876852_89876860del - POLG(NM_001126131.1):c.150_158del (p.(Gln53_Gln55del)), POLG(NM_002693.2):c.150_158delGCAGCAGCA (p.Q53_Q55del) - POLG_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.150_158dup likely benign r.(?) p.(Gln53_Gln55dup) g.89876852_89876860dup - POLG(NM_002693.2):c.150_158dupGCAGCAGCA (p.Q53_Q55dup) - POLG_000178 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. - c.153_158del benign r.(?) p.(Gln54_Gln55del) g.89876855_89876860del - POLG(NM_002693.2):c.153_158delGCAGCA (p.Q54_Q55del) - POLG_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.153_158del likely benign r.(?) p.(Gln54_Gln55del) g.89876855_89876860del - POLG(NM_002693.2):c.153_158delGCAGCA (p.Q54_Q55del) - POLG_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.153_158dup benign r.(?) p.(Gln54_Gln55dup) g.89876855_89876860dup - POLG(NM_002693.2):c.125delGinsGGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGCA (p.Q54_Q55dup) - POLG_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.153_158dup likely benign r.(?) p.(Gln54_Gln55dup) g.89876855_89876860dup - POLG(NM_002693.2):c.125delGinsGGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGCA (p.Q54_Q55dup) - POLG_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.153_158dup likely benign r.(?) p.(Gln54_Gln55dup) g.89876855_89876860dup - POLG(NM_002693.2):c.125delGinsGGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGCA (p.Q54_Q55dup) - POLG_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.153_158dup benign r.(?) p.(Gln54_Gln55dup) g.89876855_89876860dup - POLG(NM_002693.2):c.125delGinsGGCAGCA (p.Q54_Q55dup), POLG(NM_002693.2):c.153_158dupGCAGCA (p.Q54_Q55dup) - POLG_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.156G>A likely benign r.(?) p.(=) g.89876830C>T - POLG(NM_002693.2):c.156G>A (p.Q52=) - POLG_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.156_158del benign r.(?) p.(Gln55del) g.89876858_89876860del - POLG(NM_002693.2):c.156_158delGCA (p.Q55del) - POLG_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.156_158del benign r.(?) p.(Gln55del) g.89876858_89876860del - POLG(NM_002693.2):c.156_158delGCA (p.Q55del) - POLG_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.156_158del benign r.(?) p.(Gln55del) g.89876858_89876860del - POLG(NM_002693.2):c.156_158delGCA (p.Q55del) - POLG_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
-/. - c.156_158del benign r.(?) p.(Gln55del) g.89876858_89876860del - POLG(NM_002693.2):c.156_158delGCA (p.Q55del) - POLG_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.156_158del benign r.(?) p.(Gln55del) g.89876858_89876860del - POLG(NM_002693.2):c.156_158delGCA (p.Q55del) - POLG_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.156_158dup benign r.(?) p.(Gln55dup) g.89876858_89876860dup - POLG(NM_001126131.1):c.150_152dup (p.(Gln53dup)), POLG(NM_002693.2):c.125delGinsGGCA (p.Q55dup), POLG(NM_002693.2):c.156_158dupGCA (p.Q55dup) - POLG_000109 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.156_158dup likely benign r.(?) p.(Gln55dup) g.89876858_89876860dup - POLG(NM_001126131.1):c.150_152dup (p.(Gln53dup)), POLG(NM_002693.2):c.125delGinsGGCA (p.Q55dup), POLG(NM_002693.2):c.156_158dupGCA (p.Q55dup) - POLG_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.156_158dup benign r.(?) p.(Gln55dup) g.89876858_89876860dup - POLG(NM_001126131.1):c.150_152dup (p.(Gln53dup)), POLG(NM_002693.2):c.125delGinsGGCA (p.Q55dup), POLG(NM_002693.2):c.156_158dupGCA (p.Q55dup) - POLG_000109 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-/. - c.156_158dup benign r.(?) p.(Gln55dup) g.89876858_89876860dup - POLG(NM_001126131.1):c.150_152dup (p.(Gln53dup)), POLG(NM_002693.2):c.125delGinsGGCA (p.Q55dup), POLG(NM_002693.2):c.156_158dupGCA (p.Q55dup) - POLG_000109 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.253G>C likely benign r.(?) p.(Glu85Gln) g.89876733C>G - POLG(NM_001126131.1):c.253G>C (p.(Glu85Gln)) - POLG_000172 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.264C>T likely benign r.(?) p.(=) g.89876722G>A - POLG(NM_002693.2):c.264C>T (p.F88=) - POLG_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.264C>T likely benign r.(?) p.(=) g.89876722G>A - POLG(NM_002693.2):c.264C>T (p.F88=) - POLG_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+?/. - c.276_298dup likely pathogenic r.(?) p.(Val100Glyfs*174) g.89876690_89876712dup - POLG(NM_002693.2):c.276_298dupGGAGATGCCTGGCGAGGCCGCGG (p.V100Gfs*174) - POLG_000171 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.293C>T likely benign r.(?) p.(Ala98Val) g.89876693G>A - POLG(NM_002693.2):c.293C>T (p.A98V) - POLG_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.488C>T VUS r.(?) p.(Pro163Leu) g.89876498G>A - POLG(NM_002693.2):c.488C>T (p.P163L) - POLG_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.547G>C VUS r.(?) p.(Glu183Gln) g.89876439C>G - - - POLG_000170 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.678G>C likely benign r.(?) p.(Gln226His) g.89873489C>G - POLG(NM_002693.2):c.678G>C (p.Q226H) - POLG_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.678G>C likely benign r.(?) p.(Gln226His) g.89873489C>G - POLG(NM_002693.2):c.678G>C (p.Q226H) - POLG_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.693G>C likely benign r.(?) p.(Glu231Asp) g.89873474C>G - POLG(NM_001126131.1):c.693G>C (p.(Glu231Asp)) - POLG_000169 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 3 c.752C>T - r.(?) p.(Thr251Ile) g.89873415G>A g.89330184G>A - - POLG_000047 - Castiglioni, submitted - - Germline yes - - 0 - Fabiana Fattori
+?/. 3 c.752C>T likely pathogenic r.(?) p.(Thr251Ile) g.89873415G>A g.89330184G>A - - POLG_000047 - Castiglioni, submitted - - Germline - - - 0 - Fabiana Fattori
+/. - c.752C>T - r.(?) p.(Thr251Ile) g.89873415G>A - - - POLG_000046 variant associated with CPEO phenotype - - - Germline - - - 0 - André Militão
+/. - c.752C>T pathogenic r.(?) p.(Thr251Ile) g.89873415G>A - POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. - c.752C>T pathogenic r.(?) p.(Thr251Ile) g.89873415G>A - POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.752C>T VUS r.(?) p.(Thr251Ile) g.89873415G>A - POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. - c.752C>T pathogenic r.(?) p.(Thr251Ile) g.89873415G>A - POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - c.752C>T pathogenic r.(?) p.(Thr251Ile) g.89873415G>A - POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.752C>T pathogenic r.(?) p.(Thr251Ile) g.89873415G>A - POLG(NM_002693.2):c.752C>T (p.T251I) - POLG_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. - c.798G>T likely benign r.(?) p.(=) g.89873369C>A - POLG(NM_002693.2):c.798G>T (p.V266=) - POLG_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.798G>T likely benign r.(?) p.(=) g.89873369C>A - POLG(NM_002693.2):c.798G>T (p.V266=) - POLG_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.803G>C VUS r.(?) p.(Gly268Ala) g.89873364C>G - POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A) - POLG_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.803G>C VUS r.(?) p.(Gly268Ala) g.89873364C>G - POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A) - POLG_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
?/. - c.803G>C VUS r.(?) p.(Gly268Ala) g.89873364C>G - POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A) - POLG_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.803G>C likely benign r.(?) p.(Gly268Ala) g.89873364C>G - POLG(NM_001126131.1):c.803G>C (p.(Gly268Ala)), POLG(NM_002693.2):c.803G>C (p.G268A) - POLG_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
+/. - c.824G>A - r.(?) p.(Arg275Gln) g.89873343C>T - - - POLG_000117 - Papuc et al., submitted - - Germline yes - - 0 - Anaïs Begemann
-?/. - c.852C>T likely benign r.(?) p.(=) g.89873315G>A - POLG(NM_002693.2):c.852C>T (p.I284=) - POLG_000168 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.856-5_856-3del likely benign r.spl? p.? g.89872356_89872358del - POLG(NM_002693.2):c.856-5_856-3delCTC - POLG_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.856-5_856-3del likely benign r.spl? p.? g.89872356_89872358del - POLG(NM_002693.2):c.856-5_856-3delCTC - POLG_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.856-5_856-3del likely benign r.spl? p.? g.89872356_89872358del - POLG(NM_002693.2):c.856-5_856-3delCTC - POLG_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - c.911T>G ACMG: 5 r.(?) p.(Leu304Arg) g.89872286A>C g.89329055A>C - - POLG_000042 - Trujillano et al., submitted - - Germline - - - 0 - Daniel Trujillano
?/. - c.926G>A VUS r.(?) p.(Arg309His) g.89872271C>T - POLG(NM_001126131.1):c.926G>A (p.(Arg309His)) - POLG_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.948G>A likely benign r.(?) p.(=) g.89872249C>T - POLG(NM_001126131.2):c.948G>A (p.K316=), POLG(NM_002693.2):c.948G>A (p.K316=) - POLG_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.948G>A benign r.(?) p.(=) g.89872249C>T - POLG(NM_001126131.2):c.948G>A (p.K316=), POLG(NM_002693.2):c.948G>A (p.K316=) - POLG_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.948G>A likely benign r.(?) p.(=) g.89872249C>T - POLG(NM_001126131.2):c.948G>A (p.K316=), POLG(NM_002693.2):c.948G>A (p.K316=) - POLG_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.948G>A benign r.(?) p.(=) g.89872249C>T - POLG(NM_001126131.2):c.948G>A (p.K316=), POLG(NM_002693.2):c.948G>A (p.K316=) - POLG_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.970C>A likely benign r.(?) p.(Pro324Thr) g.89872227G>T - POLG(NM_002693.2):c.970C>A (p.P324T) - POLG_000166 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.970C>A VUS r.(?) p.(Pro324Thr) g.89872227G>T - POLG(NM_002693.2):c.970C>A (p.P324T) - POLG_000166 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.970C>A likely benign r.(?) p.(Pro324Thr) g.89872227G>T - POLG(NM_002693.2):c.970C>A (p.P324T) - POLG_000166 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.970C>T likely benign r.(?) p.(Pro324Ser) g.89872227G>A - POLG(NM_002693.2):c.970C>T (p.P324S) - POLG_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.970C>T benign r.(?) p.(Pro324Ser) g.89872227G>A - POLG(NM_002693.2):c.970C>T (p.P324S) - POLG_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.970C>T likely benign r.(?) p.(Pro324Ser) g.89872227G>A - POLG(NM_002693.2):c.970C>T (p.P324S) - POLG_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.975del pathogenic r.(?) p.(Thr326Glnfs*39) g.89872227del - POLG(NM_002693.2):c.975delC (p.T326Qfs*39) - POLG_000167 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. - c.1091dup pathogenic r.(?) p.(Gly365Argfs*23) g.89871995dup - POLG(NM_002693.2):c.1091dupT (p.G365Rfs*23) - POLG_000165 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.1126C>T likely benign r.(?) p.(=) g.89871960G>A - POLG(NM_002693.2):c.1126C>T (p.L376=) - POLG_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.1126C>T benign r.(?) p.(=) g.89871960G>A - POLG(NM_002693.2):c.1126C>T (p.L376=) - POLG_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1174C>G likely benign r.(?) p.(Leu392Val) g.89871763G>C - POLG(NM_002693.2):c.1174C>G (p.L392V) - POLG_000164 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.1174C>G VUS r.(?) p.(Leu392Val) g.89871763G>C - POLG(NM_002693.2):c.1174C>G (p.L392V) - POLG_000164 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1174C>G VUS r.(?) p.(Leu392Val) g.89871763G>C - POLG(NM_002693.2):c.1174C>G (p.L392V) - POLG_000164 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.1174C>G VUS r.(?) p.(Leu392Val) g.89871763G>C - POLG(NM_002693.2):c.1174C>G (p.L392V) - POLG_000164 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.1275C>T likely benign r.(?) p.(=) g.89870556G>A - POLG(NM_002693.2):c.1275C>T (p.A425=, p.=) - POLG_000163 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1275C>T likely benign r.(?) p.(=) g.89870556G>A - POLG(NM_002693.2):c.1275C>T (p.A425=, p.=) - POLG_000163 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.1276G>A pathogenic r.(?) p.(Gly426Ser) g.89870555C>T - POLG(NM_002693.2):c.1276G>A (p.G426S) - POLG_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
+/. - c.1293del pathogenic r.(?) p.(Val432Serfs*28) g.89870538del - - - POLG_000162 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.1370G>A VUS r.(?) p.(Arg457Gln) g.89870461C>T - POLG(NM_002693.2):c.1370G>A (p.R457Q) - POLG_000191 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.1386G>A likely benign r.(?) p.(=) g.89870445C>T - POLG(NM_002693.2):c.1386G>A (p.S462=) - POLG_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
+/. - c.1399G>A pathogenic r.(?) p.(Ala467Thr) g.89870432C>T - POLG(NM_001126131.2):c.1399G>A (p.A467T), POLG(NM_002693.2):c.1399G>A (p.A467T, p.(Ala467Thr)) - POLG_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
+/. - c.1399G>A pathogenic r.(?) p.(Ala467Thr) g.89870432C>T - POLG(NM_001126131.2):c.1399G>A (p.A467T), POLG(NM_002693.2):c.1399G>A (p.A467T, p.(Ala467Thr)) - POLG_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. - c.1399G>A pathogenic r.(?) p.(Ala467Thr) g.89870432C>T - POLG(NM_001126131.2):c.1399G>A (p.A467T), POLG(NM_002693.2):c.1399G>A (p.A467T, p.(Ala467Thr)) - POLG_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+/. - c.1399G>A pathogenic (recessive) r.(?) p.(Ala467Thr) g.89870432C>T - - - POLG_000080 - PubMed: Lionel 2018 - - Germline - - - 0 - Johan den Dunnen
+/. - c.1399G>A pathogenic r.(?) p.(Ala467Thr) g.89870432C>T - POLG(NM_001126131.2):c.1399G>A (p.A467T), POLG(NM_002693.2):c.1399G>A (p.A467T, p.(Ala467Thr)) - POLG_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. - c.1399G>A pathogenic r.(?) p.(Ala467Thr) g.89870432C>T - POLG(NM_001126131.2):c.1399G>A (p.A467T), POLG(NM_002693.2):c.1399G>A (p.A467T, p.(Ala467Thr)) - POLG_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+/. - c.1399G>A pathogenic r.(?) p.(Ala467Thr) g.89870432C>T - POLG(NM_001126131.2):c.1399G>A (p.A467T), POLG(NM_002693.2):c.1399G>A (p.A467T, p.(Ala467Thr)) - POLG_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. - c.1402A>G pathogenic r.(?) p.(Asn468Asp) g.89870429T>C - POLG(NM_002693.2):c.1402A>G (p.N468D) - POLG_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. - c.1402A>G pathogenic r.(?) p.(Asn468Asp) g.89870429T>C - POLG(NM_002693.2):c.1402A>G (p.N468D) - POLG_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
-?/. - c.1550G>T likely benign r.(?) p.(Gly517Val) g.89870178C>A - POLG(NM_002693.2):c.1550G>T (p.G517V) - POLG_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.1550G>T likely benign r.(?) p.(Gly517Val) g.89870178C>A - POLG(NM_002693.2):c.1550G>T (p.G517V) - POLG_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
Legend   « First ‹ Prev     1 2 3     Next › Last »