Unique variants in the PRNP gene

Information The variants shown are described using the NM_000311.3 transcript reference sequence.

64 entries on 1 page. Showing entries 1 - 64.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Haplotype     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-/., -/? 4 1i c.-10-21G>A r.(=), r.(?) p.(=) - - benign g.4679836G>A g.4699190G>A PRNP(NM_000311.4):c.-10-21G>A - PRNP_000012 VKGL data sharing initiative Nederland {PMID08829666:Palmer 1996} - - CLASSIFICATION record, Germline - 7/124 chromosomes - - - Johan den Dunnen, VKGL-NL_Rotterdam
-?/. 1 - c.159C>T r.(?) p.(Gly53=) - - likely benign g.4680025C>T g.4699379C>T PRNP(NM_000311.4):c.159C>T (p.G53=) - PRNP_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+/., -?/., ?/. 4 2 c.160G>A r.(?) p.(Gly54Ser) - - likely benign, pathogenic, VUS g.4680026G>A g.4699380G>A PRNP(NM_000311.4):c.160G>A (p.G54S) - PRNP_000040 VKGL data sharing initiative Nederland, 1 more item PubMed: Beck 2010, PubMed: Owen 2014 - - CLASSIFICATION record, Germline, Unknown ? 5 groups - - - Johan den Dunnen, J Beck, VKGL-NL_Rotterdam
-?/? 1 2 c.(178_201)[3] r.(?) p.(Pro60_Gln67)[3] - - likely benign g.4680044_4680067del - - - PRNP_000000 1 more item {PMID07783865:Reder 1995} - - Germline - - - - - Johan den Dunnen
+?/. 1 2 c.201_202ins(168) r.(?) p.(Pro60_Gln67)[11] 12 - likely pathogenic g.4680067_4680068ins168 - 7-OPRI - PRNP_000000 12 haplotype (undetermined) PubMed: Owen 2014 - - Germline - - - - - J Beck
+?/. 1 2 c.201_202ins(216) r.(?) p.(Pro60_Gln67)[13] 14 - likely pathogenic g.4680067_4680068ins216 - 9-OPRI - PRNP_000000 14 haplotype (undetermined) PubMed: Owen 2014 - - Germline - - - - - J Beck
+?/. 1 2 c.203_204ins204_227{222G>A}ins180_251{246A>G}ins204_227 r.(?) p.(Pro60_Gln67)[9] 10 - likely pathogenic g.4680067_4680068ins120 - - - PRNP_000051 10 haplotype 1-2-2a-2-2-3g-2-2-3-4 PubMed: Beck 2007 - - Unknown ? - - - - Johan den Dunnen
+?/. 2 2 c.203_204ins228_251ins204_251ins204_251{246A>G} r.(?) p.(Pro60_Gln67)[9] 10 - likely pathogenic g.4680067_4680068ins120 - 5-OPRI - PRNP_000048, PRNP_000049 10 haplotype 1-2-3-2-3-2-3g-2-3-4, 10 haplotype 1-2-3-2-3-2-3g-2-3-4 (South African) PubMed: Mead 2007, PubMed: Owen 2014 - - Germline yes - - - - Johan den Dunnen, J Beck
-?/. 2 - c.204T>C r.(?) p.(Pro68=) - - likely benign g.4680070T>C g.4699424T>C PRNP(NM_000311.4):c.204T>C (p.P68=), PRNP(NM_001271561.2):c.115T>C (p.S39P) - PRNP_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_VUmc
-/., -/?, -?/?, ?/? 7 2 c.(204_227)del, c.204_227del r.(?) p.(Pro84_Gln91)del, p.(Pro84_Gln91del) - - benign, likely benign, VUS g.4680070_4680093del, g.4680112_4680135del g.4699424_4699447del, g.4699466_4699489del ?_225del24, ?_225del25, PRNP(NM_000311.4):c.204_227delTCATGGTGGTGGCTGGGGGCAGCC (p.P84_Q91del) - PRNP_000001, PRNP_000010, PRNP_000057 24 bp del upstream codon 76, 4-haplotype, incomplete penetrance, 2 more items {PMID07485229:Perry 1995}, {PMID07902693:Pocchiari 1993}, {PMID08030960:Masullo 1994}, 1 more item - - CLASSIFICATION record, Germline - - - - - Johan den Dunnen, VKGL-NL_Rotterdam, VKGL-NL_VUmc
-?/. 1 2 c.204_227dup r.(?) p.(Pro84_Gln91dup) - - likely benign g.4680070_4680093dup g.4699424_4699447dup 1-OPRI, 225_226inscctcatggtggtggctgggggcag - PRNP_000046 OPRI-repeat, 1-2-2-2-3-4 PubMed: Beck 2010 - - Germline no - - - - Johan den Dunnen
+/?, +?/. 2 2 c.210T>C r.(?) p.(=) - - likely pathogenic, pathogenic g.4680076T>C g.4699430T>C - - PRNP_000011 12-haplotype 1-2-2c-3-2-3-2-3-2-3g-3-4 {PMID01736177:Brown 1992}, PubMed: Goldfarb 1991 - - Germline - - - - - Johan den Dunnen
+?/. 1 2 c.225_226ins204_227[4] r.(?) p.(Pro60_Gln67)[8] 9 - likely pathogenic g.4680091_4680092ins96 - 4-OPRI - PRNP_000054 9 haplotype 1-2-2-2-2-2-2-3-4 PubMed: Owen 2014 - - Germline ? - - - - J Beck
+/? 1 2 c.225_226ins204_251ins204_251ins204_251{246A>G}ins228_251 r.(?) p.(Pro60_Gln67)[11] - - pathogenic g.4680115_4680116ins168 - - - PRNP_000014 - {PMID01736177:Brown 1992} - - Germline - - - - - Johan den Dunnen
+/., +?/. 2 2 c.225_226ins204_251ins204_251{246A>G}ins180_227 r.(?) p.(Pro60_Gln67)[10] 11 - likely pathogenic, pathogenic g.4680091_4680092ins144 - 6-OPRI - PRNP_000013 11 haplotype 1-2-2-2-3-2-3g-2-2-3-4 PubMed: Goldfarb 1991, PubMed: Owen 2014 - - Germline ?, yes - - - - Johan den Dunnen, J Beck
+?/? 1 2 c.225_226ins204_251[2]ins204_251{246G>A}ins228_251 r.(?) p.(Pro60_Gln67)[11] 12 - likely pathogenic g.4680115_4680116ins168 - - - PRNP_000047 12 haplotype 1-2-2c-3-2-3-2-3-2-3g-3-4 PubMed: Goldfarb 1991 - - Germline - - - - - Johan den Dunnen
+?/. 2 2 c.225_226ins228_251{246A>G}ins204_227[4] r.(?) p.(Pro60_Gln67)[9] 10 - likely pathogenic g.4680091_4680092ins120 - 5-OPRI - PRNP_000050 10 haplotype 1-2-2-3g-2-2-2-2-3-4, 10 haplotype 1-2-2-3g-2-2-2-2-3-4 (English) PubMed: Mead 2007, PubMed: Owen 2014 - - Germline yes - - - - Johan den Dunnen, J Beck
+/? 1 2 c.225_226ins228_251{246A>G}ins228_251ins180_227ins180_227ins180_227 r.(?) p.(Pro60_Gln67)[12] - - pathogenic g.4680115_4680116ins192 - - - PRNP_000015 13-haplotype 1-2-2-3g-3-2-2-2-2-2-2-3-4 {PMID08595485:van Gool 1995} - - Germline - - - - - Johan den Dunnen
+/. 1 2 c.225_226ins228_251{246A>G}[3]ins180_251 r.(?) p.(Pro60_Gln67)[9] 10 - pathogenic g.4680091_4680092ins120 - - - PRNP_000053 10 haplotype 1-2-2-3g-3g-3g-2-2-3-4 PubMed: Skworc 1999 - - Germline yes - - - - Johan den Dunnen
+/. 1 - c.227_228ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] r.227_228ins[ucauggugguggcugggggcagcc[2];ccauggugguggcuggggacagcc;ucauggugguggcugggggcagcc[5]] 1 more item - - pathogenic 1 more item 1 more item - - PRNP_000064 - PubMed: Lee 2019 ClinVar-000992388.1 - Germline/De novo (untested) - - - - - Johan den Dunnen
-/. 1 - c.228_251del r.(?) p.(Pro84_Gln91del) - - benign g.4680094_4680117del g.4699448_4699471del PRNP(NM_000311.4):c.228_251delCCATGGTGGTGGCTGGGGACAGCC (p.P84_Q91del) - PRNP_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-/., -/?, -?/? 6 2 c.246_269del r.(?) p.(Pro60_Gln67)[3], p.(Pro60_Gln67)[4], p.(Pro84_Gln91)del, p.(Pro84_Gln91del) - - benign, likely benign g.4680070_4680093del, g.4680112_4680135del g.4699424_4699447del, g.4699466_4699489del PRNP(NM_000311.4):c.246_269delACAGCCTCATGGTGGTGGCTGGGG (p.P84_Q91del) - PRNP_000001, PRNP_000059 4-haplotype, VKGL data sharing initiative Nederland, 1 more item {PMID01347972:Vnencak-Jones 1992}, {PMID01357594:Bosque 1992}, {PMID01678248:Puckett 1991}, 1 more item - - CLASSIFICATION record, Germline - 6/240 chromosomes TthIII1- - - Johan den Dunnen, VKGL-NL_VUmc
+?/. 1 2 c.249_250ins180_227ins180_227ins180_227ins180_227{222G>A} r.(?) p.(Pro60_Gln67)[12] 13 - likely pathogenic g.4680115_4680116ins192 - - - PRNP_000002 13 haplotype 1-2-2-3-2-2-2-2-2-2-2-2a-4 PubMed: Goldfarb 1991 - - Germline ? - - - - Johan den Dunnen
+/. 1 2 c.249_250ins180_227ins180_251 r.(?) p.(Pro60_Gln67)[9] 10 - pathogenic g.4680115_4680116ins120 - - - PRNP_000052 10 haplotype 1-2-2-3-2-2-2-2-3-4 PubMed: Cochrane 1996 - - Germline yes - - - - Johan den Dunnen
+/? 1 2 c.249_250ins180_227ins204_251{246A>G}ins180_227ins204_251 r.(?) p.(Pro60_Gln67)[12] - - pathogenic g.4680115_4680116ins192 - - - PRNP_000003 13-haplotype 1-2-2-3-2-2-2-2a-2-2-2-3-4 {PMID10581230:Laplanche 1999} - - Germline - - - - - Johan den Dunnen
+/. 1 2 c.249_250ins180_227ins204_251{246A>G}ins180_251 r.(?) p.(Pro60_Gln67)[11] 12 - pathogenic g.4680115_4680116ins168 - - - PRNP_000004 12 haplotype 1-2-2-3-2-2-2-3g-2-2-3-4 PubMed: Tateishi 1991 - - Germline ? - - - - Johan den Dunnen
+?/? 1 2 c.249_250ins204_227{222G>A}ins204_227{222G>A} r.(?) p.(Pro60_Gln67)[6] - - likely pathogenic g.4680115_4680116ins48 - - - PRNP_000005 7-haplotype 1-2-2-3-2a-2a-4 {PMID08232966:Goldfarb 1993} - - Germline - - - - - Johan den Dunnen
+?/. 1 2 c.249_250ins204_251ins204_251 r.(?) p.(Pro60_Gln67)[8] 9 - likely pathogenic g.4680115_4680116ins96 - - - PRNP_000008 9 haplotype 1-2-2-3-2-3-2-3-4 PubMed: Goldfarb 1991 - - Germline ? - - - - Johan den Dunnen
+/? 1 2 c.249_250ins204_251ins228_251{246A>G}ins180_227{222G>A}ins204_251ins204_251 r.(?) p.(Pro60_Gln67)[13] - - pathogenic g.4680115_4680116ins216 - - - PRNP_000009 14-haplotype 1-2-2-3-2-3-3g-2-2a-2-3-2-3-4 {PMID08750875:Krasemann 1995} - - Germline - - - - - Johan den Dunnen
+?/., +?/? 3 2 c.249_250ins204_251{246A>G}ins180_251 r.(?) p.(Pro60_Gln67)[9] 10 - likely pathogenic g.4680115_4680116ins120 - 5-OPRI - PRNP_000006 10 haplotype 1-2-2-3-2-3g-2-2-3-4, 10 haplotype 1-2-2-3-2-3g-2-2-3-4 (Northern Ireland) PubMed: Goldfarb 1991, PubMed: Mead 2007, PubMed: Owen 2014 - - Germline, Unknown ?, yes - - - - Johan den Dunnen, J Beck
+/? 1 2 c.249_250ins204_251{246A>G}ins204_227{222G>A}ins180_227ins204_251{246A>G}ins204_251 r.(?) p.(Pro60_Gln67)[13] - - pathogenic g.4680115_4680116ins216 - - - PRNP_000007 14-haplotype 1-2-2-3-2-3g-2a-2-2-2-3g-2-3-4 {PMID01349721:Owen 1992} - - Germline - - - - - Johan den Dunnen
?/? 1 2 c.290G>A r.(?) p.(Ser97Asn) - - VUS g.4680156G>A g.4699510G>A - - PRNP_000016 - - - rs56362942 Unknown - - - - - Johan den Dunnen
+/., +/? 7 2 c.305C>T r.(?) p.(Pro102Leu) - - likely pathogenic, pathogenic g.4680171C>T g.4699525C>T - - PRNP_000017 - {PMID02564168:Hsiao 1989}, {PMID02572450:Goldgaber 1989}, {PMID10889337:Muramoto 2000}, 2 more items - - Germline, Unknown ? - DdeI+ - - Johan den Dunnen, J Beck
+/., +/?, ?/? 10 2 c.314C>T r.(?) p.(Pro105Leu) - ACMG pathogenic, pathogenic (dominant), VUS g.4680180C>T g.4699534C>T PRNP(NM_000311.4):c.314C>T (p.P105L) - PRNP_000018 VKGL data sharing initiative Nederland {PMID08461023:Kitamoto 1993}, {PMID10408557:Yamada 1993}, PubMed: Beck 2010, PubMed: Helbig 2016, 1 more item - rs11538758 CLASSIFICATION record, De novo, Germline, Unknown yes - AluI+ - - Johan den Dunnen, J Beck, VKGL-NL_Rotterdam
+?/. 2 2 c.341G>T r.(?) p.(Gly114Val) - - likely pathogenic g.4680207G>T g.4699561G>T - - PRNP_000044 variant not found in controls (Turkey, Uganda (Gujarati)) PubMed: Beck 2010 - - Unknown ? - - - - Johan den Dunnen
-/? 2 2 c.350C>T r.(?) p.(Ala117Val) - - benign g.4680216C>T g.4699570C>T - - PRNP_000020 - {PMID08829666:Palmer 1996} - - Germline - - - - - Johan den Dunnen
+/., +/? 2 2 c.350_351inv r.(?) p.(Ala117Val) - - pathogenic g.4680216_4680217inv g.4699570_4699571inv [350C>T;351>4G] (A117V) - PRNP_000019 - {PMID07501157:Mastrianni 1995}, PubMed: Owen 2014 - - Germline - - PvuII- - - Johan den Dunnen, J Beck
-/., -/? 7 2 c.351A>G r.(?) p.(=), p.(Ala117=) - - benign g.4680217A>G g.4699571A>G A117A, PRNP(NM_000311.4):c.351A>G (p.A117=) - PRNP_000021 VKGL data sharing initiative Nederland {PMID02564168:Hsiao 1989}, {PMID07501157:Mastrianni 1995}, {PMID07902693:Pocchiari 1993}, 1 more item - - CLASSIFICATION record, Germline - 7/124 chromosomes PvuII- - - Johan den Dunnen, VKGL-NL_Rotterdam, VKGL-NL_VUmc, VKGL-NL_AMC
-/?, -?/. 4 2 c.372C>G r.(?) p.(=), p.(Gly124=) - - benign, likely benign g.4680238C>G g.4699592C>G 421C>G (G124G), PRNP(NM_000311.4):c.372C>G (p.G124=) - PRNP_000022 VKGL data sharing initiative Nederland {PMID07916191:Ghetti 1994}, {PMID10790216:Peoc'h 2000} - - CLASSIFICATION record, Germline - - EcoO109I- - - Johan den Dunnen, VKGL-NL_Rotterdam, VKGL-NL_VUmc
-/., -/?, -?/., -?/?, ?/? 23 2 c.385A>G r.(?) p.(Met129Val) - - benign, likely benign, VUS g.4680251A>G g.4699605A>G PRNP(NM_000311.4):c.385A>G (p.M129V), PRNP(NM_000311.5):c.385A>G (p.M129V) - PRNP_000023 VKGL data sharing initiative Nederland {PMID07501157:Mastrianni 1995}, {PMID07783865:Reder 1995}, {PMID07902693:Pocchiari 1993}, 6 more items - rs1799990 CLASSIFICATION record, Germline, Unknown ? - - - - Johan den Dunnen, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_VUmc, VKGL-NL_AMC
-?/., ?/? 3 2 c.424G>A r.(?) p.(Gly142Ser) - - likely benign, VUS g.4680290G>A g.4699644G>A PRNP(NM_000311.4):c.424G>A (p.G142S) - PRNP_000024 variant found in controls of different ethnic origin, VKGL data sharing initiative Nederland PubMed: Beck 2010 - rs150351644 CLASSIFICATION record, Unknown ? - - - - Johan den Dunnen, VKGL-NL_VUmc
+/. 1 2 c.489C>G r.(?) p.(Tyr163*) - - pathogenic g.4680355C>G g.4699709C>G - - PRNP_000041 - PubMed: Mead 2013, PubMed: Owen 2014 - - Germline yes - - - - J Beck
?/. 1 2 c.499G>A r.(?) p.(Asp167Asn) - - VUS g.4680365G>A g.4699719G>A - - PRNP_000043 - PubMed: Beck 2010 - - Germline ? - - - - Johan den Dunnen
-/., -?/., ?/? 4 2 c.512A>G r.(?) p.(Asn171Ser) - - benign, likely benign, VUS g.4680378A>G g.4699732A>G PRNP(NM_000311.4):c.512A>G (p.N171S) - PRNP_000025 variant found in controls of different ethnic origin, VKGL data sharing initiative Nederland PubMed: Beck 2010 - rs16990018 CLASSIFICATION record, Unknown ? - - - - Johan den Dunnen, VKGL-NL_Rotterdam, VKGL-NL_VUmc
-?/. 1 - c.531C>T r.(?) p.(His177=) - - likely benign g.4680397C>T g.4699751C>T PRNP(NM_000311.4):c.531C>T (p.H177=) - PRNP_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/?, +?/. 3 2 c.532G>A r.(?) p.(Asp178Asn) - - likely pathogenic, pathogenic g.4680398G>A g.4699752G>A - - PRNP_000026 - {PMID01357594:Bosque 1992}, {PMID07783865:Reder 1995}, PubMed: Owen 2014 - - Germline - - TthIII1- - - Johan den Dunnen, J Beck
+/? 1 2 c.538G>A r.(?) p.(Val180Ile) - - pathogenic g.4680404G>A g.4699758G>A - - PRNP_000027 - {PMID08138811:Hitoshi 1993} - - Germline - - TthIII1- - - Johan den Dunnen
-?/. 1 - c.550A>G r.(?) p.(Ile184Val) - - likely benign g.4680416A>G g.4699770A>G PRNP(NM_000311.4):c.550A>G (p.I184V) - PRNP_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+/? 1 2 c.586G>A r.(?) p.(Glu196Lys) - - pathogenic g.4680452G>A g.4699806G>A 635G>A - PRNP_000028 - {PMID10790216:Peoc'h 2000} - - Germline - - XmnI+ - - Johan den Dunnen
?/? 1 2 c.592T>G r.(?) p.(Phe198Val) - - VUS g.4680458T>G g.4699812T>G - - PRNP_000029 - - - rs55871421 Unknown - - - - - Johan den Dunnen
+/? 1 2 c.593T>C r.(?) p.(Phe198Ser) - - pathogenic g.4680459T>C g.4699813T>C - - PRNP_000030 - {PMID07916191:Ghetti 1994} - - Germline - - - - - Johan den Dunnen
+/?, +?/., ?/? 8 2 c.598G>A r.(?) p.(Glu200Lys) - - likely pathogenic, pathogenic, VUS g.4680464G>A g.4699818G>A - - PRNP_000031 - {PMID01347972:Vnencak-Jones 1992}, {PMID02572450:Goldgaber 1989}, {PMID10672318:Seno 2000}, 1 more item - rs28933385 Germline, Unknown - - - - - Johan den Dunnen, J Beck
-?/. 1 - c.606C>T r.(?) p.(Asp202=) - - likely benign g.4680472C>T g.4699826C>T PRNP(NM_000311.4):c.606C>T (p.D202=) - PRNP_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/? 1 2 c.607G>A r.(?) p.(Val203Ile) - - likely pathogenic g.4680473G>A g.4699827G>A 656G>A - PRNP_000032 weakly causative {PMID10790216:Peoc'h 2000} - - Germline - - HpaI+ - - Johan den Dunnen
?/? 1 2 c.622C>T r.(?) p.(Arg208Cys) - - VUS g.4680488C>T g.4699842C>T - - PRNP_000033 - - - rs55826236 Unknown - - - - - Johan den Dunnen
?/? 1 2 c.623G>A r.(?) p.(Arg208His) - - VUS g.4680489G>A g.4699843G>A - - PRNP_000034 - - - rs74315412 Unknown - - - - - Johan den Dunnen
-?/. 1 2 c.625G>A r.(?) p.(Val209Met) - - likely benign g.4680491G>A g.4699845G>A - - PRNP_000045 - PubMed: Beck 2010 - - Germline no - - - - Johan den Dunnen
+/?, ?/? 5 2 c.628G>A r.(?) p.(Val210Ile) - - pathogenic, VUS g.4680494G>A g.4699848G>A - - PRNP_000035 incomplete penetrance {PMID07902693:Pocchiari 1993} - rs74315407 Germline, Unknown - - - - - Johan den Dunnen
+/. 1 2 c.628G>T r.(?) p.(Val210Phe) - - pathogenic g.4680494G>T g.4699848G>T - - PRNP_000055 - PubMed: Owen 2014 - - Germline - - - - - J Beck
+/., +/? 2 2 c.631G>C r.(?) p.(Glu211Gln) - - pathogenic g.4680497G>C g.4699851G>C 680G>C - PRNP_000036 - {PMID10790216:Peoc'h 2000}, PubMed: Owen 2014 - - Germline - - PvuII+ - - Johan den Dunnen, J Beck
+/. 1 2 c.635A>G r.(?) p.(Gln212Arg) - - pathogenic g.4680501A>G g.4699855A>G - - PRNP_000042 - PubMed: Beck 2010, PubMed: Owen 2014 - - Germline ? - - - - J Beck
+/? 1 2 c.650A>G r.(?) p.(Gln217Arg) - - pathogenic g.4680516A>G g.4699870A>G - - PRNP_000037 - {PMID07916191:Ghetti 1994} - - Germline - - - - - Johan den Dunnen
-/?, -?/., -?/?, ?/? 7 2 c.655G>A r.(?) p.(Glu219Lys), p.Glu219Lys - - benign, likely benign, VUS g.4680521G>A g.4699875G>A PRNP(NM_000311.3):c.655G>A (p.(Glu219Lys)), PRNP(NM_000311.4):c.655G>A (p.E219K) - PRNP_000038 VKGL data sharing initiative Nederland {PMID10672318:Seno 2000}, {PMID10889337:Muramoto 2000} - rs1800014 CLASSIFICATION record, Germline, Unknown - - - - - Johan den Dunnen, VKGL-NL_Leiden, VKGL-NL_VUmc
+/? 1 2 c.695T>G r.(?) p.(Met232Arg) - - pathogenic g.4680561T>G g.4699915T>G - - PRNP_000039 - {PMID08138811:Hitoshi 1993} - - Germline - - NlaIII- - - Johan den Dunnen
Legend   How to query