Full data view for gene PRNP

Information The variants shown are described using the NM_000311.3 transcript reference sequence.

162 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »



AscendingDNA change (cDNA)     

RNA change     




Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

-/? 1i c.-10-21G>A r.(?) p.(=) - Parent #1 - benign g.4679836G>A g.4699190G>A - - PRNP_000012 - {PMID08829666:Palmer 1996} - - Germline - - - - - DNA PCRdig, SEQ - - ? - - - ? ? ? (unknown) - - - - - 1 Johan den Dunnen
-/? 1i c.-10-21G>A r.(?) p.(=) - Parent #1 - benign g.4679836G>A g.4699190G>A - - PRNP_000012 - {PMID08829666:Palmer 1996} - - Germline - - - - - DNA PCRdig, SEQ - - ? - - - ? ? ? (unknown) - - - - - 1 Johan den Dunnen
-/? 1i c.-10-21G>A r.(?) p.(=) - Parent #1 - benign g.4679836G>A g.4699190G>A - - PRNP_000012 - {PMID08829666:Palmer 1996} - - Germline - 7/124 chromosomes - - - DNA PCRdig, SEQ - - Healthy/Control - - - ? ? ? (unknown) - - - - - 7 Johan den Dunnen
-/. - c.-10-21G>A r.(=) p.(=) - Unknown - benign g.4679836G>A g.4699190G>A PRNP(NM_000311.4):c.-10-21G>A - PRNP_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.159C>T r.(?) p.(Gly53=) - Unknown - likely benign g.4680025C>T g.4699379C>T PRNP(NM_000311.4):c.159C>T (p.G53=) - PRNP_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. 2 c.160G>A r.(?) p.(Gly54Ser) - Parent #1 - pathogenic g.4680026G>A g.4699380G>A - - PRNP_000040 - PubMed: Owen 2014 - - Germline - - - 0 - DNA SEQ - - ? - PubMed: Beck 2010 - - - - - - 0 - - 1 J Beck
-?/. 2 c.160G>A r.(?) p.(Gly54Ser) - Unknown - likely benign g.4680026G>A g.4699380G>A - - PRNP_000040 - PubMed: Beck 2010 - - Unknown - - - 0 - DNA SEQ - - PRND - PubMed: Beck 2010 - F no Uganda Gujarati 48y 0 - - 1 Johan den Dunnen
-?/. 2 c.160G>A r.(?) p.(Gly54Ser) - Unknown - likely benign g.4680026G>A g.4699380G>A - - PRNP_000040 variant also found in CEPH control panel (2 Pakistani liguistic groups, low levels China and Middle East) PubMed: Beck 2010 - - Unknown ? 5 groups - 0 - DNA SEQ - - Healthy/Control - PubMed: Beck 2010 - ? ? Uganda Gujarati - 0 - - 1 Johan den Dunnen
?/. - c.160G>A r.(?) p.(Gly54Ser) - Unknown - VUS g.4680026G>A - PRNP(NM_000311.4):c.160G>A (p.G54S) - PRNP_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/? 2 c.(178_201)[3] r.(?) p.(Pro60_Gln67)[3] - Parent #1 - likely benign g.4680044_4680067del - - - PRNP_000000 Variant Error [EMISMATCH/0]: This transcript variant has an error. Please fix this entry and then remove this message. {PMID07783865:Reder 1995} - - Germline - - - - - DNA PCRdig, SEQ - - FFI - - - ? ? United States - - - - - 1 Johan den Dunnen
+?/. 2 c.201_202ins(168) r.(?) p.(Pro60_Gln67)[11] 12 Unknown - likely pathogenic g.4680067_4680068ins168 - 7-OPRI - PRNP_000000 12 haplotype (undetermined) PubMed: Owen 2014 - - Germline - - - 0 - DNA DSDI, SEQ - - ? - - - - - United Kingdom (Great Britain) - - 0 - - 1 J Beck
+?/. 2 c.201_202ins(216) r.(?) p.(Pro60_Gln67)[13] 14 Unknown - likely pathogenic g.4680067_4680068ins216 - 9-OPRI - PRNP_000000 14 haplotype (undetermined) PubMed: Owen 2014 - - Germline - - - 0 - DNA DSDI, SEQ - - ? - - - - - United Kingdom (Great Britain) - - 0 - - 1 J Beck
+?/. 2 c.203_204ins204_227{222G>A}ins180_251{246A>G}ins204_227 r.(?) p.(Pro60_Gln67)[9] 10 Unknown - likely pathogenic g.4680067_4680068ins120 - - - PRNP_000051 10 haplotype 1-2-2a-2-2-3g-2-2-3-4 PubMed: Beck 2007 - - Unknown ? - - 0 - DNA SEQ - - PRND - PubMed: Beck 2007 - F no Japan - >49y 0 - - 1 Johan den Dunnen
+?/. 2 c.203_204ins228_251ins204_251ins204_251{246A>G} r.(?) p.(Pro60_Gln67)[9] 10 Parent #1 - likely pathogenic g.4680067_4680068ins120 - 5-OPRI - PRNP_000048 10 haplotype 1-2-3-2-3-2-3g-2-3-4 (South African) PubMed: Owen 2014 - - Germline yes - - 0 - DNA SEQ - - ? - PubMed: Mead 2007 - - - United Kingdom (Great Britain) - - 0 - - 1 J Beck
+?/. 2 c.203_204ins228_251ins204_251ins204_251{246A>G} r.(?) p.(Pro60_Gln67)[9] 10 Parent #1 - likely pathogenic g.4680067_4680068ins120 - 5-OPRI - PRNP_000049 10 haplotype 1-2-3-2-3-2-3g-2-3-4 PubMed: Mead 2007 - - Germline yes - - 0 - DNA SEQ - - PRND - PubMed: Mead 2007 4-generation famlily, 4 affecteds (F, 3M) - no South Africa - 53y 0 - - 1 Johan den Dunnen
-?/. - c.204T>C r.(?) p.(Pro68=) - Unknown - likely benign g.4680070T>C g.4699424T>C PRNP(NM_000311.4):c.204T>C (p.P68=), PRNP(NM_001271561.2):c.115T>C (p.S39P) - PRNP_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.204T>C r.(?) p.(Pro68=) - Unknown - likely benign g.4680070T>C g.4699424T>C PRNP(NM_000311.4):c.204T>C (p.P68=), PRNP(NM_001271561.2):c.115T>C (p.S39P) - PRNP_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/? 2 c.(204_227)del r.(?) p.(Pro84_Gln91)del - Parent #1 - VUS g.4680070_4680093del g.4699424_4699447del ?_225del24 - PRNP_000010 24 bp del upstream codon 76 {PMID08030960:Masullo 1994} - - Germline - - - - - DNA PCRdig, SEQ - - DEM - - - ? ? Italy - - - - - 1 Johan den Dunnen
?/? 2 c.(204_227)del r.(?) p.(Pro84_Gln91)del - Parent #2 - VUS g.4680070_4680093del g.4699424_4699447del ?_225del25 - PRNP_000010 24 bp del upstream codon 76 {PMID08030960:Masullo 1994} - - Germline - - - - - DNA PCRdig, SEQ - - DEM - - - ? ? Italy - - - - - 1 Johan den Dunnen
-/? 2 c.204_227del r.(?) p.(Pro84_Gln91)del - Maternal (confirmed) - benign g.4680070_4680093del g.4699424_4699447del - - PRNP_000010 4-haplotype {PMID10408557:Yamada 1993} - - Germline - - - - - DNA PCRdig, SEQ - - Healthy/Control - - 3-generation family, young son affected brother ? ? Japan - - - - - 1 Johan den Dunnen
-?/? 2 c.204_227del r.(?) p.(Pro84_Gln91)del - Parent #1 - likely benign g.4680112_4680135del g.4699466_4699489del - - PRNP_000010 Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message. {PMID07485229:Perry 1995} - - Germline - - - 0 - DNA PCRdig, SEQ, SSCA - - AD - - - ? ? United States - - - - - 3 Johan den Dunnen
-/? 2 c.204_227del r.(?) p.(Pro84_Gln91)del - Parent #2 - benign g.4680070_4680093del g.4699424_4699447del - - PRNP_000010 incomplete penetrance {PMID07902693:Pocchiari 1993} - - Germline - - - - - DNA PCRdig, SEQ - - CJD - - 3-generation family, 2 affected sisters, 2 unaffected carrier sisters ? ? Italy - - - - - 4 Johan den Dunnen
-/. - c.204_227del r.(?) p.(Pro84_Gln91del) - Unknown - benign g.4680070_4680093del g.4699424_4699447del PRNP(NM_000311.4):c.204_227delTCATGGTGGTGGCTGGGGGCAGCC (p.P84_Q91del) - PRNP_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.204_227del r.(?) p.(Pro84_Gln91del) - Unknown - benign g.4680070_4680093del g.4699424_4699447del PRNP(NM_000311.4):c.204_227delTCATGGTGGTGGCTGGGGGCAGCC (p.P84_Q91del) - PRNP_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. 2 c.204_227dup r.(?) p.(Pro84_Gln91dup) - Paternal (inferred) - likely benign g.4680070_4680093dup g.4699424_4699447dup 1-OPRI, 225_226inscctcatggtggtggctgggggcag - PRNP_000046 OPRI-repeat, 1-2-2-2-3-4 PubMed: Beck 2010 - - Germline no - - 0 - DNA SEQ - - GSD - PubMed: Beck 2010 small family, affected male, affected untested brother, sister and mother - - Italy Sicily >61y 0 - - 1 Johan den Dunnen
+?/. 2 c.210T>C r.(?) p.(=) - Parent #1 - likely pathogenic g.4680076T>C g.4699430T>C - - PRNP_000011 - PubMed: Goldfarb 1991 - - Germline - - - 0 - DNA PCR, SEQ - - CJD - - - ? ? United States - - - - - 3 Johan den Dunnen
+/? 2 c.210T>C r.(?) p.(=) - Parent #1 - pathogenic g.4680076T>C g.4699430T>C - - PRNP_000011 12-haplotype 1-2-2c-3-2-3-2-3-2-3g-3-4 {PMID01736177:Brown 1992} - - Germline - - - - - DNA PCR, SEQ - - CJD - - 4-generation family, 2 affecteds ? ? United States - - - - - 2 Johan den Dunnen
+?/. 2 c.225_226ins204_227[4] r.(?) p.(Pro60_Gln67)[8] 9 Unknown - likely pathogenic g.4680091_4680092ins96 - 4-OPRI - PRNP_000054 9 haplotype 1-2-2-2-2-2-2-3-4 PubMed: Owen 2014 - - Germline ? - - 0 - DNA SEQ - - ? - PubMed: Kaski 2011 - - - United Kingdom (Great Britain) - - 0 - - 1 J Beck
+/? 2 c.225_226ins204_251ins204_251ins204_251{246A>G}ins228_251 r.(?) p.(Pro60_Gln67)[11] - Parent #1 - pathogenic g.4680115_4680116ins168 - - - PRNP_000014 - {PMID01736177:Brown 1992} - - Germline - - - - - DNA PCR, SEQ - - CJD - - 4-generation family, 2 affecteds ? ? United States - - - - - 2 Johan den Dunnen
+?/. 2 c.225_226ins204_251ins204_251{246A>G}ins180_227 r.(?) p.(Pro60_Gln67)[10] 11 Parent #1 - likely pathogenic g.4680091_4680092ins144 - - - PRNP_000013 11 haplotype 1-2-2-2-3-2-3g-2-2-3-4 PubMed: Goldfarb 1991 - - Germline ? - - 0 - DNA PCR, SEQ - - CJD - - - ? ? United States - - - - - 1 Johan den Dunnen
+/. 2 c.225_226ins204_251ins204_251{246A>G}ins180_227 r.(?) p.(Pro60_Gln67)[10] 11 Parent #1 - pathogenic g.4680091_4680092ins144 - 6-OPRI - PRNP_000013 11 haplotype 1-2-2-2-3-2-3g-2-2-3-4 PubMed: Owen 2014 - - Germline yes - - 0 - DNA SEQ - - ? - PubMed: Poulter 1992 - - - United Kingdom (Great Britain) - - 0 - - 1 J Beck
+?/? 2 c.225_226ins204_251[2]ins204_251{246G>A}ins228_251 r.(?) p.(Pro60_Gln67)[11] 12 Parent #1 - likely pathogenic g.4680115_4680116ins168 - - - PRNP_000047 12 haplotype 1-2-2c-3-2-3-2-3-2-3g-3-4 PubMed: Goldfarb 1991 - - Germline - - - 0 - DNA PCR, SEQ - - CJD - - - ? ? United States - - - - - 3 Johan den Dunnen
+?/. 2 c.225_226ins228_251{246A>G}ins204_227[4] r.(?) p.(Pro60_Gln67)[9] 10 Parent #1 - likely pathogenic g.4680091_4680092ins120 - 5-OPRI - PRNP_000050 10 haplotype 1-2-2-3g-2-2-2-2-3-4 (English) PubMed: Owen 2014 - - Germline yes - - 0 - DNA DSDI, SEQ Blood - ? - - - - - United Kingdom (Great Britain) - - 0 - - 1 J Beck
+?/. 2 c.225_226ins228_251{246A>G}ins204_227[4] r.(?) p.(Pro60_Gln67)[9] 10 Parent #1 - likely pathogenic g.4680091_4680092ins120 - - - PRNP_000050 10 haplotype 1-2-2-3g-2-2-2-2-3-4 PubMed: Mead 2007 - - Germline yes - - 0 - DNA SEQ - - PRND - PubMed: Mead 2007 3-generation family, 3 affecteds (2F, M) ? no - - - 0 - - 3 Johan den Dunnen
+/? 2 c.225_226ins228_251{246A>G}ins228_251ins180_227ins180_227ins180_227 r.(?) p.(Pro60_Gln67)[12] - Parent #1 - pathogenic g.4680115_4680116ins192 - - - PRNP_000015 13-haplotype 1-2-2-3g-3-2-2-2-2-2-2-3-4 {PMID08595485:van Gool 1995} - - Germline - - - - - DNA PCR, SEQ - - DEM - - 3-generation family, 6 affecteds ? ? Netherlands - - - - - 6 Johan den Dunnen
+/. 2 c.225_226ins228_251{246A>G}[3]ins180_251 r.(?) p.(Pro60_Gln67)[9] 10 Parent #1 - pathogenic g.4680091_4680092ins120 - - - PRNP_000053 10 haplotype 1-2-2-3g-3g-3g-2-2-3-4 PubMed: Skworc 1999 - - Germline yes - - 0 - DNA SEQ - - CJD - PubMed: Skworc 1999 3-generation family, 3 affecteds (3F) F no Germany - - 0 - - 3 Johan den Dunnen
+/. - c.227_228ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] r.227_228ins[ucauggugguggcugggggcagcc[2];ccauggugguggcuggggacagcc;ucauggugguggcugggggcagcc[5]] p.(Gln91_Gly92insProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGln) - Unknown - pathogenic g.4680093_4680094ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] g.4699447_4699448ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] - - PRNP_000064 - PubMed: Lee 2019 ClinVar-000992388.1 - Germline/De novo (untested) - - - 0 - DNA, RNA RT-PCR, SEQ, SEQ-NG blood WES ? Pat25 PubMed: Lee 2019 - - - United States - - 0 - - 1 Johan den Dunnen
-/. - c.228_251del r.(?) p.(Pro84_Gln91del) - Unknown - benign g.4680094_4680117del g.4699448_4699471del PRNP(NM_000311.4):c.228_251delCCATGGTGGTGGCTGGGGACAGCC (p.P84_Q91del) - PRNP_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/? 2 c.246_269del r.(?) p.(Pro60_Gln67)[3] - Parent #1 - likely benign g.4680112_4680135del g.4699466_4699489del - - PRNP_000001 - {PMID01357594:Bosque 1992} - - Germline - - TthIII1- - - DNA PCRdig, SEQ - - CJD - - 3-generation family, 5 affecteds ? ? United States - - - - - 5 Johan den Dunnen
-/? 2 c.246_269del r.(?) p.(Pro60_Gln67)[4] - Parent #1 - benign g.4680112_4680135del g.4699466_4699489del - - PRNP_000001 4-haplotype {PMID01347972:Vnencak-Jones 1992} - - Germline - - - - - DNA PCRdig, SEQ - - CJD - - multi-generation family ? ? United States - - - - - 1 Johan den Dunnen
-/? 2 c.246_269del r.(?) p.(Pro60_Gln67)[4] - Unknown - benign g.4680112_4680135del g.4699466_4699489del - - PRNP_000001 4-haplotype {PMID01347972:Vnencak-Jones 1992} - - Germline - 6/240 chromosomes - - - DNA PCRdig, SEQ - - Healthy/Control - - 120 controls ? ? United States - - - - - 6 Johan den Dunnen
-?/? 2 c.246_269del r.(?) p.(Pro84_Gln91)del - Parent #1 - likely benign g.4680070_4680093del g.4699424_4699447del - - PRNP_000001 Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message. {PMID07485229:Perry 1995} - - Germline - - - - - DNA PCRdig, SEQ, SSCA - - AD - - - ? ? United States - - - - - 3 Johan den Dunnen
-?/? 2 c.246_269del r.(?) p.(Pro84_Gln91)del - Parent #1 - likely benign g.4680112_4680135del g.4699466_4699489del - - PRNP_000001 4-haplotype {PMID01678248:Puckett 1991} - - Germline - - - - - DNA PCRdig, SEQ - - Healthy/Control - - - ? ? Italy - - - - - 1 Johan den Dunnen
-/. - c.246_269del r.(?) p.(Pro84_Gln91del) - Unknown - benign g.4680112_4680135del g.4699466_4699489del PRNP(NM_000311.4):c.246_269delACAGCCTCATGGTGGTGGCTGGGG (p.P84_Q91del) - PRNP_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. 2 c.249_250ins180_227ins180_227ins180_227ins180_227{222G>A} r.(?) p.(Pro60_Gln67)[12] 13 Parent #1 - likely pathogenic g.4680115_4680116ins192 - - - PRNP_000002 13 haplotype 1-2-2-3-2-2-2-2-2-2-2-2a-4 PubMed: Goldfarb 1991 - - Germline ? - - 0 - DNA PCR, SEQ - - GSD - - - ? ? France - - - - - 1 Johan den Dunnen
+/. 2 c.249_250ins180_227ins180_251 r.(?) p.(Pro60_Gln67)[9] 10 Parent #1 - pathogenic g.4680115_4680116ins120 - - - PRNP_000052 10 haplotype 1-2-2-3-2-2-2-2-3-4 PubMed: Cochrane 1996 - - Germline yes - - 0 - DNA SEQ - - CJD - PubMed: Cochran 1996 6-generation family, 10 affecteds ? no United States Ukrain;Jewish-Ashkenazi - 0 - - 10 Johan den Dunnen
+/? 2 c.249_250ins180_227ins204_251{246A>G}ins180_227ins204_251 r.(?) p.(Pro60_Gln67)[12] - Parent #1 - pathogenic g.4680115_4680116ins192 - - - PRNP_000003 13-haplotype 1-2-2-3-2-2-2-2a-2-2-2-3-4 {PMID10581230:Laplanche 1999} - - Germline - - - - - DNA PCR, SEQ - - GSD - - 5-generation family, 11 affecteds ? ? France - - - - - 11 Johan den Dunnen
+/. 2 c.249_250ins180_227ins204_251{246A>G}ins180_251 r.(?) p.(Pro60_Gln67)[11] 12 Parent #1 - pathogenic g.4680115_4680116ins168 - - - PRNP_000004 12 haplotype 1-2-2-3-2-2-2-3g-2-2-3-4 PubMed: Tateishi 1991 - - Germline ? - - 0 - DNA PCR, SEQ - - DEM - - family, 4 affecteds ? ? Japan - - - - - 4 Johan den Dunnen
+?/? 2 c.249_250ins204_227{222G>A}ins204_227{222G>A} r.(?) p.(Pro60_Gln67)[6] - Maternal (confirmed) - likely pathogenic g.4680115_4680116ins48 - - - PRNP_000005 7-haplotype 1-2-2-3-2a-2a-4 {PMID08232966:Goldfarb 1993} - - Germline - - - - - DNA PCRdig, SEQ - - Healthy/Control - - affected proband, mother and maternal grandfather ? ? United States - - - - - 3 Johan den Dunnen
+?/. 2 c.249_250ins204_251ins204_251 r.(?) p.(Pro60_Gln67)[8] 9 Parent #1 - likely pathogenic g.4680115_4680116ins96 - - - PRNP_000008 9 haplotype 1-2-2-3-2-3-2-3-4 PubMed: Goldfarb 1991 - - Germline ? - - 0 - DNA PCR, SEQ - - CIR - - - ? ? United States - - - - - 1 Johan den Dunnen
+/? 2 c.249_250ins204_251ins228_251{246A>G}ins180_227{222G>A}ins204_251ins204_251 r.(?) p.(Pro60_Gln67)[13] - Parent #1 - pathogenic g.4680115_4680116ins216 - - - PRNP_000009 14-haplotype 1-2-2-3-2-3-3g-2-2a-2-3-2-3-4 {PMID08750875:Krasemann 1995} - - Germline - - - - - DNA PCR, SEQ - - DEM - - 5-generation family, 4 affecteds ? ? Germany - - - - - 1 Johan den Dunnen
+?/? 2 c.249_250ins204_251{246A>G}ins180_251 r.(?) p.(Pro60_Gln67)[9] 10 Parent #1 - likely pathogenic g.4680115_4680116ins120 - - - PRNP_000006 10 haplotype 1-2-2-3-2-3g-2-2-3-4 PubMed: Goldfarb 1991 - - Germline - - - 0 - DNA PCR, SEQ - - CJD - - - ? ? United States - - - - - 1 Johan den Dunnen
+?/. 2 c.249_250ins204_251{246A>G}ins180_251 r.(?) p.(Pro60_Gln67)[9] 10 Parent #1 - likely pathogenic g.4680115_4680116ins120 - 5-OPRI - PRNP_000006 10 haplotype 1-2-2-3-2-3g-2-2-3-4 (Northern Ireland) PubMed: Owen 2014 - - Germline yes - - 0 - DNA DSDI, SEQ Blood - ? - PubMed: Mead 2007 - - - United Kingdom (Great Britain) - - 0 - - 1 J Beck
+?/. 2 c.249_250ins204_251{246A>G}ins180_251 r.(?) p.(Pro60_Gln67)[9] 10 Unknown - likely pathogenic g.4680115_4680116ins120 - - - PRNP_000006 10 haplotype 1-2-2-3-2-3g-2-2-3-4 PubMed: Mead 2007 - - Unknown ? - - 0 - DNA SEQ - - PRND - PubMed: Mead 2007 - F no Netherlands - - 0 - - 1 Johan den Dunnen
+/? 2 c.249_250ins204_251{246A>G}ins204_227{222G>A}ins180_227ins204_251{246A>G}ins204_251 r.(?) p.(Pro60_Gln67)[13] - Parent #1 - pathogenic g.4680115_4680116ins216 - - - PRNP_000007 14-haplotype 1-2-2-3-2-3g-2a-2-2-2-3g-2-3-4 {PMID01349721:Owen 1992} - - Germline - - - - - DNA PCR, SEQ - - DEM - - - ? ? United Kingdom (Great Britain) - - - - - 1 Johan den Dunnen
?/? 2 c.290G>A r.(?) p.(Ser97Asn) - Parent #1 - VUS g.4680156G>A g.4699510G>A - - PRNP_000016 - - - rs56362942 Unknown - - - - - DNA SEQ - - Healthy/Control - - - ? ? - (not applicable) - - - - - 1 Johan den Dunnen
+/? 2 c.305C>T r.(?) p.(Pro102Leu) - Parent #1 - pathogenic g.4680171C>T g.4699525C>T - - PRNP_000017 - {PMID02564168:Hsiao 1989} - - Germline - - DdeI+ - - DNA PCRdig, SEQ - - GSD - - 4-generation family, 4 affecteds ? ? United States - - - - - 4 Johan den Dunnen
+/? 2 c.305C>T r.(?) p.(Pro102Leu) - Parent #1 - pathogenic g.4680171C>T g.4699525C>T - - PRNP_000017 - {PMID02564168:Hsiao 1989} - - Germline - - DdeI+ - - DNA PCRdig, SEQ - - GSD - - 4-generation family, 19 affecteds ? ? United Kingdom (Great Britain) - - - - - 19 Johan den Dunnen
+/? 2 c.305C>T r.(?) p.(Pro102Leu) - Parent #1 - pathogenic g.4680171C>T g.4699525C>T - - PRNP_000017 - {PMID10889337:Muramoto 2000} - - Germline - - DdeI+ - - DNA, protein PCRdig, SEQ - - GSD - - - ? ? Japan - - - - - 1 Johan den Dunnen
+/? 2 c.305C>T r.(?) p.(Pro102Leu) - Parent #1 - pathogenic g.4680171C>T g.4699525C>T - - PRNP_000017 - {PMID10889337:Muramoto 2000} - - Germline - - DdeI+ - - DNA, protein PCRdig, SEQ - - GSD - - - ? ? Japan - - - - - 1 Johan den Dunnen
+/? 2 c.305C>T r.(?) p.(Pro102Leu) - Parent #1 - pathogenic g.4680171C>T g.4699525C>T - - PRNP_000017 - {PMID02572450:Goldgaber 1989} - - Germline - - - - - DNA PCRdig, SEQ - - GSD - - family, 3 affecteds ? ? ? (unknown) - - - - - 3 Johan den Dunnen
+/. 2 c.305C>T r.(?) p.(Pro102Leu) - Parent #1 - pathogenic g.4680171C>T g.4699525C>T - - PRNP_000017 - PubMed: Owen 2014 - - Germline - - - 0 - DNA SEQ - - CJD - PubMed: Owen 2014 - - - - - - 0 - - 135 J Beck
+/. 2 c.305C>T r.(?) p.(Pro102Leu) - Maternal (inferred) - likely pathogenic g.4680171C>T g.4699525C>T - - PRNP_000017 - PubMed: Beck 2010 - - Unknown ? - - 0 - DNA SEQ - - GSD - PubMed: Beck 2010 small family, affected male, affected untested brother, sister and mother - - Italy Sicily >61y 0 - - 1 Johan den Dunnen
+/? 2 c.314C>T r.(?) p.(Pro105Leu) - Parent #1 - pathogenic g.4680180C>T g.4699534C>T - - PRNP_000018 - {PMID08461023:Kitamoto 1993} - - Germline - - AluI+ - - DNA PCRdig, SEQ - - GSD - - - ? ? Japan - - - - - 1 Johan den Dunnen
+/? 2 c.314C>T r.(?) p.(Pro105Leu) - Parent #1 - pathogenic g.4680180C>T g.4699534C>T - - PRNP_000018 - {PMID08461023:Kitamoto 1993} - - Germline - - AluI+ - - DNA PCRdig, SEQ - - GSD - - - ? ? Japan - - - - - 1 Johan den Dunnen
+/? 2 c.314C>T r.(?) p.(Pro105Leu) - Parent #1 - pathogenic g.4680180C>T g.4699534C>T - - PRNP_000018 - {PMID08461023:Kitamoto 1993} - - Germline - - AluI+ - - DNA PCRdig, SEQ - - GSD - - - ? ? Japan - - - - - 1 Johan den Dunnen
+/? 2 c.314C>T r.(?) p.(Pro105Leu) - Parent #1 - pathogenic g.4680180C>T g.4699534C>T - - PRNP_000018 - {PMID10408557:Yamada 1993} - - Germline - - - - - DNA PCRdig, SEQ - - DEM - - 3-generation family, 2 affected brothers ? ? Japan - - - - - 2 Johan den Dunnen
+/? 2 c.314C>T r.(?) p.(Pro105Leu) - Paternal (confirmed) - pathogenic g.4680180C>T g.4699534C>T - - PRNP_000018 - {PMID10408557:Yamada 1993} - - Germline - - - - - DNA PCRdig, SEQ - - Healthy/Control - - 3-generation family, young son affected brother ? ? Japan - - - - - 1 Johan den Dunnen
?/? 2 c.314C>T r.(?) p.(Pro105Leu) - Parent #1 - VUS g.4680180C>T g.4699534C>T - - PRNP_000018 - - - rs11538758 Unknown - - - - - DNA SEQ - - Healthy/Control - - - ? ? - (not applicable) - - - - - 1 Johan den Dunnen
+/. 2 c.314C>T r.(?) p.(Pro105Leu) - Paternal (inferred) - pathogenic g.4680180C>T g.4699534C>T - - PRNP_000018 - PubMed: Beck 2010 - - De novo yes - - 0 - DNA SEQ - - PRND - PubMed: Beck 2010 - F ? United Kingdom (Great Britain) - >43y 0 - - 1 Johan den Dunnen
+/. 2 c.314C>T r.(?) p.(Pro105Leu) - Parent #1 - pathogenic g.4680180C>T g.4699534C>T - - PRNP_000018 - PubMed: Owen 2014 - - Germline - - - 0 - DNA SEQ - - ? - - - - - United Kingdom (Great Britain) - - 0 - - 1 J Beck
+/. - c.314C>T r.(?) p.(Pro105Leu) - Unknown ACMG pathogenic (dominant) g.4680180C>T g.4699534C>T - - PRNP_000018 - PubMed: Helbig 2016 - - De novo - - - 0 - DNA SEQ-NG - WES seizures Pat86 PubMed: Helbig 2016 - - - United States - - 0 - - 1 Johan den Dunnen
+/. - c.314C>T r.(?) p.(Pro105Leu) - Unknown - pathogenic g.4680180C>T - PRNP(NM_000311.4):c.314C>T (p.P105L) - PRNP_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 2 c.341G>T r.(?) p.(Gly114Val) - Parent #1 - likely pathogenic g.4680207G>T g.4699561G>T - - PRNP_000044 - PubMed: Beck 2010 - - Unknown ? - - 0 - DNA SEQ - - CJD - PubMed: Beck 2010 - M ? India Inida, south >75y 0 - - 1 Johan den Dunnen
+?/. 2 c.341G>T r.(?) p.(Gly114Val) - Parent #1 - likely pathogenic g.4680207G>T g.4699561G>T - - PRNP_000044 variant not found in controls (Turkey, Uganda (Gujarati)) PubMed: Beck 2010 - - Unknown ? - - 0 - DNA SEQ - - PRND - PubMed: Beck 2010 - F ? Turkey - - 0 - - 1 Johan den Dunnen
-/? 2 c.350C>T r.(?) p.(Ala117Val) - Parent #1 - benign g.4680216C>T g.4699570C>T - - PRNP_000020 - {PMID08829666:Palmer 1996} - - Germline - - - - - DNA PCRdig, SEQ - - ? - - - ? ? ? (unknown) - - - - - 1 Johan den Dunnen
-/? 2 c.350C>T r.(?) p.(Ala117Val) - Parent #1 - benign g.4680216C>T g.4699570C>T - - PRNP_000020 - {PMID08829666:Palmer 1996} - - Germline - - - - - DNA PCRdig, SEQ - - ? - - - ? ? ? (unknown) - - - - - 1 Johan den Dunnen
+/? 2 c.350_351inv r.(?) p.(Ala117Val) - Paternal (inferred) - pathogenic g.4680216_4680217inv g.4699570_4699571inv - - PRNP_000019 - {PMID07501157:Mastrianni 1995} - - Germline - - PvuII- - - DNA PCRdig, SEQ - - GSD - - 5-generation family, 11 affecteds ? ? United States - - - - - 11 Johan den Dunnen
+/. 2 c.350_351inv r.(?) p.(Ala117Val) - Parent #1 - pathogenic g.4680216_4680217inv g.4699570_4699571inv [350C>T;351>4G] (A117V) - PRNP_000019 - PubMed: Owen 2014 - - Germline - - - 0 - DNA SEQ - - - - - - - - - - - 0 - - 1 J Beck
-/? 2 c.351A>G r.(?) p.(=) - Parent #1 - benign g.4680217A>G g.4699571A>G A117A - PRNP_000021 - {PMID02564168:Hsiao 1989} - - Germline - - PvuII- - - DNA PCRdig, SEQ - - GSD - - 4-generation family, 4 affecteds ? ? United States - - - - - 4 Johan den Dunnen
-/? 2 c.351A>G r.(?) p.(=) - Parent #1 - benign g.4680217A>G g.4699571A>G - - PRNP_000021 - {PMID08829666:Palmer 1996} - - Germline - 7/124 chromosomes PvuII- - - DNA PCRdig, SEQ - - Healthy/Control - - - ? ? ? (unknown) - - - - - 7 Johan den Dunnen
-/? 2 c.351A>G r.(?) p.(=) - Maternal (confirmed) - benign g.4680217A>G g.4699571A>G - - PRNP_000021 - {PMID07501157:Mastrianni 1995} - - Germline - - PvuII- - - DNA PCRdig, SEQ - - GSD - - 5-generation family, 11 affecteds ? ? United States - - - - - 11 Johan den Dunnen
-/? 2 c.351A>G r.(?) p.(=) - Parent #2 - benign g.4680217A>G g.4699571A>G A117A - PRNP_000021 - {PMID07902693:Pocchiari 1993} - - Germline - - - - - DNA PCRdig, SEQ - - CJD - - - ? ? Italy - - - - - 1 Johan den Dunnen
-/. - c.351A>G r.(?) p.(Ala117=) - Unknown - benign g.4680217A>G g.4699571A>G PRNP(NM_000311.4):c.351A>G (p.A117=) - PRNP_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.351A>G r.(?) p.(Ala117=) - Unknown - benign g.4680217A>G g.4699571A>G PRNP(NM_000311.4):c.351A>G (p.A117=) - PRNP_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.351A>G r.(?) p.(Ala117=) - Unknown - benign g.4680217A>G g.4699571A>G PRNP(NM_000311.4):c.351A>G (p.A117=) - PRNP_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/? 2 c.372C>G r.(?) p.(=) - Parent #2 - benign g.4680238C>G g.4699592C>G - - PRNP_000022 - {PMID07916191:Ghetti 1994} - - Germline - - - - - DNA PCRdig, SEQ - - GSD - - large multi-generation family ? ? United States - - - - - 1 Johan den Dunnen
-/? 2 c.372C>G r.(?) p.(=) - Parent #1 - benign g.4680238C>G g.4699592C>G 421C>G (G124G) - PRNP_000022 - {PMID10790216:Peoc'h 2000} - - Germline - - EcoO109I- - - DNA PCRdig, SEQ - - CJD - - patient and affected carrier brother ? ? Italy - - - - - 2 Johan den Dunnen
-?/. - c.372C>G r.(?) p.(Gly124=) - Unknown - likely benign g.4680238C>G - PRNP(NM_000311.4):c.372C>G (p.G124=) - PRNP_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.372C>G r.(?) p.(Gly124=) - Unknown - likely benign g.4680238C>G - PRNP(NM_000311.4):c.372C>G (p.G124=) - PRNP_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/? 2 c.385A>G r.(?) p.(Met129Val) - Paternal (inferred) - likely benign g.4680251A>G g.4699605A>G - - PRNP_000023 - {PMID07501157:Mastrianni 1995} - - Germline - - - - - DNA PCRdig, SEQ - - GSD - - 5-generation family, 11 affecteds ? ? United States - - - - - 11 Johan den Dunnen
-?/? 2 c.385A>G r.(?) p.(Met129Val) - Maternal (confirmed) - likely benign g.4680251A>G g.4699605A>G - - PRNP_000023 - {PMID07501157:Mastrianni 1995} - - Germline - - - - - DNA PCRdig, SEQ - - GSD - - 5-generation family, 11 affecteds ? ? United States - - - - - 11 Johan den Dunnen
-?/? 2 c.385A>G r.(?) p.(Met129Val) - Parent #1 - likely benign g.4680251A>G g.4699605A>G - - PRNP_000023 - {PMID08461023:Kitamoto 1993} - - Germline - - - - - DNA PCRdig, SEQ - - GSD - - - ? ? Japan - - - - - 1 Johan den Dunnen
-?/? 2 c.385A>G r.(?) p.(Met129Val) - Parent #1 - likely benign g.4680251A>G g.4699605A>G - - PRNP_000023 - {PMID08461023:Kitamoto 1993} - - Germline - - - - - DNA PCRdig, SEQ - - GSD - - - ? ? Japan - - - - - 1 Johan den Dunnen
-?/? 2 c.385A>G r.(?) p.(Met129Val) - Parent #1 - likely benign g.4680251A>G g.4699605A>G - - PRNP_000023 - {PMID08461023:Kitamoto 1993} - - Germline - - - - - DNA PCRdig, SEQ - - GSD - - - ? ? Japan - - - - - 1 Johan den Dunnen
-?/? 2 c.385A>G r.(?) p.(Met129Val) - Parent #1 - likely benign g.4680251A>G g.4699605A>G - - PRNP_000023 - {PMID07916191:Ghetti 1994} - - Germline - - - - - DNA PCRdig, SEQ - - GSD - - large multi-generation family ? ? United States - - - - - 1 Johan den Dunnen
-?/? 2 c.385A>G r.(?) p.(Met129Val) - Parent #1 - likely benign g.4680251A>G g.4699605A>G - - PRNP_000023 - {PMID07916191:Ghetti 1994} - - Germline - - - - - DNA PCRdig, SEQ - - GSD - - large multi-generation family ? ? United States - - - - - 1 Johan den Dunnen
-?/? 2 c.385A>G r.(?) p.(Met129Val) - Parent #1 - likely benign g.4680251A>G g.4699605A>G - - PRNP_000023 - {PMID07783865:Reder 1995} - - Germline - - - - - DNA PCRdig, SEQ - - FFI - - - ? ? United States - - - - - 1 Johan den Dunnen
-?/? 2 c.385A>G r.(?) p.(Met129Val) - Maternal (confirmed) - likely benign g.4680251A>G g.4699605A>G - - PRNP_000023 - {PMID07783865:Reder 1995} - - Germline - - - - - DNA PCRdig, SEQ - - FFI - - - ? ? United States - - - - - 1 Johan den Dunnen
-?/? 2 c.385A>G r.(?) p.(Met129Val) - Parent #1 - likely benign g.4680251A>G g.4699605A>G - - PRNP_000023 - {PMID08030960:Masullo 1994} - - Germline - - - - - DNA PCRdig, SEQ - - DEM - - - ? ? Italy - - - - - 1 Johan den Dunnen
Legend   How to query   « First ‹ Prev     1 2     Next › Last »