All transcript variants in gene PRODH

Information The variants shown are described using the NM_016335.4 transcript reference sequence.

49 entries on 1 page. Showing entries 1 - 49.



AscendingDNA change (cDNA)     


RNA change     


DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







./. - c.-2906700_*61401dup - r.? p.? g.18839287_21830562dup - - - ARVCF_000005 increased gene dosage PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - 0 - Johan den Dunnen
./. - c.-2540257_*7125del - - - g.18893563_21464119del - - - ARVCF_000003 decreased gene dosage PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - 0 - Johan den Dunnen
./. - c.-2540257_*11649del - r.0? p.0? g.18889039_21464119del - - - ARVCF_000002 decreased gene dosage PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - 0 - Johan den Dunnen
-/. - c.56C>A benign r.(?) p.(Pro19Gln) g.18923745G>T - PRODH(NM_016335.4):c.56C>A (p.P19Q) - PRODH_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.130_156del VUS r.(?) p.(Thr44_Ala52del) g.18923648_18923674del - PRODH(NM_016335.4):c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC (p.T44_A52del) - PRODH_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. - c.553T>C benign r.(?) p.(Trp185Arg) g.18912678A>G - PRODH(NM_016335.4):c.553T>C (p.W185R) - PRODH_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.578G>A VUS r.(?) p.(Gly193Asp) g.18912653C>T - PRODH(NM_016335.4):c.578G>A (p.G193D) - PRODH_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.668-64G>C benign r.(=) p.(=) g.18910756C>G - PRODH(NM_016335.4):c.668-64G>C - PRODH_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.703C>T VUS r.(?) p.(Leu235Phe) g.18910657G>A - PRODH(NM_016335.4):c.703C>T (p.L235F) - PRODH_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. - c.733-5del benign r.spl? p.? g.18910453del - PRODH(NM_016335.4):c.733-5delT - PRODH_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.772T>G VUS r.(?) p.(Phe258Val) g.18910407A>C - PRODH(NM_016335.4):c.772T>G (p.F258V) - PRODH_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.865T>A VUS r.(?) p.(Leu289Met) g.18909902A>T - PRODH(NM_016335.4):c.865T>A (p.L289M) - PRODH_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
+/. - c.930-1G>C pathogenic r.spl? p.? g.18908937C>G - PRODH(NM_016335.4):c.930-1G>C - PRODH_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.991T>C benign r.(?) p.(=) g.18908875A>G - PRODH(NM_016335.4):c.991T>C (p.L331=) - PRODH_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.1093G>T VUS r.(?) p.(Val365Phe) g.18907230C>A - PRODH(NM_016335.4):c.1093G>T (p.V365F) - PRODH_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. - c.1105-14C>T benign r.(=) p.(=) g.18907124G>A - PRODH(NM_016335.4):c.1105-14C>T - PRODH_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.1163C>T VUS r.(?) p.(Pro388Leu) g.18907052G>A - PRODH(NM_016335.4):c.1163C>T (p.P388L) - PRODH_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.1278C>T benign r.(?) p.(=) g.18905978G>A - PRODH(NM_016335.4):c.1278C>T (p.D426=) - PRODH_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.1292G>A likely benign r.(?) p.(Arg431His) g.18905964C>T - PRODH(NM_016335.4):c.1292G>A (p.R431H) - PRODH_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.1322T>C VUS r.(?) p.(Leu441Pro) g.18905934A>G - PRODH(NM_016335.4):c.1322T>C (p.Leu441Pro) - PRODH_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.1322T>C VUS r.(?) p.(Leu441Pro) g.18905934A>G - PRODH(NM_016335.4):c.1322T>C (p.Leu441Pro) - PRODH_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
+/. - c.1357C>T - r.(?) p.(Arg453Cys) g.18905899G>A - - - PRODH_000025 - Papuc et al., submitted - rs3970559 Germline - - - 0 - Anaïs Begemann
+/. - c.1357C>T pathogenic r.(?) p.(Arg453Cys) g.18905899G>A - PRODH(NM_016335.4):c.1357C>T (p.R453C) - PRODH_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.1357C>T VUS r.(?) p.(Arg453Cys) g.18905899G>A - PRODH(NM_016335.4):c.1357C>T (p.R453C) - PRODH_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.1397C>T benign r.(?) p.(Thr466Met) g.18905859G>A - PRODH(NM_016335.4):c.1397C>T (p.T466M) - PRODH_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.1445T>C likely benign r.(?) p.(Leu482Ser) g.18904484A>G - PRODH(NM_001195226.1):c.1121T>C (p.(Leu374Ser), p.(Leu482Ser)) - PRODH_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.1459C>T likely benign r.(?) p.(His487Tyr) g.18904470G>A - PRODH(NM_001195226.1):c.1135C>T (p.(His379Tyr), p.(His487Tyr)) - PRODH_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.1463A>G likely benign r.(?) p.(Asn488Ser) g.18904466T>C - PRODH(NM_001195226.1):c.1139A>G (p.(Asn380Ser), p.(Asn488Ser)) - PRODH_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.1515T>C benign r.(?) p.(=) g.18904414A>G - PRODH(NM_016335.4):c.1515T>C (p.F505=) - PRODH_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.1562G>A benign r.(?) p.(Arg521Gln) g.18901004C>T - PRODH(NM_016335.4):c.1562G>A (p.R521Q) - PRODH_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
+/. 14 c.1562G>A - r.(?) p.(Arg521Gln) g.18901004C>T - 1562A>G (Gln521Arg) - PRODH_000024 - Papuc et al., submitted - rs450046 Germline - - - 0 - Anaïs Begemann
-?/. - c.1616-9C>T likely benign r.(=) p.(=) g.18900884G>A - PRODH(NM_016335.4):c.1616-9C>T - PRODH_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.1687C>T VUS r.(?) p.(Arg563Cys) g.18900804G>A - PRODH(NM_001195226.1):c.1363C>T (p.(Arg455Cys), p.(Arg563Cys)) - PRODH_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.1727A>G likely benign r.(?) p.(His576Arg) g.18900764T>C - PRODH(NM_001195226.1):c.1403A>G (p.(His468Arg), p.(His576Arg)) - PRODH_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.1741C>T benign r.(?) p.(=) g.18900750G>A - PRODH(NM_016335.4):c.1741C>T (p.L581=) - PRODH_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.*19T>C benign r.(=) p.(=) g.18900669A>G - PRODH(NM_016335.4):c.*19T>C - PRODH_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.*1500G>C likely benign r.(=) p.(=) g.18899188C>G - DGCR6(NM_005675.4):c.649C>G (p.(Pro217Ala)) - DGCR6_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.*1520T>A likely benign r.(=) p.(=) g.18899168A>T - DGCR6(NM_005675.4):c.629A>T (p.(Gln210Leu)) - DGCR6_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.*2157G>A likely benign r.(=) p.(=) g.18898531C>T - DGCR6(NM_005675.4):c.503C>T (p.(Thr168Ile)) - DGCR6_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.*2220C>T likely benign r.(=) p.(=) g.18898468G>A - DGCR6(NM_005675.4):c.440G>A (p.(Arg147Gln)) - DGCR6_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.*2268C>T likely benign r.(=) p.(=) g.18898420G>A - DGCR6(NM_005675.4):c.392G>A (p.(Arg131His)) - DGCR6_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.*2274C>T likely benign r.(=) p.(=) g.18898414G>A - DGCR6(NM_005675.4):c.386G>A (p.(Arg129Gln)) - DGCR6_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.*2275G>A likely benign r.(=) p.(=) g.18898413C>T - DGCR6(NM_005675.4):c.385C>T (p.(Arg129Trp)) - DGCR6_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.*2285C>T VUS r.(=) p.(=) g.18898403G>A - DGCR6(NM_005675.4):c.375G>A (p.(=)) - DGCR6_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.*2293G>A likely benign r.(=) p.(=) g.18898395C>T - DGCR6(NM_005675.4):c.373-6C>T (p.(=)) - DGCR6_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.*2917G>A VUS r.(=) p.(=) g.18897771C>T - DGCR6(NM_005675.4):c.358C>T (p.(Gln120Ter)) - DGCR6_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.*2925G>A likely benign r.(=) p.(=) g.18897763C>T - DGCR6(NM_005675.4):c.350C>T (p.(Ala117Val)) - DGCR6_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.*2932G>C likely benign r.(=) p.(=) g.18897756C>G - DGCR6(NM_005675.4):c.343C>G (p.(Leu115Val)) - DGCR6_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.*2932G>T likely benign r.(=) p.(=) g.18897756C>A - DGCR6(NM_005675.4):c.343C>A (p.(Leu115Ile)) - DGCR6_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL