Full data view for gene PRODH

Information The variants shown are described using the NM_016335.4 transcript reference sequence.

46 entries on 1 page. Showing entries 1 - 46.
Legend  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
./. - c.-2906700_*61401dup r.? p.? Unknown - pathogenic (recessive) g.18839287_21830562dup - - - ARVCF_000005 increased gene dosage PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - 0 - DNA SEQ, SEQ-NG-I - - ? - PubMed: DDDS 2015, Journal: DDDS 2015 family, 1 affected F - United Kingdom (Great Britain) - - 0 Decipher - 1 Johan den Dunnen
./. - c.-2540257_*7125del - - Unknown - pathogenic (recessive) g.18893563_21464119del - - - ARVCF_000003 decreased gene dosage PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - 0 - DNA SEQ, SEQ-NG-I - - ? - PubMed: DDDS 2015, Journal: DDDS 2015 family, 1 affected F - United Kingdom (Great Britain) - - 0 Decipher - 1 Johan den Dunnen
./. - c.-2540257_*11649del r.0? p.0? Unknown - pathogenic (recessive) g.18889039_21464119del - - - ARVCF_000002 decreased gene dosage PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - 0 - DNA SEQ, SEQ-NG-I - - ? - PubMed: DDDS 2015, Journal: DDDS 2015 family, affected father/child F - United Kingdom (Great Britain) - - 0 Decipher - 2 Johan den Dunnen
-/. - c.56C>A r.(?) p.(Pro19Gln) Unknown - benign g.18923745G>T - PRODH(NM_016335.4):c.56C>A (p.P19Q) - PRODH_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.130_156del r.(?) p.(Thr44_Ala52del) Unknown - VUS g.18923648_18923674del - PRODH(NM_016335.4):c.130_156delACGGCAGTGCGGCCGCCGGTGCCCGCC (p.T44_A52del) - PRODH_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.553T>C r.(?) p.(Trp185Arg) Unknown - benign g.18912678A>G - PRODH(NM_016335.4):c.553T>C (p.W185R) - PRODH_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.554G>A r.(?) p.(Trp185*) Parent #1 - - g.18912677C>T g.18925164C>T - - PRODH_000032 100 heterozygous; Clinindb (India) Faruq 2020, submtted - rs11913840 Germline - 100/2795 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - Faruq 2020, submitted analysis 2794 individuals (India) - - India - - 0 - - 100 Mohammed Faruq
-/. - c.554G>A r.(?) p.(Trp185*) Both (homozygous) - benign g.18912677C>T g.18925164C>T - - PRODH_000032 1 homozygous; Clinindb (India) Faruq 2020, submtted - rs11913840 Germline - 1/2795 individuals - 0 - DNA arraySNP - Infinium Global Screening Array v1.0 ? - Faruq 2020, subitted analysis 2794 individuals (India) - - India - - 0 - - 1 Mohammed Faruq
?/. - c.578G>A r.(?) p.(Gly193Asp) Unknown - VUS g.18912653C>T - PRODH(NM_016335.4):c.578G>A (p.G193D) - PRODH_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.668-64G>C r.(=) p.(=) Unknown - benign g.18910756C>G - PRODH(NM_016335.4):c.668-64G>C - PRODH_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.703C>T r.(?) p.(Leu235Phe) Unknown - VUS g.18910657G>A - PRODH(NM_016335.4):c.703C>T (p.L235F) - PRODH_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.733-5del r.spl? p.? Unknown - benign g.18910453del - PRODH(NM_016335.4):c.733-5delT - PRODH_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.772T>G r.(?) p.(Phe258Val) Unknown - VUS g.18910407A>C - PRODH(NM_016335.4):c.772T>G (p.F258V) - PRODH_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.865T>A r.(?) p.(Leu289Met) Unknown - VUS g.18909902A>T - PRODH(NM_016335.4):c.865T>A (p.L289M) - PRODH_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.930-1G>C r.spl? p.? Unknown - pathogenic g.18908937C>G - PRODH(NM_016335.4):c.930-1G>C - PRODH_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.991T>C r.(?) p.(=) Unknown - benign g.18908875A>G - PRODH(NM_016335.4):c.991T>C (p.L331=) - PRODH_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1093G>T r.(?) p.(Val365Phe) Unknown - VUS g.18907230C>A - PRODH(NM_016335.4):c.1093G>T (p.V365F) - PRODH_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1105-14C>T r.(=) p.(=) Unknown - benign g.18907124G>A - PRODH(NM_016335.4):c.1105-14C>T - PRODH_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1126C>T r.(?) p.(Arg376Trp) Unknown - VUS g.18907089G>A - PRODH(NM_016335.4):c.1126C>T (p.R376W) - PRODH_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1163C>T r.(?) p.(Pro388Leu) Unknown - VUS g.18907052G>A - PRODH(NM_016335.4):c.1163C>T (p.P388L) - PRODH_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1278C>T r.(?) p.(=) Unknown - benign g.18905978G>A - PRODH(NM_016335.4):c.1278C>T (p.D426=) - PRODH_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1292G>A r.(?) p.(Arg431His) Unknown - likely benign g.18905964C>T - PRODH(NM_016335.4):c.1292G>A (p.R431H) - PRODH_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1322T>C r.(?) p.(Leu441Pro) Unknown - VUS g.18905934A>G - PRODH(NM_016335.4):c.1322T>C (p.L441P) - PRODH_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1322T>C r.(?) p.(Leu441Pro) Unknown - VUS g.18905934A>G - PRODH(NM_016335.4):c.1322T>C (p.L441P) - PRODH_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.1322T>C r.(?) p.(Leu441Pro) Paternal (confirmed) - pathogenic (recessive) g.18905934A>G g.18918421A>G - - PRODH_000012 - - - - Germline - - - 0 - DNA SEQ-NG-I - - EE - - - - - - - - 0 - - 1 Francesca Bisulli
?/. - c.1322T>C r.(?) p.(Leu441Pro) Unknown - VUS g.18905934A>G - PRODH(NM_016335.4):c.1322T>C (p.L441P) - PRODH_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1357C>T r.(?) p.(Arg453Cys) Maternal (confirmed) - - g.18905899G>A - - - PRODH_000025 - Papuc et al., submitted - rs3970559 Germline - - - 0 - DNA SEQ-NG-I blood WES EE 62075 - - F no Switzerland ancestors from Switzerland and South Italy - 0 - - 1 Anaïs Begemann
+/. - c.1357C>T r.(?) p.(Arg453Cys) Unknown - pathogenic g.18905899G>A - PRODH(NM_016335.4):c.1357C>T (p.R453C) - PRODH_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1357C>T r.(?) p.(Arg453Cys) Unknown - VUS g.18905899G>A - PRODH(NM_016335.4):c.1357C>T (p.R453C) - PRODH_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1397C>T r.(?) p.(Thr466Met) Unknown - benign g.18905859G>A - PRODH(NM_016335.4):c.1397C>T (p.T466M) - PRODH_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.1397C>T r.(?) p.(Thr466Met) Maternal (confirmed) - pathogenic (recessive) g.18905859G>A g.18918346G>A - - PRODH_000011 - - - - Germline - - - 0 - DNA SEQ-NG-I - - EE - - - - - - - - 0 - - 1 Francesca Bisulli
-?/. - c.1463A>G r.(?) p.(Asn488Ser) Unknown - likely benign g.18904466T>C - PRODH(NM_001195226.1):c.1139A>G (p.(Asn380Ser)), PRODH(NM_016335.4):c.1463A>G (p.N488S) - PRODH_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1463A>G r.(?) p.(Asn488Ser) Unknown - likely benign g.18904466T>C - PRODH(NM_001195226.1):c.1139A>G (p.(Asn380Ser)), PRODH(NM_016335.4):c.1463A>G (p.N488S) - PRODH_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1515T>C r.(?) p.(=) Unknown - benign g.18904414A>G - PRODH(NM_016335.4):c.1515T>C (p.F505=) - PRODH_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1562G>A r.(?) p.(Arg521Gln) Unknown - benign g.18901004C>T - PRODH(NM_016335.4):c.1562G>A (p.R521Q) - PRODH_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. 14 c.1562G>A r.(?) p.(Arg521Gln) Unknown - - g.18901004C>T - 1562A>G (Gln521Arg) - PRODH_000024 - Papuc et al., submitted - rs450046 Germline - - - 0 - DNA SEQ-NG-I blood WES EE 62075 - - F no Switzerland ancestors from Switzerland and South Italy - 0 - - 1 Anaïs Begemann
-?/. - c.1616-9C>T r.(=) p.(=) Unknown - likely benign g.18900884G>A - PRODH(NM_016335.4):c.1616-9C>T - PRODH_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1741C>T r.(?) p.(=) Unknown - benign g.18900750G>A - PRODH(NM_016335.4):c.1741C>T (p.L581=) - PRODH_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.*19T>C r.(=) p.(=) Unknown - benign g.18900669A>G - PRODH(NM_016335.4):c.*19T>C - PRODH_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*2220C>T r.(=) p.(=) Unknown - likely benign g.18898468G>A - DGCR6(NM_005675.4):c.440G>A (p.(Arg147Gln)) - DGCR6_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*2268C>T r.(=) p.(=) Unknown - likely benign g.18898420G>A - DGCR6(NM_005675.4):c.392G>A (p.(Arg131His)) - DGCR6_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.*2285C>T r.(=) p.(=) Unknown - VUS g.18898403G>A - DGCR6(NM_005675.4):c.375G>A (p.(=)) - DGCR6_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*2293G>A r.(=) p.(=) Unknown - likely benign g.18898395C>T - DGCR6(NM_005675.4):c.373-6C>T (p.(=)) - DGCR6_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.*2917G>A r.(=) p.(=) Unknown - VUS g.18897771C>T - DGCR6(NM_005675.4):c.358C>T (p.(Gln120Ter)) - DGCR6_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*2932G>C r.(=) p.(=) Unknown - likely benign g.18897756C>G - DGCR6(NM_005675.4):c.343C>G (p.(Leu115Val)) - DGCR6_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.*2932G>T r.(=) p.(=) Unknown - likely benign g.18897756C>A - DGCR6(NM_005675.4):c.343C>A (p.(Leu115Ile)) - DGCR6_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
Legend