Unique variants in the PROS1 gene

Information The variants shown are described using the NM_000313.3 transcript reference sequence.

22 entries on 1 page. Showing entries 1 - 22.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+?/. 1 - c.? r.0? p.0? - likely pathogenic g.93516594_96012342del - chr3:g.93516594_96012342del - ARL13B_000040 heterozygous PubMed: Turro 2020 - - Germline/De novo (untested) ? - - - - LOVD
+/. 1 - c.50dup r.(?) p.(Val18Serfs*21) - pathogenic g.93692544dup - - - PROS1_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.234G>T r.(?) p.(=) - VUS g.93646094C>A - PROS1(NM_000313.3):c.234G>T (p.(Thr78Thr)) - PROS1_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.284G>A r.(?) p.(Gly95Glu) - VUS g.93629525C>T - PROS1(NM_000313.4):c.284G>A (p.(Gly95Glu)) - PROS1_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
./. 1 - c.346+1651C>T r.(=) p.(=) - VUS g.93627812G>A g.93908968G>A - - PROS1_000003 for details see the Uveogene database PubMed: Yang 2016 - rs4857037 Germline - 161/304 cases - - - Peizeng Yang
-?/. 1 - c.688G>A r.(?) p.(Glu230Lys) - likely benign g.93619687C>T - PROS1(NM_000313.3):c.688G>A (p.(Glu230Lys)) - PROS1_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.698G>A r.(?) p.(Arg233Lys) - likely benign g.93619677C>T - - - PROS1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.701A>G r.(?) p.(Tyr234Cys) - likely pathogenic g.93619674T>C - - - PROS1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.814G>A r.(?) p.(Gly272Arg) - VUS g.93617327C>T - - - PROS1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.1063C>T r.(?) p.(Arg355Cys) - pathogenic g.93611869G>A g.93893025G>A - - PROS1_000006 2 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs387906674 Germline - 2/2795 individuals - - - Mohammed Faruq
+?/. 1 - c.1064G>A r.(?) p.(Arg355His) - likely pathogenic g.93611868C>T g.93893024C>T - - PROS1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.1149G>A r.(?) p.(Trp383*) - pathogenic g.93611783C>T - - - PROS1_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.1323+33A>G r.(=) p.(=) - VUS g.93605147T>C - - - PROS1_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.1334G>A r.(?) p.(Arg445His) - VUS g.93603730C>T - PROS1(NM_000313.4):c.1334G>A (p.(Arg445His)) - PROS1_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 2 - c.1501T>C r.(?) p.(Ser501Pro) - VUS g.93598150A>G g.93879306A>G - - PROS1_000005 conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; Clinindb (India), 1 more item PubMed: Narang 2020, Journal: Narang 2020 - rs121918472 CLASSIFICATION record, Germline - 2/2794 individuals - - - VKGL-NL_Nijmegen, Mohammed Faruq
-?/. 1 - c.1630T>G r.(?) p.(Ser544Ala) - likely benign g.93598021A>C - PROS1(NM_000313.3):c.1630T>G (p.(Ser544Ala)) - PROS1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1682G>A r.(?) p.(Arg561Gln) - VUS g.93595998C>T - PROS1(NM_000313.4):c.1682G>A (p.(Arg561Gln)) - PROS1_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1747A>C r.(?) p.(Asn583His) - likely benign g.93595933T>G - PROS1(NM_000313.4):c.1747A>C (p.(Asn583His)) - PROS1_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1894G>A r.(?) p.(Val632Met) - VUS g.93593226C>T - PROS1(NM_000313.4):c.1894G>A (p.(Val632Met)) - PROS1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 - c.1912G>A r.(?) p.(Gly638Ser) - likely pathogenic g.93593208C>T - - - PROS1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 2 - c.2001A>G r.(?) p.(Pro667=) - benign g.93593119T>C g.93874275T>C PROS1(NM_000313.4):c.2001A>G (p.P667=) - PROS1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen
?/. 1 - c.2003_2005delins[1983_1998;CCAT;[NC_000003.11:g.90251491_90251569];C] r.(?) p.(Ser668_Ser676delinsLeuGluLeuThrHisValHisSerTyr) - VUS g.93593115_93593117delins[G;[NC_000003.11:g.90251491_90251569];GAGTGTACATGAGTGAGCTCTA] g.93874271_93874273delins[G;[NC_000003.11:g.90251491_90251569];GAGTGTACATGAGTGAGCTCTA] - - PROS1_000002 1 more item - - - Germline ? - - - - Gemeinschaftspraxis für Humangenetik Dresden
Legend   How to query  


Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.