Unique variants in gene SLC26A3

Information The variants shown are described using the NM_000111.2 transcript reference sequence.

93 entries on 1 page. Showing entries 1 - 93.




AscendingDNA change (cDNA)     


RNA change     


DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     

Germline/De novo/Somatic     






+?/+? 1 _1_1i c.-211-?_-89+?del - r.? p.? g.(?_107443556)_(107443678_?)del g.107803111_107803233del 8.6 kb deletion: Exon 1 deletion - SLC26A3_000110 1 Swedish DIAR1 patient PubMed: Wedenoja et al. 2011 - - SUMMARY record yes - - - - Anne Polvi
?/? 1 2 c.119A>G - r.(?) p.(Lys40Arg) g.107434836T>C g.107794391T>C - - SLC26A3_000053 - PubMed: Wedenoja 2011 - rs78133952 Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 2i c.131+2_131+3ins288 - r.? p.? g.107434821_107434822ins288 - c.131+2_131+3insU14569.1 - SLC26A3_000083 1 more item PubMed: Wedenoja et al. 2011 - - SUMMARY record yes - - - - Anne Polvi
?/? 1 2i c.131+2_131+3insU14569.1 - r.(?) p.(=) g.107434821_107434822insU14569.1 - - - SLC26A3_000071 Intron donor site change PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+?, ?/? 2 3 c.145_157del - r.(145_157del), r.(?) p.(Lys49Leufs*8) g.107434301_107434313del g.107793856_107793868del c.145-157del13bp - SLC26A3_000001 2 Belgian siblings (Togo ancestry; hom) with DIAR1 PubMed: Makela et al. 2002, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
./. 1 - c.167_168del - r.(?) p.(Ser56Phefs*14) g.107434290_107434291del g.107793845_107793846del NM_000111.2(SLC26A3):c.167_168del p.(Ser56Phefs*14) - SLC26A3_000139 variant could not be associated with disease phenotype PubMed: Vogelaar 2017, Journal: Vogelaar 2017 - - Germline - - - - - -
+?/+? 1 3 c.177dup - r.(177dup) p.(Ile60Hisfs*11) g.107434281dup g.107793836dup c.177-178insC - SLC26A3_000104 1 North American DIAR1 patient (com-het) PubMed: Höglung et al. 1998 - - SUMMARY record yes - - - - Anne Polvi
?/? 1 3 c.203G>A - r.(?) p.(Arg68Gln) g.107434255C>T g.107793810C>T - - SLC26A3_000054 - PubMed: Wedenoja 2011 - rs10280704 Unknown - - - - - Ivo F.A.C. Fokkema
?/?, +?/+? 2 3 c.269_270insAA - r.(?), r.(269_270insaa) p.(Gly91Lysfs*3) g.107434188_107434189insTT g.107793743_107793744insTT c.268-269insAA - SLC26A3_000003 3 sisters from Hong Kong (com-het) with DIAR1 PubMed: Wedenoja 2011, PubMed: Höglung et al. 1998b - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/? 1 3i_8i c.271+?_972-?del - r.(?) p.(Gly91Aspfs*17) g.107423797_107434187del g.107783352_107793742del - - SLC26A3_000072 7 kb deletion; Exon 4 to 8 deletion PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 3i_8i c.272-?_971+?del - r.(272_971del) p.(Gly91Aspfs*17) g.(?_107427272)_(107432385_?)del g.107786827_107791940del 7 kb deletion: Exon 4 to 8 deletion - SLC26A3_000115 1 Austrian DIAR1 patient PubMed: Wedenoja et al. 2011 - - SUMMARY record yes - - - - Anne Polvi
?/?, +?/+? 2 4 c.332del - r.(?), r.(332del) p.(Phe111Serfs*4) g.107432325del g.107791880del c.332del - SLC26A3_000004 1 Swedish DIAR1 patient PubMed: Wedenoja 2011, PubMed: Wedenoja et al. 2011 - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/? 1 4 c.332T>C - r.(?) p.(Phe111Ser) g.107432325A>G g.107791880A>G - - SLC26A3_000055 - PubMed: Wedenoja 2011 - rs75733585 Unknown - - - - - Ivo F.A.C. Fokkema
?/? 1 4 c.344del - r.(?) p.(Ile115Thrfs*19) g.107432313del g.107791868del - - SLC26A3_000005 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 4 c.344delT - r.(344delu) p.(Ile115Thrfs*19) g.107432313delA g.107791868delA c.344delT - SLC26A3_000117 2 Polish DIAR1 families ( 1 hom and 1 het) PubMed: Höglung et al. 1996 - - SUMMARY record yes 0/159 CON - - - Anne Polvi
?/? 1 4 c.357C>T - r.(=) p.(=) g.107432300G>A g.107791855G>A - - SLC26A3_000056 - PubMed: Wedenoja 2011 - rs73419912 Unknown - - - - - Ivo F.A.C. Fokkema
?/?, +?/+? 2 4 c.358G>A - r.(?), r.(358g>a) p.(Gly120Ser) g.107432299C>T g.107791854C>T c.358G>A - SLC26A3_000006 1 Polish, 1 Swedish and 1 Norwegian DIAR1 family (all com-het) PubMed: Wedenoja 2011, PubMed: Höglung et al. 1998, PubMed: Höglung et al. 2001b - - Unknown, SUMMARY record yes 0/100 CON - - - Ivo F.A.C. Fokkema, Anne Polvi
?/?, +?/+? 2 4 c.371A>T - r.(?), r.(371a>u) p.(His124Leu) g.107432286T>A g.107791841T>A c.371A>T - SLC26A3_000007 3 Polish (2 com-het) and 1 French DIAR1 family PubMed: Wedenoja 2011, 1 more item - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/?, +?/+? 2 5 c.386C>T - r.(?), r.(386c>u) p.(Pro129Leu) g.107431677G>A g.107791232G>A c.386C>T - SLC26A3_000008 1 Austrian DIAR1 patient PubMed: Wedenoja 2011, PubMed: Wedenoja et al. 2011 - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/?, +?/+? 2 5 c.392C>G - r.(?), r.(392c>g) p.(Pro131Arg) g.107431671G>C g.107791226G>C c.392C>A - SLC26A3_000010 2 North American DIAR1 patients (1 com-het and 1 het) PubMed: Wedenoja 2011, PubMed: Höglung et al. 1998 - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/?, +?/+? 2 5 c.392C>T - r.(?), r.(392c>u) p.(Pro131Leu) g.107431671G>A g.107791226G>A c.392C>T - SLC26A3_000011 1 American DIAR1 patient and 2 Korean siblings with DIAR1 PubMed: Wedenoja 2011, PubMed: Wedenoja et al. 2011, PubMed: Hong et al. 2013 - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/?, +?/+? 2 5 c.392del - r.(?), r.(392del) p.(Pro131Argfs*3) g.107431671del g.107791226del c.392del - SLC26A3_000009 1 Austrian DIAR1 patient PubMed: Wedenoja 2011, PubMed: Wedenoja et al. 2011 - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
+?/+? 1 5 c.401G>A - r.(?) p.(Ser134Asn) g.107431662C>T g.107791217C>T r.(401g>a) - SLC26A3_000136 1 Korean DIAR1 patient (com-het) PubMed: Hong et al. 2013 - - SUMMARY record yes - - - - Anne Polvi
?/?, +?/+? 2 5 c.408G>A - r.(?), r.(408g>a) p.(Met136Ile) g.107431655C>T g.107791210C>T c.408G>A - SLC26A3_000012 1 English DIAR1 patient PubMed: Wedenoja 2011, PubMed: Wedenoja et al. 2011 - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/? 1 5 c.514G>A - r.(?) p.(Glu172Lys) g.107431549C>T g.107791104C>T - - SLC26A3_000057 - PubMed: Wedenoja 2011 - rs71566741 Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 5 c.525G>C - r.(525g>c) p.(Arg175Ser) g.107431538C>G g.107791093C>G c.525G>C: p.Arg175 Ser - SLC26A3_000125 1 Korean DIAR1 patient (com-het) PubMed: Lee et al 2012 - - SUMMARY record yes 0/188 CON - - - Anne Polvi
?/?, +?/+? 2 5 c.559G>T - r.(?), r.(559g>u) p.(Gly187*) g.107431504C>A g.107791059C>A c.559G>T - SLC26A3_000013 Arabic major DIAR1 mutation: >20 Kuwaiti and Saudi Arabian DIAR1 patients. Also patient from UK. PubMed: Wedenoja 2011, PubMed: Höglung et al. 1998b, PubMed: Wedenoja et al. 2011 - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/?, +?/+? 2 5, 5i c.571-2A>G - r.(=), r.spl? p.(=), p.? g.107430135T>C g.107789690T>C IVS5-2A>G - SLC26A3_000014 1 Canadian DIAR1 patient (com-het) PubMed: Wedenoja 2011, PubMed: Höglung et al. 1998b - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/?, +?/+? 2 5, 5i c.571-1G>T - r.(=), r.spl? p.(=), p.? g.107430134C>A g.107789689C>A IVS5-1G>T - SLC26A3_000015 1 North American DIAR1 patient (com-het) PubMed: Wedenoja 2011, PubMed: Höglung et al. 1998b - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/?, +?/+? 2 6 c.610T>G - r.(?), r.(610u>g) p.(Tyr204Asp) g.107430094A>C g.107789649A>C c.610T>G - SLC26A3_000016 1 Spanish DIAR1 patient PubMed: Wedenoja 2011, PubMed: Wedenoja et al. 2011 - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/?, +?/+? 2 6 c.616T>C - r.(?), r.(616u>c) p.(Ser206Pro) g.107430088A>G g.107789643A>G c.616A>C: S206P - SLC26A3_000017 1 Dutch DIAR1 family (Moroccan ancestry) PubMed: Wedenoja 2011, PubMed: Höglung et al. 2001b - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/?, +?/+? 2 6 c.659A>C - r.(?), r.(659a>c) p.(His220Pro) g.107430045T>G g.107789600T>G 659A>C - SLC26A3_000018 2 Andalusian (southern Spain) sibs (com-het) and 1 Spanish patient with DIAR1 PubMed: Wedenoja 2011, PubMed: Rodriques-Herrera et al. 2011, PubMed: Wedenoja et al. 2011 - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/? 1 6i_8i c.735+?_972-?del - r.(?) p.(Val246Ilefs*8) g.107423797_107429969del g.107783352_107789524del - - SLC26A3_000073 3.5 kb deletion, Exon 7 to 8 deletion PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+/. 1 6i_8i c.735+4_735+7delAGTA - r.571_735del p.Leu191_Lys245delinsVal g.107429962_107429965delTACT g.107789517_107789520delTACT - - SLC26A3_000138 - - - - Germline - - - - - Felice Amato
+?/+? 1 6i_8i c.736-?_971+?del - r.(736_971del) p.(Val246Ilefs*8) g.(?_107427272)_(107427954_?)del g.107786827_107787509del 3.5 kb genomic deletion: EX7-8del - SLC26A3_000132 2 Japanese siblings (hom) with DIAR1 PubMed: Höglung et al. 2001b - - SUMMARY record yes - - - - Anne Polvi
?/?, +?/+? 2 8 c.915C>A - r.(?), r.(915c>a) p.(Tyr305*) g.107427328G>T g.107786883G>T Y305X - SLC26A3_000019 2 Polish DIAR1 families ( 1 hom and 1 com-het) PubMed: Wedenoja 2011, PubMed: Höglung et al. 1998 - - Unknown, SUMMARY record yes - - - - Ivo F.A.C. Fokkema, Anne Polvi
?/? 1 8 c.921T>G - r.(?) p.(Cys307Trp) g.107427322A>C g.107786877A>C - - SLC26A3_000058 - PubMed: Wedenoja 2011 - rs34407351 Unknown - - - - - Ivo F.A.C. Fokkema
?/? 1 8 c.923A>G - r.(?) p.(Asp308Gly) g.107427320T>C g.107786875T>C - - SLC26A3_000059 - PubMed: Wedenoja 2011 - rs80222394 Unknown - - - - - Ivo F.A.C. Fokkema
?/? 1 8 c.950T>G - r.(?) p.(Val317Gly) g.107427293A>C g.107786848A>C - - SLC26A3_000060 - PubMed: Wedenoja 2011 - rs78983942 Unknown - - - - - Ivo F.A.C. Fokkema
+/+ 1 8 c.951_953delGGT - r.(951_953delggu) p.(Val318del) g.107427290_107427292delACC g.107786845_107786847delACC c.951delGGT - SLC26A3_000134 Finnish major DIAR1 mutation. 45 Finnish (and Swedish) DIAR1 patients PubMed: Höglung et al. 1996, PubMed: Wedenoja et al. 2011 - - SUMMARY record yes 3/436 FIN (het) - - - Anne Polvi
+/. 1 8i c.971+3_971+4delAA - r.spl? p.? g.107427268_107427269delTT g.107786823_107786824delTT - - SLC26A3_000137 - - - - Germline - - - - - Felice Amato
?/? 1 9 c.996C>T - r.(=) p.(=) g.107423773G>A g.107783328G>A - - SLC26A3_000061 - PubMed: Wedenoja 2011 - rs35576676 Unknown - - - - - Ivo F.A.C. Fokkema
+?/+?, ?/? 2 9 c.1028G>A - r.(1028g>a), r.(?) p.(Cys343Tyr) g.107423741C>T g.107783296C>T c.1028G>A - SLC26A3_000021 1 French DIAR1 patient PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 9 c.1030_1047delinsGATGCC - r.(1030_1047delinsgaugcc), r.(?) p.(Phe344_Val349delinsAspAla) g.107423722_107423739delinsGGCATC g.107783277_107783294delinsGGCATC c.1030_1047delinsGATGCC - SLC26A3_000022 1 Polish DIAR1 patient PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+? 1 9 c.1047+3A>C - r.spl? p.? g.107423719T>G g.107783274T>G - - SLC26A3_000135 1 Korean DIAR1 patient (com-het) PubMed: Hong et al. 2013 - - SUMMARY record yes - - - - Anne Polvi
+?/+?, ?/? 2 10 c.1136G>C - r.(1136g>c), r.(?) p.(Gly379Ala) g.107423522C>G g.107783077C>G c.1136G>C - SLC26A3_000023 1 British DIAR1 patient PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
?/? 1 10 c.1148_1149del - r.(?) p.(Ile383Serfs*74) g.107423509_107423510del g.107783064_107783065del - - SLC26A3_000024 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+/+ 1 10 c.1148_1149delTA - r.(1148_1149delua) p.(Ile383Serfs*74) g.107423509_107423510delTA g.107783064_107783065delTA 1 more item - SLC26A3_000080 2 Andalusian (southern Spain) sibs (com-het) and 1 Spanish DIAR1 patient PubMed: Rodriques-Herrera et al. 2011, PubMed: Wedenoja et al. 2011 - - SUMMARY record yes - - - - Anne Polvi
+?/+?, ?/? 2 10 c.1193C>T - r.(1193c>u), r.(?) p.(Ser398Phe) g.107423465G>A g.107783020G>A c.1193C>T - SLC26A3_000025 1 Austrian DIAR1 patient PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
?/? 1 11 c.1299G>A - r.(=) p.(=) g.107423254C>T g.107782809C>T - - SLC26A3_000062 - PubMed: Wedenoja 2011 - rs3735605 Unknown - - - - - Ivo F.A.C. Fokkema
+?/+?, ?/? 2 11 c.1306C>T - r.(1306c>u), r.(?) p.(Gln436*) g.107423247G>A g.107782802G>A c.1306C>T - SLC26A3_000026 1 Dutch DIAR1 patient (hom) PubMed: Höglung et al. 2001b, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes 0/132 CON - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 11i, 11 c.1312-1G>A - r.spl?, r.(?) p.?, p.(=) g.107420209C>T g.107779764C>T IVS11-1G>A - SLC26A3_000027 1 Polish DIAR1 family (com-het) PubMed: Höglung et al. 1998b, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
?/? 1 12 c.1314C>T - r.(=) p.(=) g.107420206G>A g.107779761G>A - - SLC26A3_000063 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+?, ?/? 2 12 c.1342_1343del - r.(1342_1343del), r.(?) p.(Leu448Lysfs*9) g.107420177_107420178del g.107779732_107779733del c.1342_1343del - SLC26A3_000028 1 Japanese DIAR1 patient PubMed: Makela et al. 2002, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 12 c.1360C>T - r.(1360c>u), r.(?) p.(Gln454*) g.107420160G>A g.107779715G>A c.1360C>T - SLC26A3_000029 1 Canadian DIAR1 patient PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 12 c.1362del - r.(1362del), r.(?) p.(Gln454Hisfs*5) g.107420158del g.107779713del c.1362del - SLC26A3_000030 3 DIAR1 patients (Belgium, Turkey) PubMed: Choi et al. 2009, PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 12 c.1386G>A - r.(1386g>a), r.(?) p.(Trp462*) g.107420134C>T g.107779689C>T - - SLC26A3_000031 1 British DIAR1 family (Arabic ancestry; hom) PubMed: Makela et al. 2002, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 12 c.1387C>T - r.(1387c>u), r.(?) p.(Arg463*) g.107420133G>A g.107779688G>A c.1387C>T - SLC26A3_000032 1 French DIAR1 patient PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 12 c.1403A>T - r.(1403a>u), r.(?) p.(Asp468Val) g.107420117T>A g.107779672T>A c.1403A>T - SLC26A3_000033 1 Polish DIAR1 patient (com-het) PubMed: Höglung et al. 2001b, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes 0/48 CON - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+? 1 12i c.1408-1G>A - r.spl? p.? g.107418727C>T g.107778282C>T IVS12-1G>C - SLC26A3_000091 2 German (Palestinian) sibs (hom) with DIAR1 PubMed: Höglung et al. 2001b - - SUMMARY record yes 0/116 CON - - - Anne Polvi
?/? 1 13 c.1408-1G>C - r.(=) p.(=) g.107418727C>G g.107778282C>G - - SLC26A3_000034 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+?, ?/? 2 13 c.1487T>G - r.(1487u>g), r.(?) p.(Leu496Arg) g.107418647A>C g.107778202A>C - - SLC26A3_000035 3 sisters from Hong Kong (com-het) with DIAR1 PubMed: Höglung et al. 1998b, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
?/? 1 13i c.1515-2del - r.(=) p.(=) g.107417153del g.107776708del - - SLC26A3_000036 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 13i c.1515-2delA - r.spl? p.? g.107417153delT g.107776708delT IVS13-2delA - SLC26A3_000094 1 Kuwaiti DIAR1 patient (hom) PubMed: Höglung et al. 2001b - - SUMMARY record yes 0/77 CON - - - Anne Polvi
?/? 1 14 c.1517del - r.(?) p.(Pro506Glnfs*30) g.107417149del g.107776704del - - SLC26A3_000037 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 14 c.1517delC - r.(1517delc) p.(Pro506Glnfs*30) g.107417149delG g.107776704delG c.1516delC - SLC26A3_000095 1 Polish DIAR1 family (com-het) PubMed: Höglung et al. 1998 - - SUMMARY record yes - - - - Anne Polvi
+?/+? 1 14 c.1526_1527delGC - r.(1526_1527delgc) p.(Ser509Asnfs*4) g.107417139_107417140delGC g.107776694_107776695delGC 1 more item - SLC26A3_000096 1 Japanese DIAR1 family (hom) {PMID:Etani et al. 1998:10671059 - - SUMMARY record yes - - - - Anne Polvi
?/? 1 14 c.1529C>T - r.(?) p.(Thr510Met) g.107417137G>A g.107776692G>A - - SLC26A3_000064 - PubMed: Wedenoja 2011 - rs60147601 Unknown - - - - - Ivo F.A.C. Fokkema
?/? 1 14 c.1551_1554del - r.(?) p.(Asn518Serfs*17) g.107417112_107417115del g.107776667_107776670del - - SLC26A3_000038 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 14 c.1551_1554delCAAC - r.(1551_1554delcaac) p.(Asn518Serfs*17) g.107417112_107417115delGTTG g.107776667_107776670delGTTG c.1548-1551delAACC - SLC26A3_000097 1 Polish DIAR1 family (com-het) PubMed: Höglung et al. 1998 - - SUMMARY record yes - - - - Anne Polvi
+?/+?, ?/? 2 14 c.1559A>G - r.(1559a>g), r.(?) p.(Tyr520Cys) g.107417107T>C g.107776662T>C c.1559A>G - SLC26A3_000039 1 Turkish DIAR1 patient PubMed: Choi et al. 2009, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 14 c.1563G>C - r.(1563g>c), r.(?) p.(Lys521Asn) g.107417103C>G g.107776658C>G c.1563G>C - SLC26A3_000040 2 Swedish DIAR1 patients PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
?/? 1 14 c.1579_1581del - r.(?) p.(Tyr527del) g.107417085_107417087del g.107776640_107776642del - - SLC26A3_000041 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 14 c.1579_1581delTAT - r.(1579_1581deluau) p.(Tyr527del) g.107417085_107417087delTAA g.107776640_107776642delATA c.1578-1580delTTA - SLC26A3_000100 1 Polish DIAR1 family (com-het) PubMed: Höglung et al. 1998 - - SUMMARY record yes - - - - Anne Polvi
+?/+?, ?/? 2 15 c.1609del - r.(1609del), r.(?) p.(Ile537Phefs*39) g.107416965del g.107776520del c.1609delA - SLC26A3_000042 1 North American/Canadian DIAR1 patient (com-het) PubMed: Höglung et al. 1998b, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes 0/142 CON - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 15 c.1624_1626delinsC - r.(1624_1626delinsc), r.(?) p.(Ser542Profs*11) g.107416948_107416950delinsG g.107776503_107776505delinsG c.1624_1626delinsC - SLC26A3_000043 1 Turkish DIAR1 patient PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 15 c.1631T>A - r.(1631u>a), r.(?) p.(Ile544Asn) g.107416943A>T g.107776498A>T - - SLC26A3_000044 2 Vietnamese siblings (hom) with DIAR1 PubMed: Höglung et al. 2001, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
?/? 1 15 c.1661G>A - r.(?) p.(Arg554Gln) g.107416913C>T g.107776468C>T - - SLC26A3_000065 - PubMed: Wedenoja 2011 - rs2301635 Unknown - - - - - Ivo F.A.C. Fokkema
?/? 1 17 c.1802T>C - r.(?) p.(Ile601Thr) g.107414570A>G g.107774125A>G - - SLC26A3_000066 - PubMed: Wedenoja 2011 - rs35776303 Unknown - - - - - Ivo F.A.C. Fokkema
./., ?/? 3 17 c.1953T>C - r.(=) p.(=) g.107414419A>G g.107773974A>G SLC26A3:c.1953T>C (=), SLC26A3:NM_000111.2:c.1953T>C (=) - SLC26A3_000067 VKGL data sharing initiative Nederland; correct HGVS to be checked PubMed: Wedenoja 2011 - rs41669 CLASSIFICATION record, Unknown - - - - - VKGL-NL_Nijmegen, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 17 c.1954G>A - r.(1954g>a), r.(?) p.(Asp652Asn) g.107414418C>T g.107773973C>T c.1954G>A - SLC26A3_000045 2 Turkish (hom) and 2 German DIAR1 patients PubMed: Choi et al. 2009, PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
+?/+?, ?/? 2 17 c.1990del - r.(1990del), r.(?) p.(Val664*) g.107414382del g.107773937del c.1990del - SLC26A3_000046 1 Swedish DIAR1 patient PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
?/? 1 18 c.2024_2026dup - r.(?) p.(Ile675dup) g.107412535_107412537dup g.107772090_107772092dup - - SLC26A3_000047 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 18 c.2024_2026dupTCA - r.(2024_2026dupuca) p.(Ile675dup) g.107412535_107412537dup g.107772090_107772092dup c.2025_2026insATC: I675–676ins - SLC26A3_000047 1 more item PubMed: Höglung et al. 1998b, PubMed: Hosnut et al. 2010 - - SUMMARY record yes - - - - Anne Polvi
?/? 1 18 c.2038dup - r.(?) p.(Asp680Glyfs*8) g.107412523dup g.107772078dup - - SLC26A3_000068 - PubMed: Wedenoja 2011 - rs35617203 Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 18i c.2063-1G>T - r.spl? p.? g.107408354C>A g.107767909C>A a splice site mutation in the consensus acceptor site of intron 18: c.2063-1G>T - SLC26A3_000108 9 Korean DIAR1 patients (4 hom and 5 com-het) PubMed: Lee et al 2012, PubMed: Hong et al. 2013 - - SUMMARY record yes - - - - Anne Polvi
?/? 1 19 c.2104_2105delins29 - r.(?) p.(Gly702Thrins9) g.107408311_107408312delins29 - - - SLC26A3_000049 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 19 c.2104_2105delinsACCGGTTTTGAAGTGAAAATTCAAAATTT - r.(2104_2105delinsaccgguuuugaagugaaaauucaaaauuu) p.(Gly702delinsThrGlyPheGluValLysIleGlnAsnPhe) g.107408311_107408312delinsAAATTTTGAATTTTCACTTCAAAACCGGT g.107767866_107767867delinsAAATTTTGAATTTTCACTTCAAAACCGGT c.2104-2105delGGins29bp (ACCGGTTTTGAAGTGAAAATTCAAAATTT).): G702Tins9 - SLC26A3_000109 2 Norwegian siblings (com-het) with DIAR1 PubMed: Höglung et al. 2001b - - SUMMARY record yes - - - - Anne Polvi
+/+? 1 19 c.2116del - r.(2116del) p.(Ser706Alafs*6) g.107408300del g.107767855del - - SLC26A3_000050 - PubMed: Wedenoja 2011 - - Unknown - - - - - Ivo F.A.C. Fokkema
+?/+? 1 19 c.2116delA - r.(2116dela) p.(Ser706Alafs*6) g.107408300delT g.107767855delT c.2116delA - SLC26A3_000111 1 Finnish DIAR1 family (com-het) PubMed: Höglung et al. 1998 - - SUMMARY record yes 0/80 CON - - - Anne Polvi
+?/+? 1 19 c.2132T>G - r.(2132u>g) p.(Leu711*) g.107408284A>C g.107767839A>C c.2132T>G: p.L711X - SLC26A3_000112 1 Tyrolean DIAR1 family (hom) PubMed: Heinz-Erian et al. 2008 - - SUMMARY record yes - - - - Anne Polvi
+?/+?, ?/? 2 19i c.2205+3A>G - r.(spl?), r.(=) p.(?), p.(=) g.107408208T>C g.107767763T>C c.2205+3A>G - SLC26A3_000052 1 Swedish DIAR1 patient PubMed: Wedenoja et al. 2011, PubMed: Wedenoja 2011 - - SUMMARY record, Unknown yes - - - - Anne Polvi, Ivo F.A.C. Fokkema
?/? 1 20 c.2258A>G - r.(?) p.(Asn753Ser) g.107408037T>C g.107767592T>C - - SLC26A3_000069 - PubMed: Wedenoja 2011 - rs35342296 Unknown - - - - - Ivo F.A.C. Fokkema