Unique variants in the SLC34A3 gene

Information The variants shown are described using the NM_080877.2 transcript reference sequence.

85 entries on 1 page. Showing entries 1 - 85.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. 1 - c.(1335+1_*138)_(1336-1_?)del r.? p.? - VUS g.(140129184_140131006)_(140130403_?)del g.(137234732_137236554)_(137235951_?)del partial deletion ex13 - SLC34A3_000042 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
?/. 1 - c.-5181C>T r.(?) p.(=) - VUS g.140120390C>T - C9ORF169(NM_199001.2):c.317C>T (p.(Pro106Leu)) - C9orf169_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-2272C>T r.(?) p.(=) - VUS g.140123299C>T - RNF224(NM_001190228.2):c.232C>T (p.R78C) - C9orf169_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.-39-6C>T r.(=) p.(=) - likely benign g.140126110C>T g.137231658C>T SLC34A3(NM_001177316.1):c.-39-6C>T (p.(=)) - RNF224_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-39A>C r.(?) p.(=) - VUS g.140126116A>C - SLC34A3(NM_001177316.2):c.-39A>C - RNF224_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.86-120C>T r.(=) p.(=) - benign g.140126404C>T g.137231952C>T SLC34A3(NM_080877.2):c.86-120C>T - SLC34A3_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.179_199del r.(?) p.(Leu60_Leu66del) - VUS g.140127030_140127050del g.137232578_137232598del - - SLC34A3_000029 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
-/. 1 - c.200G>A r.(?) p.(Arg67His) - benign g.140127051G>A g.137232599G>A SLC34A3(NM_080877.2):c.200G>A (p.R67H) - RNF224_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.211G>A r.(?) p.(Gly71Ser) - likely benign g.140127062G>A - SLC34A3(NM_001177316.1):c.211G>A (p.(Gly71Ser)) - RNF224_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.231C>A r.(?) p.(Cys77*) - pathogenic g.140127082C>A - SLC34A3(NM_080877.2):c.231C>A (p.C77*) - RNF224_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 1 - c.273C>T r.(?) p.(Asp91=) - benign g.140127124C>T g.137232672C>T SLC34A3(NM_080877.2):c.273C>T (p.D91=) - SLC34A3_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.274G>A r.(?) p.(Val92Ile) - likely benign g.140127125G>A - - - RNF224_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.286G>A r.(?) p.(Ala96Thr) - VUS g.140127137G>A - - - RNF224_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.304+2T>C r.spl? p.? - pathogenic g.140127157T>C - - - RNF224_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.305-5T>C r.spl? p.? - likely benign g.140127231T>C g.137232779T>C SLC34A3(NM_001177316.1):c.305-5T>C (p.?) - RNF224_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.306C>T r.(?) p.(Ser102=) - likely benign g.140127237C>T g.137232785C>T SLC34A3(NM_001177317.1):c.306C>T (p.S102=) - RNF224_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.310G>C r.(?) p.(Val104Leu) - likely benign g.140127241G>C g.137232789G>C SLC34A3(NM_001177317.1):c.310G>C (p.V104L) - SLC34A3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.371T>C r.(?) p.(Ile124Thr) - VUS g.140127302T>C - SLC34A3(NM_001177316.2):c.371T>C (p.(Ile124Thr)) - RNF224_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.396G>A r.(?) p.(Val132=) - likely benign g.140127327G>A - SLC34A3(NM_001177317.1):c.396G>A (p.V132=) - RNF224_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.399G>A r.(?) p.(=) - likely benign g.140127330G>A - - - RNF224_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.448+1G>A r.spl p.? - likely pathogenic g.140127380G>A g.137232928G>A - - SLC34A3_000030 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
?/. 1 - c.449-3C>T r.(?) p.(=) - VUS g.140127453C>T g.137233001C>T - - SLC34A3_000031 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
-?/. 1 - c.539G>C r.(?) p.(Gly180Ala) - likely benign g.140127546G>C g.137233094G>C SLC34A3(NM_001177316.1):c.539G>C (p.(Gly180Ala)) - RNF224_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 - c.560+27_561-38del r.(?) p.(=) - likely pathogenic g.140127594_140127623del - SLC34A3(NM_080877.2):c.560+27_561-38delTGGGGCTGCAGTGGCAGCCCCAGCCCGGGC - RNF224_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 3 - c.575C>T r.(?) p.(Ser192Leu) - pathogenic g.140127675C>T g.137233223C>T SLC34A3(NM_001177316.2):c.575C>T (p.(Ser192Leu)), SLC34A3(NM_080877.2):c.575C>T (p.S192L) - SLC34A3_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
+/. 1 - c.586G>A r.(?) p.(Gly196Arg) - pathogenic g.140127686G>A - SLC34A3(NM_001177316.2):c.586G>A (p.(Gly196Arg)) - RNF224_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.625C>T r.(?) p.(Leu209=) - benign g.140127725C>T g.137233273C>T SLC34A3(NM_080877.2):c.625C>T (p.L209=) - SLC34A3_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.679G>A r.(?) p.(Ala227Thr) - likely benign g.140127779G>A g.137233327G>A SLC34A3(NM_001177316.1):c.679G>A (p.(Ala227Thr)) - RNF224_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.683G>A r.(?) p.(Ser228Asn) - VUS g.140127783G>A g.137233331G>A - - SLC34A3_000032 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
?/. 1 - c.688A>C r.(?) p.(Thr230Pro) - VUS g.140127788A>C g.137233336A>C - - SLC34A3_000033 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
-?/., ?/. 4 - c.709G>A r.(?) p.(Asp237Asn) - likely benign, VUS g.140127809G>A g.137233357G>A 1 more item - SLC34A3_000005 9 heterozygous, no homozygous; Clinindb (India), VKGL data sharing initiative Nederland PubMed: Narang 2020, Journal: Narang 2020 - rs145877051 CLASSIFICATION record, Germline - 9/2794 individuals - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Utrecht, Mohammed Faruq
?/. 1 - c.740C>G r.(?) p.(Thr247Arg) - VUS g.140127840C>G - SLC34A3(NM_080877.2):c.740C>G (p.T247R) - RNF224_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.751G>C r.(?) p.(Val251Leu) - VUS g.140127851G>C g.137233399G>C - - SLC34A3_000034 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
-?/., ?/. 4 - c.756G>A r.(?) p.(Gln252=) - likely benign, VUS g.140127856G>A g.137233404G>A 1 more item - SLC34A3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht
-/. 1 - c.756+9G>A r.(=) p.(=) - benign g.140127865G>A g.137233413G>A SLC34A3(NM_080877.2):c.756+9G>A - SLC34A3_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/., -?/. 4 - c.757T>C r.(?) p.(Leu253=) - benign, likely benign g.140128085T>C g.137233633T>C 1 more item - SLC34A3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-?/. 2 - c.779G>A r.(?) p.(Ser260Asn) - likely benign g.140128107G>A - SLC34A3(NM_001177316.1):c.779G>A (p.(Ser260Asn)), SLC34A3(NM_001177317.1):c.779G>A (p.S260N) - RNF224_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-/., -?/. 2 - c.790G>A r.(?) p.(Gly264Ser) - benign, likely benign g.140128118G>A g.137233666G>A SLC34A3(NM_001177317.1):c.790G>A (p.G264S), SLC34A3(NM_080877.2):c.790G>A (p.G264S) - SLC34A3_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
?/. 1 - c.795C>T r.(?) p.(=) - VUS g.140128123C>T - SLC34A3(NM_001177316.2):c.795C>T (p.(Asn265=)) - RNF224_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.799A>C r.(?) p.(Thr267Pro) - VUS g.140128127A>C g.137233675A>C - - SLC34A3_000035 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 2/312 cases - - - Johan den Dunnen
-?/. 1 - c.836C>T r.(?) p.(Thr279Met) - likely benign g.140128164C>T - SLC34A3(NM_001177316.1):c.836C>T (p.(Thr279Met)) - RNF224_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.894_896del r.(?) p.(Lys298del) - VUS g.140128362_140128364del g.137233910_137233912del - - SLC34A3_000036 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
-?/. 1 - c.919C>A r.(?) p.(Leu307Met) - likely benign g.140128387C>A - SLC34A3(NM_001177316.1):c.919C>A (p.(Leu307Met)) - RNF224_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 2 - c.925+20_926-48del r.(?), r.spl p.(=), p.? - pathogenic g.140128413_140128513del g.137233961_137234061del SLC34A3(NM_080877.2):c.894_925+69del - RNF224_000014 combination of variants not reported, VKGL data sharing initiative Nederland PubMed: Rush 2022 - - CLASSIFICATION record, Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen, VKGL-NL_Utrecht
?/. 1 - c.926-3C>T r.(?) p.(=) - VUS g.140128558C>T g.137234106C>T - - SLC34A3_000037 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
-?/. 2 - c.929G>A r.(?) p.(Arg310His) - likely benign g.140128564G>A - SLC34A3(NM_001177316.1):c.929G>A (p.(Arg310His)), SLC34A3(NM_080877.2):c.929G>A (p.R310H) - RNF224_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht
+/. 1 - c.944del r.(?) p.(Gly315AlafsTer28) - pathogenic g.140128579del - SLC34A3(NM_080877.2):c.944delG (p.G315Afs*28) - SLC34A3_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.949_967dup r.(?) p.(Val323Glyfs*276) - VUS g.140128584_140128602dup - SLC34A3(NM_001177316.2):c.949_967dup (p.(Val323Glyfs*276)) - RNF224_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.953T>C r.(?) p.(Leu318Pro) - VUS g.140128588T>C g.137234136T>C SLC34A3(NM_001177316.1):c.953T>C (p.(Leu318Pro)) - RNF224_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.995T>C r.(?) p.(Leu332Pro) - VUS g.140128630T>C g.137234178T>C - - SLC34A3_000038 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
-?/. 1 - c.1009G>A r.(?) p.(Gly337Ser) - likely benign g.140128644G>A g.137234192G>A SLC34A3(NM_001177316.1):c.1009G>A (p.(Gly337Ser)) - RNF224_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1025T>C r.(?) p.(Ile342Thr) - VUS g.140128660T>C g.137234208T>C - - SLC34A3_000039 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 2/312 cases - - - Johan den Dunnen
+?/. 1 - c.1053_1060del r.(?) p.(Arg353Profs*237) - likely pathogenic g.140128688_140128695del - SLC34A3(NM_001177317.1):c.1053_1060delCGGCCGCG (p.R353Pfs*237) - RNF224_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1074G>A r.(?) p.(=) - likely benign g.140128709G>A - SLC34A3(NM_001177316.2):c.1074G>A (p.(Val358=)) - RNF224_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1093+9G>A r.(=) p.(=) - likely benign g.140128737G>A - SLC34A3(NM_001177316.2):c.1093+9G>A - RNF224_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1094-4A>C r.spl? p.? - VUS g.140128864A>C g.137234412A>C SLC34A3(NM_001177316.1):c.1094-4A>C (p.?) - SLC34A3_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1135G>A r.(?) p.(Val379Ile) - VUS g.140128909G>A g.137234457G>A - - SLC34A3_000040 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
-?/. 1 - c.1140C>T r.(?) p.(Leu380=) - likely benign g.140128914C>T - SLC34A3(NM_001177317.1):c.1140C>T (p.L380=) - RNF224_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1143G>A r.(?) p.(=) - VUS g.140128917G>A - SLC34A3(NM_001177316.2):c.1143G>A (p.(Ala381=)) - RNF224_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.1149C>T r.(?) p.(=) - benign g.140128923C>T - SLC34A3(NM_080877.2):c.1149C>T (p.A383=) - RNF224_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.1164A>G r.(?) p.(Ala388=) - likely benign g.140128938A>G g.137234486A>G SLC34A3(NM_001177317.1):c.1164A>G (p.A388=) - RNF224_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1170G>A r.(?) p.(Gln390=) - likely benign g.140128944G>A g.137234492G>A SLC34A3(NM_001177317.1):c.1170G>A (p.Q390=) - RNF224_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1191G>A r.(?) p.(Ala397=) - likely benign g.140128965G>A - SLC34A3(NM_080877.2):c.1191G>A (p.A397=) - RNF224_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.1197C>G r.(?) p.(Val399=) - likely benign g.140128971C>G g.137234519C>G SLC34A3(NM_001177317.1):c.1197C>G (p.V399=) - SLC34A3_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.1267G>T r.(?) p.(Gly423Cys) - likely pathogenic g.140129115G>T - SLC34A3(NM_080877.2):c.1267G>T (p.G423C) - SLC34A3_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.1304del r.(?) p.(Ser435Thrfs*46) - pathogenic g.140129152del - SLC34A3(NM_001177316.2):c.1304del (p.(Ser435ThrfsTer46)) - SLC34A3_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1309G>A r.(?) p.(Ala437Thr) - likely benign g.140129157G>A g.137234705G>A SLC34A3(NM_001177317.1):c.1309G>A (p.A437T) - SLC34A3_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1324A>G r.(?) p.(Ser442Gly) - VUS g.140129172A>G g.137234720A>G - - SLC34A3_000041 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
+/. 2 12i c.1335+2T>A r.spl p.? - pathogenic (recessive) g.140129185T>A g.137234733T>A - - SLC34A3_000022 - PubMed: Acar 2018 - - Germline - - - - - Johan den Dunnen
?/. 1 - c.1336-25_1336del r.spl? p.? - VUS g.140130379_140130404del - SLC34A3(NM_001177316.2):c.1336-25_1336del - SLC34A3_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 12i c.1336-11_1336-1del r.spl p.? ACMG pathogenic (recessive) g.140130393_140130403del g.137235941_137235951del - - SLC34A3_000028 ACMG PVS1, PM2, PP4 PubMed: Jacob 2023 - - Germline - - - - - Johan den Dunnen
+?/., ?/. 3 - c.1453C>T r.(?) p.(Arg485Cys) - likely pathogenic, VUS g.140130521C>T - SLC34A3(NM_001177316.1):c.1453C>T (p.(Arg485Cys)), SLC34A3(NM_080877.3):c.1453C>T (p.R485C) - SLC34A3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen, VKGL-NL_Nijmegen
-/., -?/., ?/. 4 - c.1454G>A r.(?) p.(Arg485His) - benign, likely benign, VUS g.140130522G>A g.137236070G>A 1 more item - SLC34A3_000017 3 heterozygous, no homozygous; Clinindb (India), VKGL data sharing initiative Nederland PubMed: Narang 2020, Journal: Narang 2020 - rs138872455 CLASSIFICATION record, Germline - 3/2795 individuals - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Utrecht, Mohammed Faruq
-/., -?/. 3 - c.1512C>T r.(?) p.(Phe504=) - benign, likely benign g.140130580C>T g.137236128C>T SLC34A3(NM_001177317.1):c.1512C>T (p.F504=) - SLC34A3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-/., -?/. 3 - c.1538= r.(=), r.(?) p.(Val513=) - benign, likely benign g.140130606A>T g.137236154A>T 1538A>T (Glu513Val), 1 more item - SLC34A3_000013 VKGL data sharing initiative Nederland PubMed: Thiele 2020 - - CLASSIFICATION record, Germline - - - - - Johan den Dunnen, VKGL-NL_Groningen, VKGL-NL_Utrecht
+/. 1 - c.1561dup r.(?) p.(Leu521ProfsTer72) - pathogenic g.140130629dup g.137236177dup - - SLC34A3_000043 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 2/312 cases - - - Johan den Dunnen
-?/. 2 - c.1585A>T r.(?) p.(Ile529Phe) - likely benign g.140130653A>T - SLC34A3(NM_001177316.1):c.1585A>T (p.(Ile529Phe)), SLC34A3(NM_080877.2):c.1585A>T (p.I529F) - SLC34A3_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht
-?/. 1 - c.1612C>T r.(?) p.(Arg538Trp) - likely benign g.140130680C>T - SLC34A3(NM_001177316.1):c.1612C>T (p.(Arg538Trp)) - SLC34A3_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1616C>T r.(?) p.(Pro539Leu) - VUS g.140130684C>T g.137236232C>T - - SLC34A3_000044 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
-?/. 1 - c.1633C>T r.(?) p.(Arg545Cys) - likely benign g.140130701C>T - SLC34A3(NM_001177316.1):c.1633C>T (p.(Arg545Cys)) - SLC34A3_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 2 13 c.1639_1652del r.(?) p.(Arg547Alafs*41) - pathogenic (recessive) g.140130707_140130720del g.137236255_137236268del - - SLC34A3_000023 - PubMed: Acar 2018 - - Germline - - - - - Johan den Dunnen
?/. 1 - c.1690C>A r.(?) p.(Arg564Ser) - VUS g.140130758C>A - SLC34A3(NM_080877.3):c.1690C>A (p.R564S) - FAM166A_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.1727G>T r.(?) p.(Ser576Ile) - VUS g.140130795G>T g.137236343G>T - - SLC34A3_000045 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 1/312 cases - - - Johan den Dunnen
?/. 1 - c.1765G>A r.(?) p.(Glu589Lys) - VUS g.140130833G>A g.137236381G>A - - SLC34A3_000046 combination of variants not reported PubMed: Rush 2022 - - Germline/De novo (untested) - 2/312 cases - - - Johan den Dunnen
-/. 2 - c.*14A>C r.(=) p.(=) - benign g.140130882A>C g.137236430A>C SLC34A3(NM_001177317.2):c.*14A>C - SLC34A3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen
Legend   How to query  


Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.