Unique variants in the SMARCA2 gene

Information The variants shown are described using the NM_003070.3 transcript reference sequence.

134 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. 5 - c.? r.(?) p.(Glu852Asp), p.(Phe903Leu), p.(Gly881Arg), p.(Leu946Phe), p.(Ser1146Arg) - VUS g.? - p.(Glu852Asp), not specified, p.(Phe903Leu), not specified, p.(Gly881Arg), not specified, 2 more items - PTCH1_000000 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
./. 1 - c.-1811337_*6006260del r.0? p.0? - pathogenic g.204104_8198999del g.204104_8198999del - - GLDC_000111 decreased gene dosage PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - - - Johan den Dunnen
?/? 3 - c.-5G>A r.(=) p.(=) - VUS g.2029018G>A g.2029018G>A - - SMARCA2_000054 - - - - Unknown - - - - - Gijs Santen
?/., -?/. 2 - c.8C>T r.(?) p.(Thr3Met) - VUS, likely benign g.2029030C>T g.2029030C>T SMARCA2(NM_003070.3):c.8C>T (p.(Thr3Met)), SMARCA2(NM_003070.4):c.8C>T (p.T3M) - SMARCA2_000151 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Leiden
?/. 1 - c.47C>T r.(?) p.(Ser16Leu) - VUS g.2029069C>T g.2029069C>T SMARCA2(NM_003070.3):c.47C>T (p.(Ser16Leu)) - SMARCA2_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.161C>T r.(?) p.(Ser54Phe) - VUS g.2029183C>T g.2029183C>T SMARCA2(NM_003070.3):c.161C>T (p.(Ser54Phe)) - SMARCA2_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.335C>A r.(?) p.(Pro112Gln) - likely benign g.2033061C>A g.2033061C>A SMARCA2(NM_003070.3):c.335C>A (p.(Pro112Gln)) - SMARCA2_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.370C>T r.(?) p.(His124Tyr) - VUS g.2039480C>T g.2039480C>T - - SMARCA2_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.511C>A r.(?) p.(Pro171Thr) - VUS g.2039621C>A g.2039621C>A SMARCA2(NM_003070.4):c.511C>A (p.P171T) - SMARCA2_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.666A>G r.(?) p.(Gln222=) - likely benign g.2039776A>G g.2039776A>G SMARCA2(NM_003070.4):c.666_669delACAGinsGCAG (p.Q222_Q223=) - SMARCA2_000114 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.668_669del r.(?) p.(Gln223ProfsTer35) - VUS g.2039778_2039779del g.2039778_2039779del SMARCA2(NM_003070.4):c.668_669delAG (p.Q223Pfs*35) - SMARCA2_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/? 2 - c.683A>C r.(?) p.(Gln228Pro) - VUS g.2039793A>C g.2039793A>C - - SMARCA2_000040 - - - - Unknown - - - - - Gijs Santen
-/. 2 - c.685_686insCGC r.(?) p.(Gln228_Gln229insPro) - benign g.2039795_2039796insCGC g.2039795_2039796insCGC SMARCA2(NM_003070.4):c.685_686insCGC (p.Q228_Q229insP) - SMARCA2_000119 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
?/. 1 - c.687_707del r.(?) p.(Gln232_Gln238del) - VUS g.2039797_2039817del - SMARCA2(NM_003070.4):c.687_707delGCAGCAGCAGCAGCAGCAGCA (p.Q232_Q238del) - SMARCA2_000154 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.693_707del r.(?) p.(Gln234_Gln238del) - likely benign g.2039803_2039817del g.2039803_2039817del 1 more item - SMARCA2_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Leiden
-?/. 1 - c.695A>C r.(?) p.(Gln232Pro) - likely benign g.2039805A>C - SMARCA2(NM_003070.4):c.695A>C (p.Q232P) - SMARCA2_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.696_707del r.(?) p.(Gln235_Gln238del) - likely benign g.2039806_2039817del g.2039806_2039817del SMARCA2(NM_003070.3):c.667_678del (p.(Gln227_Gln230del)) - SMARCA2_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 3 - c.699_707del r.(?) p.(Gln236_Gln238del) - likely benign g.2039809_2039817del g.2039809_2039817del 1 more item - SMARCA2_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Rotterdam, VKGL-NL_Leiden
-?/., -/. 4 - c.699_707dup r.(?) p.(Gln236_Gln238dup) - likely benign, benign g.2039809_2039817dup g.2039809_2039817dup 1 more item - SMARCA2_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC, VKGL-NL_Rotterdam, VKGL-NL_Leiden
-/. 1 - c.702_707del r.(?) p.(Gln237_Gln238del) - benign g.2039812_2039817del - SMARCA2(NM_003070.4):c.702_707delGCAGCA (p.Q237_Q238del) - SMARCA2_000120 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/., -/. 4 - c.702_707dup r.(?) p.(Gln237_Gln238dup) - likely benign, benign g.2039812_2039817dup g.2039812_2039817dup 1 more item - SMARCA2_000121 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Leiden
-/., ?/., -?/. 5 - c.705_707del r.(?) p.(Gln238del) - benign, VUS, likely benign g.2039815_2039817del g.2039815_2039817del SMARCA2(NM_003070.3):c.667_669del (p.(Gln238del)), SMARCA2(NM_003070.4):c.705_707delGCA (p.Q238del) - SMARCA2_000065, SMARCA2_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC, VKGL-NL_Groningen, VKGL-NL_Leiden, VKGL-NL_Utrecht
-/., -?/. 4 - c.705_707dup r.(?) p.(Gln238dup) - benign, likely benign g.2039815_2039817dup g.2039815_2039817dup SMARCA2(NM_003070.3):c.667_669dup (p.(Gln223dup)), SMARCA2(NM_003070.4):c.705_707dupGCA (p.Q238dup) - SMARCA2_000122 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC, VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_Leiden
-?/. 1 - c.708A>G r.(?) p.(Gln236=) - likely benign g.2039818A>G g.2039818A>G SMARCA2(NM_003070.4):c.708A>G (p.Q236=) - SMARCA2_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? 1 - c.716_724dup r.(?) p.(Pro239_Gln241dup) - VUS g.2039826_2039834dup g.2039826_2039834dup - - SMARCA2_000041 - - - - Unknown - - - - - Gijs Santen
?/. 1 - c.844G>A r.(?) p.(Ala282Thr) - VUS g.2047282G>A g.2047282G>A SMARCA2(NM_003070.3):c.844G>A (p.(Ala282Thr)) - SMARCA2_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.1018G>C r.(?) p.(Val340Leu) - VUS g.2047456G>C g.2047456G>C SMARCA2(NM_003070.4):c.1018G>C (p.V340L) - SMARCA2_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1282A>G r.(?) p.(Met428Val) - VUS g.2056780A>G g.2056780A>G SMARCA2(NM_003070.4):c.1282A>G (p.M428V) - SMARCA2_000145 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
./. 1 - c.1514G>A r.(?) p.(Arg505Gln) - pathogenic g.2058457G>A g.2058457G>A - - SMARCA2_000058 - PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - - - Johan den Dunnen
?/? 1 - c.1522-48T>C r.(=) p.(=) - VUS g.2060768T>C g.2060768T>C - - SMARCA2_000035 - - - - Unknown - - - - - Gijs Santen
+/., ./. 2 - c.1573C>T r.(?) p.(Arg525Cys) - pathogenic g.2060867C>T g.2060867C>T - - SMARCA2_000057 VKGL data sharing initiative Nederland PubMed: DDDS 2015, Journal: DDDS 2015 - - CLASSIFICATION record, De novo - - - - - VKGL-NL_Nijmegen, Johan den Dunnen
./. 1 - c.1574G>A r.(?) p.(Arg525His) - pathogenic g.2060868G>A g.2060868G>A - - SMARCA2_000056 - PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - - - Johan den Dunnen
-?/. 1 - c.1746+8A>G r.(=) p.(=) - likely benign g.2070479A>G g.2070479A>G SMARCA2(NM_003070.3):c.1746+8A>G (p.(=)) - SMARCA2_000125 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1821C>T r.(?) p.(Phe607=) - likely benign g.2073286C>T g.2073286C>T SMARCA2(NM_003070.4):c.1821C>T (p.F607=) - SMARCA2_000146 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.1827A>G r.(?) p.(Pro609=) - benign g.2073292A>G g.2073292A>G SMARCA2(NM_003070.4):c.1827A>G (p.P609=) - SMARCA2_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.2037-9C>T r.(=) p.(=) - likely benign g.2077620C>T g.2077620C>T SMARCA2(NM_003070.4):c.2037-9C>T - SMARCA2_000126 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.2136G>A r.(?) p.(Val712=) - likely benign g.2077728G>A g.2077728G>A SMARCA2(NM_003070.4):c.2136G>A (p.V712=) - SMARCA2_000147 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.2226_2231delinsT r.(?) p.(Leu743Argfs*6) - likely pathogenic g.2081873_2081878delinsT g.2081873_2081878delinsT - - SMARCA2_000095 - - - - Unknown - - - - - IMGAG
+/?, ?/. 3 15 c.2255G>C r.(?) p.(Gly752Ala) - pathogenic, VUS g.2081902G>C g.2081902G>C p.(Gly752Ala), not specified, p.(G752A), not specified - SMARCA2_000019 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
+/?, ?/. 2 15 c.2264A>G r.(?) p.(Lys755Arg) - pathogenic, VUS g.2081911A>G g.2081911A>G p.(Lys755Arg), not specified - SMARCA2_000024 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
+/?, ?/. 2 15 c.2267C>T r.(?) p.(Thr756Ile) - pathogenic, VUS g.2081914C>T g.2081914C>T p(.T756I), not specified - SMARCA2_000012 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
?/. 1 15 c.2348C>G r.(?) p.(Ser783Trp) - VUS g.2081995C>G g.2081995C>G p.(Ser783Trp), not specified - SMARCA2_000097 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
?/? 26 - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
-/. 1 - c.2349-10dup r.(=) p.(=) - benign g.2083337dup g.2083337dup SMARCA2(NM_003070.4):c.2349-10dupT - SMARCA2_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/? 1 - c.2349-9del r.(=) p.(=) - VUS g.2083338del g.2083338del - - SMARCA2_000042 - - - - Unknown - - - - - Gijs Santen
-?/. 1 - c.2349-6C>T r.(=) p.(=) - likely benign g.2083341C>T g.2083341C>T SMARCA2(NM_003070.3):c.2349-6C>T (p.(=)) - SMARCA2_000127 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 - c.2431C>T r.(?) p.(Arg811Cys) - likely pathogenic g.2084101C>T g.2084101C>T - - SMARCA2_000130 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.2486C>T r.(?) p.(Thr829Ile) - likely pathogenic g.2084156C>T g.2084156C>T - - SMARCA2_000150 1 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs797045974 Germline - 1/2795 individuals - - - Mohammed Faruq
?/? 3 - c.2527-25G>A r.(=) p.(=) - VUS g.2086804G>A g.2086804G>A - - SMARCA2_000043 - - - - Unknown - - - - - Gijs Santen
?/., +/? 2 18 c.2551G>C r.(?) p.(Asp851His) - VUS, pathogenic g.2086853G>C g.2086853G>C p.(Asp851His), not specified - SMARCA2_000027 - PubMed: Sousa SB 2014, PubMed: Van Houdt et al 2012 - - Unknown - - - - - Julia Lopez, SIB - Livia Famiglietti
+/., ?/., +/? 4 18 c.2554G>A r.(?) p.(Glu852Lys) - pathogenic, VUS g.2086856G>A g.2086856G>A p.(Glu852Lys), not specified - SMARCA2_000020 - PubMed: Wieczorek 2013, PubMed: Sousa SB 2014, PubMed: Van Houdt et al 2012 - - De novo, Unknown - - - - - Johan den Dunnen, Julia Lopez, SIB - Livia Famiglietti
?/., ?/? 3 18 c.2554G>C r.(?) p.(Glu852Gln) - VUS g.2086856G>C g.2086856G>C p.(Glu852Gln), not specified - SMARCA2_000044 - PubMed: Santen GW 2013, PubMed: Sousa SB 2014 - - De novo, Unknown - - - - - Julia Lopez, Gijs Santen
+/? 1 18 c.2556A>C r.(?) p.(Glu852Asp) - pathogenic g.2086858A>C g.2086858A>C - - SMARCA2_000014 - PubMed: Van Houdt et al 2012 - - Unknown - - - - - SIB - Livia Famiglietti
?/., +/? 2 18 c.2561A>G r.(?) p.(His854Arg) - VUS, pathogenic g.2086863A>G g.2086863A>G p.(His854Arg), not specified - SMARCA2_000023 - PubMed: Sousa SB 2014, PubMed: Van Houdt et al 2012 - - Unknown - - - - - Julia Lopez, SIB - Livia Famiglietti
?/. 1 18 c.2561A>T r.(?) p.(His854Leu) - VUS g.2086863A>T g.2086863A>T p.(His854Leu), not specified - SMARCA2_000098 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
+/?, ?/. 2 18 c.2563C>G r.(?) p.(Arg855Gly) - pathogenic, VUS g.2086865C>G g.2086865C>G p.(Arg855Gly), not specified - SMARCA2_000028 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
+/., ?/. 3 18 c.2564G>A r.(?) p.(Arg855Gln) - pathogenic, VUS g.2086866G>A g.2086866G>A SMARCA2(NM_003070.3):c.2564G>A (p.(Arg855Gln)), p.(Arg855Gln), not specified - SMARCA2_000060 VKGL data sharing initiative Nederland PubMed: Wieczorek 2013, PubMed: Sousa SB 2014 - - De novo, CLASSIFICATION record, Unknown - - - - - Johan den Dunnen, VKGL-NL_Leiden, Julia Lopez
+/., ?/. 2 18 c.2639C>T r.(?) p.(Thr880Ile) - pathogenic, VUS g.2086941C>T g.2086941C>T p.(Thr880Ile), not specified - SMARCA2_000059 - PubMed: Wieczorek 2013, PubMed: Sousa SB 2014 - - De novo, Unknown - - - - - Johan den Dunnen, Julia Lopez
+/? 1 18 c.2641G>C r.(?) p.(Gly881Arg) - pathogenic g.2086943G>C g.2086943G>C - - SMARCA2_000015 - PubMed: Van Houdt et al 2012 - - Unknown - - - - - SIB - Livia Famiglietti
+/?, ?/. 2 18 c.2642G>T r.(?) p.(Gly881Val) - pathogenic, VUS g.2086944G>T g.2086944G>T p.(Gly881Val), not specified - SMARCA2_000006 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
+/?, ?/. 4 18 c.2648C>T r.(?) p.(Pro883Leu) - pathogenic, VUS g.2086950C>T g.2086950C>T p.(Pro883Leu), not specified - SMARCA2_000009 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
+?/. 1 - c.2671C>T r.(?) p.(Leu891Phe) - likely pathogenic g.2086973C>T g.2086973C>T SMARCA2(NM_003070.4):c.2671C>T (p.L891F) - SMARCA2_000131 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.2733A>G r.(?) p.(Gln911=) - benign g.2087035A>G g.2087035A>G SMARCA2(NM_003070.4):c.2733A>G (p.Q911=) - SMARCA2_000132 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.2744C>A r.(?) p.(Ala915Asp) - VUS g.2087046C>A g.2087046C>A SMARCA2(NM_003070.4):c.2744C>A (p.A915D) - SMARCA2_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/. 1 - c.2764G>A r.(?) p.(Glu922Lys) - likely pathogenic g.2087066G>A g.2087066G>A - - SMARCA2_000133 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/., +/?, ?/? 5 19 c.2815C>T r.(?) p.(His939Tyr) - VUS, pathogenic g.2088545C>T g.2088545C>T p.(His939tyr), not specified - SMARCA2_000011, SMARCA2_000045 - PubMed: Santen GW 2013, PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - De novo, Unknown - - - - - Julia Lopez, SIB - Livia Famiglietti, Gijs Santen
?/., +/? 2 19 c.2837T>C r.(?) p.(Leu946Ser) - VUS, pathogenic g.2088567T>C g.2088567T>C p.(Leu946Ser), not specified - SMARCA2_000021 - PubMed: Sousa SB 2014, PubMed: Van Houdt et al 2012 - - Unknown - - - - - Julia Lopez, SIB - Livia Famiglietti
+/? 1 19 c.2838A>T r.(?) p.(Leu946Phe) - pathogenic g.2088568A>T g.2088568A>T - - SMARCA2_000026 - PubMed: Van Houdt et al 2012 - - Unknown - - - - - SIB - Livia Famiglietti
?/? 1 - c.2883+20del r.(=) p.(=) - VUS g.2088633del g.2088633del - - SMARCA2_000046 - - - - Unknown - - - - - Gijs Santen
?/? 26 - c.2883+37del r.(=) p.(=) - VUS g.2088650del g.2088650del - - SMARCA2_000037, SMARCA2_000029 - - - - Unknown - - - - - Gijs Santen
?/. 1 19i_4 c.(2883+1_2884-1)_(3762+1_3763-1)del r.spl? p.? - VUS g.(2088614_2039487)_(2096656_2123718)del - 32kb in-frame deletion ex20-26, not specified - SMARCA2_000096 - PubMed: Sousa SB 2014 - - De novo - - - - - Julia Lopez
?/. 1 - c.(2883+1_2884-1)_(3981+1_3982-1)del r.(?) p.? - VUS g.(2088614_2096656)_(2123938_2161685)del - 55kb in-frame deletion ex20-27, not specified - SMARCA2_000099 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
?/? 3 - c.2991+10G>A r.(=) p.(=) - VUS g.2096774G>A g.2096774G>A - - SMARCA2_000030 - - - - Unknown - - - - - Gijs Santen
?/? 4 - c.2991+30G>A r.(=) p.(=) - VUS g.2096794G>A g.2096794G>A - - SMARCA2_000031 - - - - Unknown - - - - - Gijs Santen
?/? 15 - c.3079-25T>A r.(=) p.(=) - VUS g.2101545T>A g.2101545T>A - - SMARCA2_000032 - - - - Unknown - - - - - Gijs Santen
?/? 1 - c.3079-23C>T r.(=) p.(=) - VUS g.2101547C>T g.2101547C>T - - SMARCA2_000038 - - - - Unknown - - - - - Gijs Santen
-?/. 1 - c.3192G>T r.(?) p.(Ala1064=) - likely benign g.2104069G>T g.2104069G>T SMARCA2(NM_003070.4):c.3192G>T (p.A1064=) - SMARCA2_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.3203G>A r.(?) p.(Arg1068Gln) - likely pathogenic g.2104080G>A g.2104080G>A - - SMARCA2_000135 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 23 c.3209T>A r.(?) p.(Leu1070Gln) - VUS g.2104086T>A g.2104086T>A p.(Leu1070Gln), not specified - SMARCA2_000100 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
?/. 1 23 c.3220C>G r.(?) p.(Gln1074Glu) - VUS g.2104097C>G g.2104097C>G p.(Gln1074Glu), not specified - SMARCA2_000101 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
?/., ?/? 3 24 c.3293G>A r.(?) p.(Gly1098Asp) - VUS g.2110254G>A g.2110254G>A p.(Gly1098Asp), not specified - SMARCA2_000039 - PubMed: Santen GW 2013, PubMed: Sousa SB 2014 - - De novo, Unknown - - - - - Julia Lopez, Gijs Santen
+/?, ?/. 2 24 c.3313C>T r.(?) p.(Arg1105Cys) - pathogenic, VUS g.2110274C>T g.2110274C>T p.(Arg1105Cys), not specified - SMARCA2_000013 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
?/., +/., ?/? 5 24 c.3314G>A r.(?) p.(Arg1105His) - VUS, pathogenic g.2110275G>A g.2110275G>A p.(Arg1105His), not specified - SMARCA2_000047 VKGL data sharing initiative Nederland PubMed: Santen GW 2013, PubMed: Sousa SB 2014 - - De novo, Unknown, CLASSIFICATION record - - - - - Julia Lopez, VKGL-NL_Nijmegen, Gijs Santen
+/?, ?/. 2 24 c.3314G>C r.(?) p.(Arg1105Pro) - pathogenic, VUS g.2110275G>C g.2110275G>C p.(Arg1105Pro), not specified - SMARCA2_000018 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
+?/. 1 - c.3314G>T r.(?) p.(Arg1105Leu) - likely pathogenic g.2110275G>T g.2110275G>T - - SMARCA2_000136 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.3347G>C r.(?) p.(Gly1116Ala) - VUS g.2110308G>C g.2110308G>C SMARCA2(NM_003070.4):c.3347G>C (p.G1116A) - SMARCA2_000148 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 24 c.3377C>G r.(?) p.(Thr1126Arg) - VUS g.2110338C>G g.2110338C>G (p.Thr1126Arg), not specified - SMARCA2_000102 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
?/. 1 - c.3383C>A r.(?) p.(Ala1128Asp) - VUS g.2110344C>A g.2110344C>A - - SMARCA2_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 24 c.3385G>C r.(?) p.(Gly1129Arg) - VUS g.2110346G>C g.2110346G>C p.(Gly1129Arg), not specified - SMARCA2_000103 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
?/. 1 24 c.3392T>C r.(?) p.(Leu1131Pro) - VUS g.2110353T>C g.2110353T>C p.(Leu1131Pro), not specified - SMARCA2_000104 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
+?/. 1 - c.3394G>C r.(?) p.(Gly1132Arg) - likely pathogenic g.2110355G>C g.2110355G>C - - SMARCA2_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 24 c.3395G>A r.(?) p.(Gly1132Asp) - VUS g.2110356G>A g.2110356G>A p.(Gly1132Asp), not specified - SMARCA2_000105 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
+/?, ?/. 2 24 c.3404T>C r.(?) p.(Leu1135Pro) - pathogenic, VUS g.2110365T>C g.2110365T>C p.(Leu1135Pro), not specified - SMARCA2_000016 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
+/? 1 24 c.3436A>C r.(?) p.(Ser1146Arg) - pathogenic g.2110397A>C g.2110397A>C - - SMARCA2_000025 - PubMed: Van Houdt et al 2012 - - Unknown - - - - - SIB - Livia Famiglietti
+?/. 1 - c.3437G>C r.(?) p.(Ser1146Thr) - likely pathogenic g.2110398G>C g.2110398G>C SMARCA2(NM_003070.4):c.3437G>C (p.S1146T) - SMARCA2_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.3438C>T r.(?) p.(Ser1146=) - likely benign g.2110399C>T g.2110399C>T SMARCA2(NM_003070.4):c.3438C>T (p.S1146=) - SMARCA2_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 25 c.3464A>C r.(?) p.(Gln1155Pro) ACMG pathogenic (dominant) g.2115829A>C g.2115829A>C - - SMARCA2_000156 - PubMed: Squeo 2020 - - De novo - - - - - Johan den Dunnen
?/. 1 25 c.3466G>C r.(?) p.(Ala1156Pro) - VUS g.2115831G>C g.2115831G>C p.(Ala1156Pro), not specified - SMARCA2_000106 - PubMed: Sousa SB 2014 - - Unknown - - - - - Julia Lopez
+/?, ?/. 2 25 c.3473A>T r.(?) p.(Asp1158Val) - pathogenic, VUS g.2115838A>T g.2115838A>T p.(Asp1158Val), not specified - SMARCA2_000004 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
+/?, ?/. 4 25 c.3475C>G r.(?) p.(Arg1159Gly) - pathogenic, VUS g.2115840C>G g.2115840C>G p.(Arg1159Gly), not specified - SMARCA2_000005 - PubMed: Van Houdt et al 2012, PubMed: Sousa SB 2014 - - Unknown - - - - - SIB - Livia Famiglietti, Julia Lopez
Legend   How to query   « First ‹ Prev     1 2     Next › Last »