All transcript variants in gene SMARCA2

Information The variants shown are described using the NM_003070.3 transcript reference sequence.

299 entries on 3 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2 3     Next › Last »



AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







?/. - c.? r.(?) p.(Glu852Asp) - VUS g.? - p.(Glu852Asp), not specified - PTCH1_000000 - PubMed: Sousa SB 2014 - - Unknown - - - 0 - Julia Lopez
?/. - c.? r.(?) p.(Phe903Leu) - VUS g.? - p.(Phe903Leu), not specified - PTCH1_000000 - PubMed: Sousa SB 2014 - - Unknown - - - 0 - Julia Lopez
?/. - c.? r.(?) p.(Gly881Arg) - VUS g.? - p.(Gly881Arg), not specified - PTCH1_000000 - PubMed: Sousa SB 2014 - - Unknown - - - 0 - Julia Lopez
?/. - c.? r.(?) p.(Leu946Phe) - VUS g.? - p.(Leu946Phe), not specified - PTCH1_000000 - PubMed: Sousa SB 2014 - - Unknown - - - 0 - Julia Lopez
?/. - c.? r.(?) p.(Ser1146Arg) - VUS g.? - p.(Ser1146Arg), not specified - PTCH1_000000 - PubMed: Sousa SB 2014 - - Unknown - - - 0 - Julia Lopez
./. - c.-1811337_*6006260del r.0? p.0? - pathogenic g.204104_8198999del g.204104_8198999del - - GLDC_000111 decreased gene dosage PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - 0 - Johan den Dunnen
?/? - c.-5G>A r.(=) p.(=) - VUS g.2029018G>A g.2029018G>A - - SMARCA2_000054 - - - - Unknown - - - - - Gijs Santen
?/? - c.-5G>A r.(=) p.(=) - VUS g.2029018G>A g.2029018G>A - - SMARCA2_000054 - - - - Unknown - - - - - Gijs Santen
?/? - c.-5G>A r.(=) p.(=) - VUS g.2029018G>A g.2029018G>A - - SMARCA2_000054 - - - - Unknown - - - - - Gijs Santen
?/. - c.8C>T r.(?) p.(Thr3Met) - VUS g.2029030C>T g.2029030C>T SMARCA2(NM_003070.3):c.8C>T (p.(Thr3Met)), SMARCA2(NM_003070.4):c.8C>T (p.T3M) - SMARCA2_000151 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.8C>T r.(?) p.(Thr3Met) - likely benign g.2029030C>T g.2029030C>T SMARCA2(NM_003070.3):c.8C>T (p.(Thr3Met)), SMARCA2(NM_003070.4):c.8C>T (p.T3M) - SMARCA2_000151 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.47C>T r.(?) p.(Ser16Leu) - VUS g.2029069C>T g.2029069C>T SMARCA2(NM_003070.3):c.47C>T (p.(Ser16Leu)) - SMARCA2_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.161C>T r.(?) p.(Ser54Phe) - VUS g.2029183C>T g.2029183C>T SMARCA2(NM_003070.3):c.161C>T (p.(Ser54Phe)) - SMARCA2_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.335C>A r.(?) p.(Pro112Gln) - likely benign g.2033061C>A g.2033061C>A SMARCA2(NM_003070.3):c.335C>A (p.(Pro112Gln)) - SMARCA2_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.370C>T r.(?) p.(His124Tyr) - VUS g.2039480C>T g.2039480C>T - - SMARCA2_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
?/. - c.511C>A r.(?) p.(Pro171Thr) - VUS g.2039621C>A g.2039621C>A SMARCA2(NM_003070.4):c.511C>A (p.P171T) - SMARCA2_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.666A>G r.(?) p.(Gln222=) - likely benign g.2039776A>G g.2039776A>G SMARCA2(NM_003070.4):c.666_669delACAGinsGCAG (p.Q222_Q223=) - SMARCA2_000114 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.668_669del r.(?) p.(Gln223ProfsTer35) - VUS g.2039778_2039779del g.2039778_2039779del SMARCA2(NM_003070.4):c.668_669delAG (p.Q223Pfs*35) - SMARCA2_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
?/? - c.683A>C r.(?) p.(Gln228Pro) - VUS g.2039793A>C g.2039793A>C - - SMARCA2_000040 - - - - Unknown - - - - - Gijs Santen
?/? - c.683A>C r.(?) p.(Gln228Pro) - VUS g.2039793A>C g.2039793A>C - - SMARCA2_000040 - - - - Unknown - - - - - Gijs Santen
-/. - c.685_686insCGC r.(?) p.(Gln228_Gln229insPro) - benign g.2039795_2039796insCGC g.2039795_2039796insCGC SMARCA2(NM_003070.4):c.685_686insCGC (p.Q228_Q229insP) - SMARCA2_000119 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.685_686insCGC r.(?) p.(Gln228_Gln229insPro) - benign g.2039795_2039796insCGC g.2039795_2039796insCGC SMARCA2(NM_003070.4):c.685_686insCGC (p.Q228_Q229insP) - SMARCA2_000119 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.687_707del r.(?) p.(Gln232_Gln238del) - VUS g.2039797_2039817del - SMARCA2(NM_003070.4):c.687_707delGCAGCAGCAGCAGCAGCAGCA (p.Q232_Q238del) - SMARCA2_000154 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.693_707del r.(?) p.(Gln234_Gln238del) - likely benign g.2039803_2039817del g.2039803_2039817del SMARCA2(NM_003070.3):c.667_681del (p.(Gln228_Gln232del)), SMARCA2(NM_003070.4):c.693_707delGCAGCAGCAGCAGCA (p.Q234_Q238del) - SMARCA2_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.693_707del r.(?) p.(Gln234_Gln238del) - likely benign g.2039803_2039817del g.2039803_2039817del SMARCA2(NM_003070.3):c.667_681del (p.(Gln228_Gln232del)), SMARCA2(NM_003070.4):c.693_707delGCAGCAGCAGCAGCA (p.Q234_Q238del) - SMARCA2_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.695A>C r.(?) p.(Gln232Pro) - likely benign g.2039805A>C - SMARCA2(NM_003070.4):c.695A>C (p.Q232P) - SMARCA2_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.696_707del r.(?) p.(Gln235_Gln238del) - likely benign g.2039806_2039817del g.2039806_2039817del SMARCA2(NM_003070.3):c.667_678del (p.(Gln227_Gln230del)) - SMARCA2_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.699_707del r.(?) p.(Gln236_Gln238del) - likely benign g.2039809_2039817del g.2039809_2039817del SMARCA2(NM_003070.3):c.667_675del (p.(Gln226_Gln228del)), SMARCA2(NM_003070.4):c.699_707delGCAGCAGCA (p.Q236_Q238del) - SMARCA2_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.699_707del r.(?) p.(Gln236_Gln238del) - likely benign g.2039809_2039817del g.2039809_2039817del SMARCA2(NM_003070.3):c.667_675del (p.(Gln226_Gln228del)), SMARCA2(NM_003070.4):c.699_707delGCAGCAGCA (p.Q236_Q238del) - SMARCA2_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.699_707del r.(?) p.(Gln236_Gln238del) - likely benign g.2039809_2039817del - SMARCA2(NM_003070.3):c.667_675del (p.(Gln226_Gln228del)), SMARCA2(NM_003070.4):c.699_707delGCAGCAGCA (p.Q236_Q238del) - SMARCA2_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.699_707dup r.(?) p.(Gln236_Gln238dup) - likely benign g.2039809_2039817dup g.2039809_2039817dup SMARCA2(NM_003070.3):c.669_670insCAGCAGCAG (p.(Gln221_Gln223dup)), SMARCA2(NM_003070.4):c.699_707dupGCAGCAGCA (p.Q236_Q238dup) - SMARCA2_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.699_707dup r.(?) p.(Gln236_Gln238dup) - likely benign g.2039809_2039817dup g.2039809_2039817dup SMARCA2(NM_003070.3):c.669_670insCAGCAGCAG (p.(Gln221_Gln223dup)), SMARCA2(NM_003070.4):c.699_707dupGCAGCAGCA (p.Q236_Q238dup) - SMARCA2_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.699_707dup r.(?) p.(Gln236_Gln238dup) - benign g.2039809_2039817dup g.2039809_2039817dup SMARCA2(NM_003070.3):c.669_670insCAGCAGCAG (p.(Gln221_Gln223dup)), SMARCA2(NM_003070.4):c.699_707dupGCAGCAGCA (p.Q236_Q238dup) - SMARCA2_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.699_707dup r.(?) p.(Gln236_Gln238dup) - benign g.2039809_2039817dup g.2039809_2039817dup SMARCA2(NM_003070.3):c.669_670insCAGCAGCAG (p.(Gln221_Gln223dup)), SMARCA2(NM_003070.4):c.699_707dupGCAGCAGCA (p.Q236_Q238dup) - SMARCA2_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.702_707del r.(?) p.(Gln237_Gln238del) - benign g.2039812_2039817del - SMARCA2(NM_003070.4):c.702_707delGCAGCA (p.Q237_Q238del) - SMARCA2_000120 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.702_707dup r.(?) p.(Gln237_Gln238dup) - likely benign g.2039812_2039817dup g.2039812_2039817dup SMARCA2(NM_003070.3):c.669_670insCAGCAG (p.(Gln222_Gln223dup)), SMARCA2(NM_003070.4):c.702_707dupGCAGCA (p.Q237_Q238dup) - SMARCA2_000121 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.702_707dup r.(?) p.(Gln237_Gln238dup) - benign g.2039812_2039817dup g.2039812_2039817dup SMARCA2(NM_003070.3):c.669_670insCAGCAG (p.(Gln222_Gln223dup)), SMARCA2(NM_003070.4):c.702_707dupGCAGCA (p.Q237_Q238dup) - SMARCA2_000121 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.702_707dup r.(?) p.(Gln237_Gln238dup) - benign g.2039812_2039817dup g.2039812_2039817dup SMARCA2(NM_003070.3):c.669_670insCAGCAG (p.(Gln222_Gln223dup)), SMARCA2(NM_003070.4):c.702_707dupGCAGCA (p.Q237_Q238dup) - SMARCA2_000121 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.702_707dup r.(?) p.(Gln237_Gln238dup) - likely benign g.2039812_2039817dup g.2039812_2039817dup SMARCA2(NM_003070.3):c.669_670insCAGCAG (p.(Gln222_Gln223dup)), SMARCA2(NM_003070.4):c.702_707dupGCAGCA (p.Q237_Q238dup) - SMARCA2_000121 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - c.705_707del r.(?) p.(Gln238del) - benign g.2039815_2039817del g.2039815_2039817del SMARCA2(NM_003070.3):c.667_669del (p.(Gln238del)), SMARCA2(NM_003070.4):c.705_707delGCA (p.Q238del) - SMARCA2_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.705_707del r.(?) p.(Gln238del) - benign g.2039815_2039817del g.2039815_2039817del SMARCA2(NM_003070.3):c.667_669del (p.(Gln238del)), SMARCA2(NM_003070.4):c.705_707delGCA (p.Q238del) - SMARCA2_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.705_707del r.(?) p.(Gln238del) - likely benign g.2039815_2039817del g.2039815_2039817del SMARCA2(NM_003070.3):c.667_669del (p.(Gln238del)), SMARCA2(NM_003070.4):c.705_707delGCA (p.Q238del) - SMARCA2_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.705_707del r.(?) p.(Gln238del) - benign g.2039815_2039817del g.2039815_2039817del SMARCA2(NM_003070.3):c.667_669del (p.(Gln238del)), SMARCA2(NM_003070.4):c.705_707delGCA (p.Q238del) - SMARCA2_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.705_707del r.(?) p.(Gln238del) - VUS g.2039815_2039817del g.2039815_2039817del SMARCA2(NM_003070.3):c.667_669del (p.(Gln238del)), SMARCA2(NM_003070.4):c.705_707delGCA (p.Q238del) - SMARCA2_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.705_707dup r.(?) p.(Gln238dup) - benign g.2039815_2039817dup g.2039815_2039817dup SMARCA2(NM_003070.3):c.667_669dup (p.(Gln223dup)), SMARCA2(NM_003070.4):c.705_707dupGCA (p.Q238dup) - SMARCA2_000122 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.705_707dup r.(?) p.(Gln238dup) - benign g.2039815_2039817dup g.2039815_2039817dup SMARCA2(NM_003070.3):c.667_669dup (p.(Gln223dup)), SMARCA2(NM_003070.4):c.705_707dupGCA (p.Q238dup) - SMARCA2_000122 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.705_707dup r.(?) p.(Gln238dup) - likely benign g.2039815_2039817dup g.2039815_2039817dup SMARCA2(NM_003070.3):c.667_669dup (p.(Gln223dup)), SMARCA2(NM_003070.4):c.705_707dupGCA (p.Q238dup) - SMARCA2_000122 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.705_707dup r.(?) p.(Gln238dup) - likely benign g.2039815_2039817dup g.2039815_2039817dup SMARCA2(NM_003070.3):c.667_669dup (p.(Gln223dup)), SMARCA2(NM_003070.4):c.705_707dupGCA (p.Q238dup) - SMARCA2_000122 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.708A>G r.(?) p.(Gln236=) - likely benign g.2039818A>G g.2039818A>G SMARCA2(NM_003070.4):c.708A>G (p.Q236=) - SMARCA2_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/? - c.716_724dup r.(?) p.(Pro239_Gln241dup) - VUS g.2039826_2039834dup g.2039826_2039834dup - - SMARCA2_000041 - - - - Unknown - - - - - Gijs Santen
?/. - c.844G>A r.(?) p.(Ala282Thr) - VUS g.2047282G>A g.2047282G>A SMARCA2(NM_003070.3):c.844G>A (p.(Ala282Thr)) - SMARCA2_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.1018G>C r.(?) p.(Val340Leu) - VUS g.2047456G>C g.2047456G>C SMARCA2(NM_003070.4):c.1018G>C (p.V340L) - SMARCA2_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.1282A>G r.(?) p.(Met428Val) - VUS g.2056780A>G g.2056780A>G SMARCA2(NM_003070.4):c.1282A>G (p.M428V) - SMARCA2_000145 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
./. - c.1514G>A r.(?) p.(Arg505Gln) - pathogenic g.2058457G>A g.2058457G>A - - SMARCA2_000058 - PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - 0 - Johan den Dunnen
?/? - c.1522-48T>C r.(=) p.(=) - VUS g.2060768T>C g.2060768T>C - - SMARCA2_000035 - - - - Unknown - - - - - Gijs Santen
./. - c.1573C>T r.(?) p.(Arg525Cys) - pathogenic g.2060867C>T g.2060867C>T - - SMARCA2_000057 - PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - 0 - Johan den Dunnen
+/. - c.1573C>T r.(?) p.(Arg525Cys) - pathogenic g.2060867C>T g.2060867C>T - - SMARCA2_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
./. - c.1574G>A r.(?) p.(Arg525His) - pathogenic g.2060868G>A g.2060868G>A - - SMARCA2_000056 - PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - 0 - Johan den Dunnen
-?/. - c.1746+8A>G r.(=) p.(=) - likely benign g.2070479A>G g.2070479A>G SMARCA2(NM_003070.3):c.1746+8A>G (p.(=)) - SMARCA2_000125 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.1821C>T r.(?) p.(Phe607=) - likely benign g.2073286C>T g.2073286C>T SMARCA2(NM_003070.4):c.1821C>T (p.F607=) - SMARCA2_000146 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.1827A>G r.(?) p.(Pro609=) - benign g.2073292A>G g.2073292A>G SMARCA2(NM_003070.4):c.1827A>G (p.P609=) - SMARCA2_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.2037-9C>T r.(=) p.(=) - likely benign g.2077620C>T g.2077620C>T SMARCA2(NM_003070.4):c.2037-9C>T - SMARCA2_000126 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2136G>A r.(?) p.(Val712=) - likely benign g.2077728G>A g.2077728G>A SMARCA2(NM_003070.4):c.2136G>A (p.V712=) - SMARCA2_000147 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. - c.2226_2231delinsT r.(?) p.(Leu743Argfs*6) - likely pathogenic g.2081873_2081878delinsT g.2081873_2081878delinsT - - SMARCA2_000095 - - - - Unknown - - - 0 - IMGAG
+/? 15 c.2255G>C r.(?) p.(Gly752Ala) - pathogenic g.2081902G>C g.2081902G>C - - SMARCA2_000019 - PubMed: Van Houdt et al 2012 - - Unknown - - - 0 - SIB - Livia Famiglietti
?/. 15 c.2255G>C r.(?) p.(Gly752Ala) - VUS g.2081902G>C g.2081902G>C p.(Gly752Ala), not specified - SMARCA2_000019 - PubMed: Sousa SB 2014 - - Unknown - - - 0 - Julia Lopez
?/. 15 c.2255G>C r.(?) p.(Gly752Ala) - VUS g.2081902G>C g.2081902G>C p.(G752A), not specified - SMARCA2_000019 - PubMed: Sousa SB 2014 - - Unknown - - - 0 - Julia Lopez
+/? 15 c.2264A>G r.(?) p.(Lys755Arg) - pathogenic g.2081911A>G g.2081911A>G - - SMARCA2_000024 - PubMed: Van Houdt et al 2012 - - Unknown - - - 0 - SIB - Livia Famiglietti
?/. 15 c.2264A>G r.(?) p.(Lys755Arg) - VUS g.2081911A>G g.2081911A>G p.(Lys755Arg), not specified - SMARCA2_000024 - PubMed: Sousa SB 2014 - - Unknown - - - 0 - Julia Lopez
+/? 15 c.2267C>T r.(?) p.(Thr756Ile) - pathogenic g.2081914C>T g.2081914C>T - - SMARCA2_000012 - PubMed: Van Houdt et al 2012 - - Unknown - - - 0 - SIB - Livia Famiglietti
?/. 15 c.2267C>T r.(?) p.(Thr756Ile) - VUS g.2081914C>T g.2081914C>T p(.T756I), not specified - SMARCA2_000012 - PubMed: Sousa SB 2014 - - Unknown - - - 0 - Julia Lopez
?/. 15 c.2348C>G r.(?) p.(Ser783Trp) - VUS g.2081995C>G g.2081995C>G p.(Ser783Trp), not specified - SMARCA2_000097 - PubMed: Sousa SB 2014 - - Unknown - - - 0 - Julia Lopez
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
?/? - c.2349-10del r.(=) p.(=) - VUS g.2083337del g.2083337del - - SMARCA2_000036 - - - - Unknown - - - - - Gijs Santen
-/. - c.2349-10dup r.(=) p.(=) - benign g.2083337dup g.2083337dup SMARCA2(NM_003070.4):c.2349-10dupT - SMARCA2_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
?/? - c.2349-9del r.(=) p.(=) - VUS g.2083338del g.2083338del - - SMARCA2_000042 - - - - Unknown - - - - - Gijs Santen
Legend   « First ‹ Prev     1 2 3     Next › Last »