Legend
Please note that a short description of a certain column can be displayed when you move your mouse cursor over the column's header and hold it still. Below, a more detailed description is shown per column.
Effect: The variant's effect on the function of the gene/protein, displayed in the format 'R/C'. R is the value reported by the source (publication, submitter) and this classification may vary between records. C is the value concluded by the curator. Note that in some database the curator uses Summary records to give details on the classification of the variant.Values used: '+' indicating the variant affects function, '+?' probably affects function, '-' does not affect function, '-?' probably does not affect function, '?' effect unknown, '.' effect was not classified.
Exon: number of exon/intron containing variant; 2 = exon 2, 12i = intron 12, 2i_7i = from intron 2 to intron 7, 8i_9 = intron 8/exon 9 boundary, _1 = 5' to exon 1, 18_ = 3' of exon 18, _1_18_ = encompassing the entire 18-exon gene
DNA change (cDNA): description of variant at DNA level, based on a coding DNA reference sequence (following HGVS recommendations); e.g. c.123C>T, c.123_145del, c.123_126dup. For deletions/duplications extending beyond the reference transcript resp. {0}/{2} is used to replace del/dup. Extent of the deletion/duplication should be specified using the genomic description (g.). "-" indicates the variant described on genomic level does not affect the coding DNA reference sequence.
RNA change: description of variant at RNA level (following HGVS recommendations).
- r.123c>u
- r.? = unknown
- r.(?) = RNA not analysed but probably transcribed copy of DNA variant
- r.spl? = RNA not analysed but variant probably affects splicing
- r.(spl?) = RNA not analysed but variant may affect splicing
- r.0? = change expected to abolish transcription
Protein: description of variant at protein level (following HGVS recommendations).
- p.(Arg345Pro) = change predicted from DNA (RNA not analysed)
- p.Arg345Pro = change derived from RNA analysis
- p.? = unknown effect
- p.0? = probably no protein produced
Allele: On which allele is the variant located? Does not necessarily imply inheritance! 'Paternal' (confirmed or inferred), 'Maternal' (confirmed or inferred), 'Parent #1' or #2 for compound heterozygosity without having screened the parents, 'Unknown' for heterozygosity without having screened the parents, 'Both' for homozygozity.
Classification method: The method used for the clinical classification of this variant.
All options:
- ACMG
- ACGS
- EAHAD-CFDB
- ENIGMA
- IARC
- InSiGHT
- kConFab
- other
Clinical classification: Clinical classification of variant, preferably based on standardised criteria (e.g. ACMG), directed on the clinical consequences as published/submitted, indicated using an enriched system including inheritance: e.g. pathogenic, pathogenic (dominant), pathogenic (recessive), pathogenic (!), pathogenic (maternal), pathogenic (paternal). Standard inheritance is covered by dominant/recessive, imprinting by maternal/paternal. A '!' warns for exceptional circumstances to be explained in the 'Remarks' field (low penetrance, variants pathogenic in heterozygous state only, hypomorphic/hypermorphic variants, protective variants, etc.). Non-disease consequences (e.g. drug metabolism (pharmacogenetics), risk factor, blood group, tasting bitter) are indicated using additions to the benign classification; benign (dominant), benign (recessive), benign (!), etc. The value 'association' is used for variants associated with a phenotype and 'NA' for variants from in vitro/in silico records. NOTE: classification may differ from the opinion of the curator as given in a variant SUMMARY-record or the 'Functional effect concluded'). NOTE: pathogenic/likely pathogenic should go together with "variant (probably) affects function" In ClassFunctional.
All options:
- pathogenic
- pathogenic (dominant)
- pathogenic (recessive)
- pathogenic (!)
- pathogenic (maternal)
- pathogenic (paternal)
- likely pathogenic
- likely pathogenic (dominant)
- likely pathogenic (recessive)
- likely pathogenic (!)
- likely pathogenic (maternal)
- likely pathogenic (paternal)
- VUS
- VUS (!)
- likely benign
- likely benign (dominant)
- likely benign (recessive)
- likely benign (!)
- likely benign (maternal)
- likely benign (paternal)
- benign
- benign (dominant)
- benign (recessive)
- benign (!)
- benign (maternal)
- benign (paternal)
- conflicting
- association
- NA
DNA change (genomic) (hg19): HGVS description of variant at DNA level, based on the genomic (chromosomal) DNA reference sequence; e.g. g.12345678C>T, g.12345679del, g.12345678_12345890dup
DNA change (hg38): HGVS description of variant at DNA level, based on the hg38 genomic (chromosomal) eference sequence; e.g. g.12345678C>T, g.12345679del, g.12345678_12345890dup
Published as: listed only when different from "DNA change"; variant as reported originally (e.g. 521delT). Variants seen in animal models, tested in vitro, predicted from RNA analysis, etc. are described between brackets like c.(456C>G)
ISCN: description of the variant according to ISCN nomenclature
DB-ID: database ID of variant, grouping multiple observations of the same variant together, starting with the HGNC gene symbol, followed by an underscore (_) and a six digit number (e.g. DMD_012345). _000000 is used for variants where DNA was not analysed (change predicted from RNA analysis), variants seen in animal models or variants not seen in humans but functionally tested in vitro
Variant remarks: remarks regarding variant described, e.g. germline mosaicism in mother, 345 kb deletion, muscle RNA analysed, not in 200 control chromosomes tested, on founder haplotype, etc.
Reference: publication describing the variant submitted, incl. links to OMIM, PubMed or other source, e.g. "den Dunnen ASHG2003 P2346"
ClinVar ID: ID of variant in ClinVar database
dbSNP ID: the dbSNP ID
Origin: Origin of variant/record: Germline = in all cells, De novo = in all cells, but not in either parent, Germline/De novo (untested) = in all cells, parents not tested (use only when De novo is likely, e.g. isolated/sporadic cases with dominant disease), Somatic = present in a subset of cells, but not in either parent, Uniparental disomy = from parental disomy (maternal or paternal), CLASSIFICATION record = submitter only sharing variant classification (note another report may share Individual data), SUMMARY record = master summary record from curator (may link to another database), In vitro (cloned) = data resulting from in vitro functional assays, animal model = data from animal model, Artefact = false positive variant call, DUPLICATE record = variant already described on another chromosome (e.g. unbalanced translocation, duplicating transposition, 2nd fusion transcript, etc.)
All options:
- Germline
- De novo
- Germline/De novo (untested)
- Somatic
- Uniparental disomy
- Uniparental disomy, maternal allele
- Uniparental disomy, paternal allele
- CLASSIFICATION record
- SUMMARY record
- In vitro (cloned)
- In silico
- animal model
- Artefact
- DUPLICATE record
- Unknown
- Not applicable
Segregation: Indicates whether the variant segregates with the phenotype (yes), does not segregate with the phenotype (no) or segregation is unknown (?)
All options:
- ? = unknown
- yes = segregates with phenotype
- no = does not segregate with phenotype
- - = not applicable
Frequency: frequency in which the variant was found; e.g 5/760 chromosomes (in 5 of 760 chromosomes tested), 1/33 patients (in 1 of 33 patients analysed in study), 0.05 controls (in 5% of control cases tested)
Re-site: restriction enzyme recognition site created (+) or destroyed (-); e.g. BglII+;BamHI-
VIP: variant VIP-status was requested for matchmaking - need collaboration(s) to crack the case - please contact the submitter/curator.
NOTE: to get VIP status ask the curator.
Methylation: result of methylation test; GOM (gain of methylation), LOM (loss of methylation), 30% (30% methylated). NOTE: when several tests were done mention the method as well (e.g. MS-PCR 75%)

 Effect
|

 Exon
|

 DNA change (cDNA)
|

 RNA change
|

 Protein
|

 Classification method
|

 Clinical classification
|

 DNA change (genomic) (hg19)
|

 DNA change (hg38)
|

 Published as
|

 ISCN
|

 DB-ID
|
 Variant remarks
|

 Reference
|

 ClinVar ID
|

 dbSNP ID
|

 Origin
|

 Segregation
|

 Frequency
|

 Re-site
|

 VIP
|

 Methylation
|

 Owner
|
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57291915_57518137dup |
g.59214554_59440776dup |
RP17_SV1 |
- |
GDPD1_000001 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57260521_57515862dup |
g.59183160_59438501dup |
RP17_SV5 |
- |
GDPD1_000005 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57324706_57324707ins[A;57440106_57510754;57295982_57510754;57295982_57324706] |
g.59247345_59247346ins[A;59362745_59433393;59218621_59433393;59218621_59247345] |
RP17_SV6 |
- |
GDPD1_000006 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020, Journal: de Bruijn 2024 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57280008_57483883delins[57233035_57634900inv;TAAGCA] |
g.59202647_59406522delins[59155674_59557539inv;TAAGCA] |
RP17_SV4 |
- |
GDPD1_000004 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678] |
g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317] |
RP17_SV3 |
- |
GDPD1_000003 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678] |
g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317] |
RP17_SV3 |
- |
GDPD1_000003 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678] |
g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317] |
RP17_SV3 |
- |
GDPD1_000003 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678] |
g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317] |
RP17_SV3 |
- |
GDPD1_000003 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57326235_57413152delins[CT;57277347_57631659inv] |
g.59248874_59335791delins[CT;59199986_59554298inv] |
RP17_SV8 |
- |
GDPD1_000008 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57453631_57468930delins[57259525_57710821inv;TT] |
g.59376270_59391569delins[59182164_59633460inv;TT] |
RP17_SV7 |
- |
GDPD1_000007 |
- |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
PubMed: Panneman 2023, Journal: Panneman 2023 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57456111_57468959delins[57275839_57559111inv;AGGCTGGTC] |
g.59378750_59391598delins[59198478_59481750inv;AGGCTGGTC] |
RP17_SV2 |
- |
GDPD1_000002 |
- |
Journal: de Bruijn 2024 |
- |
- |
Germline |
- |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678] |
g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317] |
RP17_SV3 |
- |
GDPD1_000003 |
- |
Journal: de Bruijn 2024 |
- |
- |
Germline |
- |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678] |
g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317] |
RP17_SV3 |
- |
GDPD1_000003 |
- |
Journal: de Bruijn 2024 |
- |
- |
Germline |
- |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
likely pathogenic (dominant) |
g.57626499_57626500ins[57413643_57623126inv;57264682_57626499] |
g.59549138_59549139ins[59336282_59545765inv;59187321_59549138] |
RP17_SV9 |
- |
GDPD1_000010 |
- |
Journal: de Bruijn 2024 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| +/. |
- |
c.? |
r.? |
p.? |
- |
pathogenic (dominant) |
g.57365657_57439922delins[57297473_57555520inv;A] |
g.59288296_59362561delins[59220112_59478159inv;A] |
RP17_SV10 |
- |
GDPD1_000011 |
- |
Journal: de Bruijn 2024 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Suzanne de Bruijn |
| ?/. |
- |
c.8G>C |
r.(?) |
p.(Gly3Ala) |
- |
VUS |
g.57287420G>C |
- |
SMG8(NM_018149.7):c.8G>C (p.(Gly3Ala)) |
- |
PRR11_000008 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
VKGL-NL_Leiden |
| -?/. |
- |
c.255T>C |
r.(?) |
p.(Pro85=) |
- |
likely benign |
g.57287667T>C |
- |
SMG8(NM_018149.7):c.255T>C (p.P85=) |
- |
PRR11_000002 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
VKGL-NL_AMC |
| +?/. |
- |
c.441dup |
r.(?) |
p.(Val148Serfs*11) |
- |
likely pathogenic (recessive) |
g.57287853dup |
g.59210492dup |
441dupA |
- |
SMG8_000002 |
- |
PubMed: Alzahrani 2020, Journal: Alzahrani 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Johan den Dunnen |
| +?/. |
- |
c.441dup |
r.(?) |
p.(Val148Serfs*11) |
- |
likely pathogenic (recessive) |
g.57287853dup |
g.59210492dup |
441dupA |
- |
SMG8_000002 |
- |
PubMed: Alzahrani 2020, Journal: Alzahrani 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Johan den Dunnen |
| +?/. |
- |
c.623A>G |
r.(?) |
p.(His208Arg) |
- |
likely pathogenic (recessive) |
g.57288035A>G |
g.59210674A>G |
- |
- |
SMG8_000003 |
- |
PubMed: Alzahrani 2020, Journal: Alzahrani 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Johan den Dunnen |
| +?/. |
- |
c.623A>G |
r.(?) |
p.(His208Arg) |
- |
likely pathogenic (recessive) |
g.57288035A>G |
g.59210674A>G |
- |
- |
SMG8_000003 |
- |
PubMed: Alzahrani 2020, Journal: Alzahrani 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Johan den Dunnen |
| +?/. |
- |
c.623A>G |
r.(?) |
p.(His208Arg) |
- |
likely pathogenic (recessive) |
g.57288035A>G |
g.59210674A>G |
- |
- |
SMG8_000003 |
- |
PubMed: Alzahrani 2020, Journal: Alzahrani 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Johan den Dunnen |
| ?/. |
- |
c.631C>T |
r.(?) |
p.(Leu211Phe) |
- |
VUS |
g.57288043C>T |
- |
SMG8(NM_018149.7):c.631C>T (p.(Leu211Phe)) |
- |
PRR11_000007 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
VKGL-NL_Leiden |
| -?/. |
- |
c.717G>C |
r.(?) |
p.(Pro239=) |
- |
likely benign |
g.57288129G>C |
- |
SMG8(NM_018149.7):c.717G>C (p.P239=) |
- |
PRR11_000003 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
VKGL-NL_AMC |
| ?/. |
- |
c.935T>C |
r.(?) |
p.(Phe312Ser) |
- |
VUS |
g.57288347T>C |
- |
SMG8(NM_018149.7):c.935T>C (p.(Phe312Ser)) |
- |
PRR11_000006 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
VKGL-NL_Leiden |
| +?/. |
- |
c.1121_1122insG |
r.(?) |
p.(Gly375TrpfsTer3) |
- |
VUS |
g.57288533_57288534insG |
g.59211172_59211173insG |
- |
- |
SMG8_000007 |
reported as candidate disease gene |
PubMed: Al-Kasbi 2022 |
- |
- |
Germline |
- |
- |
- |
- |
- |
Johan den Dunnen |
| +?/. |
- |
c.1125dup |
r.(?) |
p.(Pro376Alafs*2) |
- |
likely pathogenic (recessive) |
g.57288537dup |
g.59211176dup |
1125dupG |
- |
SMG8_000004 |
- |
PubMed: Alzahrani 2020, Journal: Alzahrani 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Johan den Dunnen |
| +?/. |
- |
c.1125dup |
r.(?) |
p.(Pro376Alafs*2) |
- |
likely pathogenic (recessive) |
g.57288537dup |
g.59211176dup |
1125dupG |
- |
SMG8_000004 |
- |
PubMed: Alzahrani 2020, Journal: Alzahrani 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Johan den Dunnen |
| -?/. |
- |
c.1129A>C |
r.(?) |
p.(=) |
- |
likely benign |
g.57288541A>C |
- |
SMG8(NM_018149.7):c.1129A>C (p.R377=) |
- |
PRR11_000005 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
VKGL-NL_AMC |
| ?/. |
- |
c.1375G>A |
r.(?) |
p.(Ala459Thr) |
- |
VUS |
g.57288787G>A |
- |
SMG8(NM_018149.7):c.1375G>A (p.A459T) |
- |
PRR11_000004 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
VKGL-NL_Groningen |
| -?/. |
- |
c.1788G>T |
r.(?) |
p.(Pro596=) |
- |
likely benign |
g.57289730G>T |
- |
SMG8(NM_018149.7):c.1788G>T (p.P596=) |
- |
SMG8_000006 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
VKGL-NL_AMC |
| -?/. |
- |
c.2318C>T |
r.(?) |
p.(Pro773Leu) |
- |
likely benign |
g.57290502C>T |
- |
SMG8(NM_018149.7):c.2318C>T (p.(Pro773Leu)) |
- |
SMG8_000009 |
VKGL data sharing initiative Nederland |
- |
- |
- |
CLASSIFICATION record |
- |
- |
- |
- |
- |
VKGL-NL_Leiden |
| +?/. |
- |
c.2515C>T |
r.(?) |
p.(Arg839*) |
- |
likely pathogenic (recessive) |
g.57290699C>T |
g.59213338C>T |
- |
- |
SMG8_000005 |
- |
PubMed: Alzahrani 2020, Journal: Alzahrani 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Johan den Dunnen |
| +?/. |
- |
c.2515C>T |
r.(?) |
p.(Arg839*) |
- |
likely pathogenic (recessive) |
g.57290699C>T |
g.59213338C>T |
- |
- |
SMG8_000005 |
- |
PubMed: Alzahrani 2020, Journal: Alzahrani 2020 |
- |
- |
Germline |
yes |
- |
- |
- |
- |
Johan den Dunnen |
| ?/. |
- |
c.2668T>C |
r.(?) |
p.(Tyr890His) |
- |
VUS |
g.57290852T>C |
- |
- |
- |
SMG8_000008 |
- |
- |
- |
rs137980220 |
Unknown |
- |
- |
- |
- |
- |
MobiDetails |
| ?/. |
- |
c.2668T>C |
r.(?) |
p.(Tyr890His) |
- |
VUS |
g.57290852T>C |
- |
- |
- |
SMG8_000008 |
- |
- |
- |
rs137980220 |
Unknown |
- |
- |
- |
- |
- |
MobiDetails |