Unique variants in the SPRED1 gene

Information The variants shown are described using the NM_152594.2 transcript reference sequence.

192 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »




AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







+/+ 1 TGD+flanking c.-5366987_*1155801del r.0 p.0 - pathogenic g.? - c.-335-u5366652_*5585+d1150216del - SPRED1_000088 5.97Mb deletion PubMed: Spencer 2011 - - Unknown - - - - - Ludwine Messiaen
+/+ 1 TGD+flanking c.-5076117_*799493del r.0 p.0 - pathogenic g.? - c.-335-u5075783_*5585+d793907del - SPRED1_000087 3.24Mb deletion PubMed: Brems et al, 2012 - - Unknown - - - - - Ludwine Messiaen
+/+ 1 TGD+flanking c.-753083_*142221del r.0 p.0 - pathogenic g.37792304_38786086del - - - SPRED1_000089 0.878-0.993Mb sized deletion PubMed: Spencer 2011 - - Unknown - - - - - Ludwine Messiaen
+/+ 1 TGD+flanking c.-581681_*2562437del r.0 p.0 - pathogenic g.? - c.-335-u581346_*5585+d2556852del - SPRED1_000086 6.6Mb deletion PubMed: Brems et al, 2012 - - De novo - - - - - Ludwine Messiaen
+/+ 1 TGD+flanking c.-440412_*1383539del r.0 p.0 - pathogenic g.? - c.-335-u440077_*5585+d1377954del - SPRED1_000085 1.92Mb deletion PubMed: Brems et al, 2012 - - Unknown - - - - - Ludwine Messiaen
+/+ 2 TGD+flanking c.-163137_*707118del r.0 p.0 - pathogenic g.38382250_39350983del - - - SPRED1_000133, SPRED1_000159 novel Messiaen UAB, unpublished novel mutation, Popovici C, Marseille, France - - Unknown - - - - - Ludwine Messiaen, Cornel POPOVICI
+/+ 1 prom-4 c.(?_-1175)_(423+19_?)del r.0? p.0? - pathogenic g.? - c.1-1175-?_423+19+?del - SPRED1_000083 Domain: EVH-1 PubMed: Brems et al, 2012 - - Unknown - - - - - Ludwine Messiaen
+/+ 1 prom-1 c.(?_-845)_(32+8517_?)del r.0? p.0? - pathogenic g.? - c.1-845-?_c.32+8517+?del - SPRED1_000098 ~9.4-41.4kb deletion / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
+/+ 1 prom-1 c.(?_-800)_(32+1_?)del r.0? p.0? - pathogenic g.? - c.1-800-?_c.32+?del - SPRED1_000084 deletion with minimum size of 111; maximum size of 203.8 kb / Domain: EVH-1 PubMed: Spencer 2011 - - Germline - - - - - Ludwine Messiaen
?/? 1 5'UTR c.-24A>G r.(?) p.(=) - VUS g.38545363A>G g.38253162A>G - - SPRED1_000158 - Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
+/. 1 - c.1A>T r.(?) p.(Met1?) - pathogenic g.38545387A>T - - - SPRED1_000223 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/+? 1 1 c.2T>C r.(?) p.(?) - likely pathogenic g.38545388T>C g.38253187T>C - - SPRED1_000002 - PubMed: Pasmant 2009 - - Germline - - - - - Ludwine Messiaen
+/+ 1 1 c.7G>T r.(?) p.(Glu3*) - pathogenic g.38545393G>T g.38253192G>T - - SPRED1_000005 - PubMed: Messiaen 2009 - - Germline - - - - - Ludwine Messiaen
+/+ 1 1 c.7_20del r.(?) p.(Glu3Phefs*2) - pathogenic g.38545393_38545406del g.38253192_38253205del - - SPRED1_000004 Domain: EVH-1 PubMed: Messiaen 2009 - - Germline - - - - - Ludwine Messiaen
+/+ 1 1 c.18del r.(?) p.(Thr7Leufs*15) - pathogenic g.38545404del g.38253203del - - SPRED1_000102 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - De novo - - - - - Ludwine Messiaen
+/+ 1 1 c.22del r.(?) p.(Ser8Leufs*14) - pathogenic g.38545408del g.38253207del - - SPRED1_000139 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
?/? 4 1 c.26A>T r.26a>u p.Asp9Val - VUS g.38545412A>T g.38253211A>T - - SPRED1_000001 Domain: EVH-1, 1 more item PubMed: Brems et al, 2012 - rs200157475 Germline, Unknown - - - - - Ludwine Messiaen
-?/? 1 1 c.27C>A r.(?) p.(Asp9Glu) - likely benign g.38545413C>A g.38253212C>A - - SPRED1_000134 Domain: EVH-1 Trevisson, University of Padova, unpublished novel mutation - - Germline - - - - - Eva Trevisson
-?/-? 2 1 c.30C>A r.30c>a p.Asn10Lys - likely benign g.38545416C>A g.38253215C>A - - SPRED1_000003 Domain: EVH-1 PubMed: Brems et al, 2012 - rs201692618 De novo, Unknown - - - - - Ludwine Messiaen
+?/+? 1 1 c.32+2T>C r.spl? p.(?) - likely pathogenic g.38545420T>C g.38253219T>C - - SPRED1_000117 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Germline - - - - - Ludwine Messiaen
-/. 1 - c.32+20C>T r.(=) p.(=) - benign g.38545438C>T g.38253237C>T SPRED1(NM_152594.2):c.32+20C>T - SPRED1_000176 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/-? 1 1 c.32+43A>G r.= p.= - likely benign g.38545461A>G g.38253260A>G - - SPRED1_000118 Domain: EVH-1 - - rs189604029 De novo - - - - - Ludwine Messiaen
+/+ 1 2-6 c.33-20604_684+401delinsGAAA r.33_684del p.Asp11Glufs*4 - pathogenic g.38570970_38642125delinsGAAA g.38278769_38349924delinsGAAA - - SPRED1_000082 71 kb deletion / Domain: EVH-1 PubMed: Spencer 2011 - - Germline - - - - - Ludwine Messiaen
+/+ 1 2-4 c.(?_33-17014)_(423+568)delins5 r.(?) p.(Asn12Profs*17) - pathogenic g.? - c.33-17014_423+568delins5 - SPRED1_000103 43 kb deletion / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Germline - - - - - Ludwine Messiaen
+/+ 1 2-4 c.(?_33-5928)_(423+19_?)del r.33_423del p.Asn12Profs*17 - pathogenic g.? - c.33-5928-?_423+19+?del - SPRED1_000094 ~31.4-73.7kb deletion / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
-?/. 1 - c.33-6T>C r.(=) p.(=) - likely benign g.38591568T>C g.38299367T>C SPRED1(NM_152594.2):c.33-6T>C (p.(=)) - SPRED1_000211 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/-? 1 2 c.42T>C r.= p.= - likely benign g.38591583T>C g.38299382T>C - - SPRED1_000010 Domain: EVH-1 PubMed: Messiaen 2009 - - Unknown - - - - - Ludwine Messiaen
+/+, +/., ?/+ 12 2 c.46C>T r.(?), r.46c>u p.(Arg16*), p.(Arg16Ter), p.Arg16* - pathogenic, pathogenic (dominant), VUS g.38591587C>T g.38299386C>T - - SPRED1_000011, SPRED1_000206 Domain: EVH-1, VKGL data sharing initiative Nederland, 2 more items PubMed: Pasmant 2009 - - CLASSIFICATION record, Germline, Germline/De novo (untested), Unknown - - - - - Beatrice Parfait, Ludwine Messiaen, VKGL-NL_Nijmegen, Andri Miltiadous
+/+, +/. 9 2 c.52C>T r.(?), r.52c>u p.(Arg18Ter), p.Arg18* - pathogenic g.38591593C>T g.38299392C>T SPRED1(NM_152594.2):c.52C>T (p.R18*) - SPRED1_000012, SPRED1_000177 Domain: EVH-1, VKGL data sharing initiative Nederland, 1 more item PubMed: Messiaen 2009 - - CLASSIFICATION record, De novo, Germline, Unknown - - - - - VKGL-NL_Rotterdam, Ludwine Messiaen
+/+ 1 2 c.60_61insC r.(?) p.(Val21Argfs*6) - pathogenic g.38591601_38591602insC g.38299400_38299401insC - - SPRED1_000013 Domain: EVH-1 PubMed: Messiaen 2009 - - Unknown - - - - - Ludwine Messiaen
+/+, +/., ?/+ 13 2 c.70C>T r.(?), r.70c>u p.(Arg24*), p.(Arg24Ter), p.Arg24* ACMG pathogenic, pathogenic (dominant), VUS g.38591611C>T g.38299410C>T SPRED1(NM_152594.2):c.70C>T (p.R24*) - SPRED1_000014 ACMG: PVS1, PM2, PS4_SUP: class 5, Domain: EVH-1, VKGL data sharing initiative Nederland, 2 more items PMID: 17704776, 19920235, 21089071, PubMed: Brems 2007 - rs121434313 CLASSIFICATION record, De novo, Germline, Unknown ? - - - - Beatrice Parfait, Andreas Laner, VKGL-NL_Rotterdam, Ludwine Messiaen
?/? 2 2 c.71G>A r.71g>a p.Arg24Gln - VUS g.38591612G>A g.38299411G>A - - SPRED1_000015 Domain: EVH-1 PubMed: Spencer 2011 - - Unknown - - - - - Ludwine Messiaen
+/+ 1 2 c.87_88dup r.87_88dup p.Gly30Valfs*11 - pathogenic g.38591628_38591629dup g.38299427_38299428dup - - SPRED1_000016 Domain: EVH-1 PubMed: Spencer 2011 S54 - - Unknown - - - - - Ludwine Messiaen
?/? 1 2 c.88G>A r.88g>a p.Gly30Arg - VUS g.38591629G>A g.38299428G>A - - SPRED1_000017 Domain: EVH-1 PubMed: Spencer 2011 S46 - - Unknown - - - - - Ludwine Messiaen
?/? 1 2 c.91T>A r.91u>a p.Trp31Arg - VUS g.38591632T>A g.38299431T>A - - SPRED1_000140 Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - De novo - - - - - Ludwine Messiaen
+?/+? 1 2 c.92G>T r.92g>u p.Trp31Leu - likely pathogenic g.38591633G>T g.38299432G>T - - SPRED1_000119 1 more item Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
+/. 1 - c.93G>C r.(?) p.(Trp31Cys) - pathogenic g.38591634G>C g.38299433G>C SPRED1(NM_152594.2):c.93G>C (p.W31C) - SPRED1_000212 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/+, +/. 4 2 c.93G>T r.(?) p.(Trp31Cys) - pathogenic g.38591634G>T g.38299433G>T SPRED1(NM_152594.2):c.93G>T (p.W31C) - SPRED1_000018, SPRED1_000178 Domain: EVH-1, VKGL data sharing initiative Nederland PubMed: Denayer 2011a - - CLASSIFICATION record, De novo, Unknown - - - - - VKGL-NL_Rotterdam, Ludwine Messiaen
+/+ 1 2 c.107_110del r.107_110del p.Gly36Valfs*3 - pathogenic g.38591648_38591651del g.38299447_38299450del - - SPRED1_000096 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
+/+ 1 2 c.108del r.(?) p.(Ser37Valfs*3) - pathogenic g.38591649del g.38299448del - - SPRED1_000120 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
?/., ?/? 4 2 c.124G>A r.(?), r.124g>a p.(Val42Ile), p.Val42Ile - VUS g.38591665G>A g.38299464G>A SPRED1(NM_152594.2):c.124G>A (p.(Val42Ile)) - SPRED1_000006 Domain: EVH-1, VKGL data sharing initiative Nederland, 1 more item PubMed: Spencer 2011 - rs147204964 CLASSIFICATION record, Germline, Unknown - - - - - VKGL-NL_Leiden, Ludwine Messiaen
?/? 1 2 c.131T>A r.(?) p.(Val44Asp) - VUS g.38591672T>A g.38299471T>A - - SPRED1_000007 Domain: EVH-1 PubMed: Spurlock 2009 - - Germline - - - - - Ludwine Messiaen
+/+ 3 2 c.148C>T r.148c>u p.(Gln50*) - pathogenic g.38591689C>T g.38299488C>T - - SPRED1_000008, SPRED1_000009 Domain: EVH-1 PubMed: Brems et al, 2012 - rs148646547 De novo, Germline, Unknown - - - - - Ludwine Messiaen
?/. 1 - c.170A>G r.(?) p.(Asp57Gly) - VUS g.38591711A>G - SPRED1(NM_152594.3):c.170A>G (p.D57G) - SPRED1_000234 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/+ 1 2 c.177del r.(?) p.(Phe59Leufs*62) - pathogenic g.38591718del g.38299517del - - SPRED1_000141 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Germline - - - - - Ludwine Messiaen
-?/. 1 - c.182G>A r.(?) p.(Arg61His) - likely benign g.38591723G>A g.38299522G>A SPRED1(NM_152594.2):c.182G>A (p.(Arg61His)) - SPRED1_000213 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/+, +/. 8 2 c.190C>T r.(?), r.190c>u p.(Arg64Ter), p.Arg64* - pathogenic g.38591731C>T g.38299530C>T SPRED1(NM_152594.2):c.190C>T (p.R64*) - SPRED1_000009, SPRED1_000179 Domain: EVH-1, VKGL data sharing initiative Nederland, 2 more items PubMed: Brems 2007 - - CLASSIFICATION record, Germline, Unknown - - - - - VKGL-NL_Rotterdam, Ludwine Messiaen
+/. 1 - c.207+1G>A r.spl? p.? - pathogenic g.38591749G>A g.38299548G>A SPRED1(NM_152594.2):c.207+1G>A - SPRED1_000180 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/+ 1 2 c.207+1G>T r.33_207del p.Asp11Glufs*52 - pathogenic g.38591749G>T g.38299548G>T - - SPRED1_000100 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Germline - - - - - Ludwine Messiaen
-/. 1 - c.207+15A>G r.(=) p.(=) - benign g.38591763A>G g.38299562A>G SPRED1(NM_152594.2):c.207+15A>G - SPRED1_000181 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/-? 1 2 c.207+18T>C r.(?) p.(?) - likely benign g.38591766T>C g.38299565T>C - - SPRED1_000142 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - De novo - - - - - Ludwine Messiaen
+/+ 1 3 c.217G>T r.(?) p.(Glu73*) - pathogenic g.38614451G>T g.38322250G>T - - SPRED1_000019 Domain: EVH-1 PubMed: Spurlock 2009 - - Germline - - - - - Ludwine Messiaen
-?/-? 1 3 c.221G>T r.(?) p.(Cys74Phe) - likely benign g.38614455G>T g.38322254G>T - - SPRED1_000020 Domain: EVH-1 PubMed: Messiaen 2009 - - Unknown - - - - - Ludwine Messiaen
+/+ 1 3 c.229A>T r.(?) p.(Lys77*) - pathogenic g.38614463A>T g.38322262A>T - - SPRED1_000121 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Germline - - - - - Ludwine Messiaen
?/? 1 3 c.239T>G r.239u>g p.Leu80Arg - VUS g.38614473T>G g.38322272T>G - - SPRED1_000021 Domain: EVH-1 PubMed: Spencer 2011 - - Unknown - - - - - Ludwine Messiaen
+/+ 1 3 c.242_256del r.(?) p.(Ile81_Val85del) - pathogenic g.38614476_38614490del g.38322275_38322289del - - SPRED1_000022 5 amino acid deletion: Y82, K84 and V85 are evolutionary conserved / Domain: EVH-1 PubMed: Brems 2007 - - De novo - - - - - Ludwine Messiaen
?/? 1 3 c.263C>A r.(?) p.(Thr88Lys) - VUS g.38614497C>A g.38322296C>A - - SPRED1_000104 1 more item Messiaen UAB, unpublished novel mutation - - Germline - - - - - Ludwine Messiaen
+/+ 1 3 c.269del r.269dela p.His90Profs*31 - pathogenic g.38614503del g.38322302del - - SPRED1_000091 Domain: EVH-1 PubMed: Brems et al, 2012 - - Unknown - - - - - Ludwine Messiaen
?/? 1 3 c.270C>G r.(270c>g) p.(His90Gln) - VUS g.38614504C>G g.38322303C>G - - SPRED1_000143 Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Germline - - - - - Ludwine Messiaen
+/+ 1 3 c.271del r.(?) p.(His91Thrfs*30) - pathogenic g.38614505del g.38322304del - - SPRED1_000092 Domain: EVH-1 PubMed: Messiaen 2009 - - Unknown - - - - - Ludwine Messiaen
?/? 1 3 c.274T>C r.274u>c p.Trp92Arg - VUS g.38614508T>C g.38322307T>C - - SPRED1_000105 1 more item Messiaen UAB, unpublished novel mutation - - Germline - - - - - Ludwine Messiaen
+/+ 1 3 c.283del r.(?) p.(Asp95Metfs*26) - pathogenic g.38614517del g.38322316del - - SPRED1_000144 Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
-/. 3 - c.291G>A r.(?) p.(Lys97=) - benign g.38614525G>A g.38322324G>A SPRED1(NM_152594.2):c.291G>A (p.K97=), SPRED1(NM_152594.3):c.291G>A (p.K97=) - SPRED1_000183 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen, VKGL-NL_AMC
?/? 1 3 c.299G>A r.299g>a p.Gly100Asp - VUS g.38614533G>A g.38322332G>A - - SPRED1_000093 Domain: EVH-1 PubMed: Brems et al, 2012 - - Unknown - - - - - Ludwine Messiaen
+/+ 1 3 c.303dup r.(?) p.(Thr102Tyrfs*7) - pathogenic g.38614537dup g.38322336dup - - SPRED1_000106 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
+/+ 4 3 c.304dup r.304dup p.Thr102Asnfs*7 - pathogenic g.38614538dup g.38322337dup - - SPRED1_000023 Domain: EVH-1, 1 more item PubMed: Spencer 2011 - - De novo, Unknown - - - - - Ludwine Messiaen
+?/+? 2 3 c.305C>A r.305c>a p.Thr102Lys - likely pathogenic g.38614539C>A g.38322338C>A - - SPRED1_000024 Domain: EVH-1 PubMed: Spencer 2011 - - Unknown - - - - - Ludwine Messiaen
+/+ 1 3 c.305C>G r.(?) p.(Thr102Arg) - pathogenic g.38614539C>G g.38322338C>G - - SPRED1_000025 Domain: EVH-1 PubMed: Messiaen 2009 - - Germline - - - - - Ludwine Messiaen
+?/+? 1 3 c.305C>T r.305c>u p.Thr102Met - likely pathogenic g.38614539C>T g.38322338C>T - - SPRED1_000026 Domain: EVH-1 PubMed: Spencer 2011 - - Unknown - - - - - Ludwine Messiaen
+/+, +/. 2 3 c.305del r.(?), r.305delc p.(Thr102SerfsTer19), p.Thr102Serfs*19 - pathogenic g.38614539del g.38322338del SPRED1(NM_152594.2):c.305delC (p.T102Sfs*19) - SPRED1_000027, SPRED1_000184 Domain: EVH-1, VKGL data sharing initiative Nederland PubMed: Spencer 2011 - - CLASSIFICATION record, Unknown - - - - - VKGL-NL_Rotterdam, Ludwine Messiaen
+/+ 1 3 c.320_333del r.(?) p.(Ala107Valfs*2) - pathogenic g.38614554_38614567del g.38322353_38322366del - - SPRED1_000028 Domain: EVH-1 PubMed: Messiaen 2009 - - Germline - - - - - Ludwine Messiaen
+/+ 4 3 c.326_329dup r.326_329dup p.Arg110Serfs*2 - pathogenic g.38614560_38614563dup g.38322359_38322362dup - - SPRED1_000029 Domain: EVH-1, 2 more items PubMed: Messiaen 2009 - - Germline, Unknown - - - - - Ludwine Messiaen
?/+ 1 3 c.331dup r.(?) p.(Ala111fs) - VUS g.38614565dup g.38322364dup - - SPRED1_000135 Domain: EVH-1 PubMed: Pasmant 2014 - - Unknown - - - - - Beatrice Parfait
+?/. 1 - c.335T>C r.(?) p.(Phe112Ser) - likely pathogenic g.38614569T>C g.38322368T>C - - SPRED1_000207 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/+ 1 3 c.340dup r.(?) p.(Arg114Lysfs*20) - pathogenic g.38614574dup g.38322373dup - - SPRED1_000122 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
+/. 1 - c.345_364del r.(?) p.(Ile116TyrfsTer11) - pathogenic g.38614579_38614598del g.38322378_38322397del SPRED1(NM_152594.2):c.345_364delTATCCGAAGAGCTATAGAGG (p.I116Yfs*11) - SPRED1_000185 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? 1 3 c.347T>A r.347u>a p.Ile116Asn - VUS g.38614581T>A g.38322380T>A - - SPRED1_000095 1 more item Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
+/+, +/., ?/+ 14 3 c.349C>T r.(?), r.349c>u p.(Arg117Ter), p.Arg117* - pathogenic, VUS g.38614583C>T g.38322382C>T SPRED1(NM_152594.2):c.349C>T (p.R117*) - SPRED1_000030, SPRED1_000186 Domain: EVH-1, VKGL data sharing initiative Nederland, 1 more item PubMed: Brems 2007 - - CLASSIFICATION record, De novo, Germline, Unknown - - - - - Beatrice Parfait, VKGL-NL_Rotterdam, Ludwine Messiaen
+/+, +/. 2 3 c.360dup r.(?) p.(Glu121Argfs*13), p.(Glu121ArgfsTer13) - pathogenic g.38614594dup g.38322393dup SPRED1(NM_152594.2):c.360dupA (p.E121Rfs*13) - SPRED1_000031 Domain: EVH-1, VKGL data sharing initiative Nederland PubMed: Denayer 2011a, family 9 - - CLASSIFICATION record, Unknown - - - - - VKGL-NL_Rotterdam, Ludwine Messiaen
+/+ 1 3 c.361del r.(?) p.(Glu121Argfs*31) - pathogenic g.38614595del g.38322394del - - SPRED1_000123 novel / Domain: EVH-1 Messiaen UAB, unpublished novel mutation - - De novo - - - - - Ludwine Messiaen
-?/. 1 - c.372T>A r.(?) p.(Ser124=) - likely benign g.38614606T>A g.38322405T>A - - SPRED1_000214 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/+ 1 3 c.375del r.(?) p.(Gln125fs) - VUS g.38614609del g.38322408del - - SPRED1_000136 - PubMed: Pasmant 2014 - - Unknown - - - - - Beatrice Parfait
-?/-? 1 3i c.377-31A>G r.= p.= - likely benign g.38616933A>G g.38324732A>G - - SPRED1_000124 novel Messiaen UAB, unpublished novel mutation - - De novo - - - - - Ludwine Messiaen
-/., -?/-? 2 I3 c.377-10A>G r.(=), r.(?) p.(=), p.(?) - benign, likely benign g.38616954A>G g.38324753A>G SPRED1(NM_152594.2):c.377-10A>G - SPRED1_000145, SPRED1_000188 VKGL data sharing initiative Nederland Messiaen UAB, unpublished novel mutation - - CLASSIFICATION record, Unknown - - - - - VKGL-NL_Rotterdam, Ludwine Messiaen
+?/+?, ?/. 2 3i c.377-9T>G r.(=), r.(spl?) p.(=), p.(?) - likely pathogenic, VUS g.38616955T>G g.38324754T>G SPRED1(NM_152594.2):c.377-9T>G - SPRED1_000107, SPRED1_000189 novel, VKGL data sharing initiative Nederland Messiaen UAB, unpublished novel mutation - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Rotterdam, Ludwine Messiaen
+/+ 1 3i c.377-2G r.377_423del p.Cys127Lysfs*2 - pathogenic g.38616962G>A - c.377-2G>A - SPRED1_000080 1 more item PubMed: Brems et al, 2012 - - Unknown - - - - - Ludwine Messiaen
+/+ 1 4 c.381C>A r.(?) p.(Cys127*) - pathogenic g.38616968C>A g.38324767C>A - - SPRED1_000108 novel Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
+/+ 1 4 c.389C>A r.(?) p.(Ser130*) - pathogenic g.38616976C>A g.38324775C>A - - SPRED1_000109 novel Messiaen UAB, unpublished novel mutation - - Germline - - - - - Ludwine Messiaen
+/+ 2 4 c.389C>G r.(?) p.(Ser130*) - pathogenic g.38616976C>G g.38324775C>G - - SPRED1_000137 - Messiaen UAB, unpublished novel mutation, PubMed: Pasmant 2014 - - De novo, Unknown - - - - - Beatrice Parfait, Ludwine Messiaen
+/+ 1 4 c.395dup r.(?) p.(Asn132Lysfs*2) - pathogenic g.38616982dup g.38324781dup - - SPRED1_000110 novel Messiaen UAB, unpublished novel mutation - - Unknown - - - - - Ludwine Messiaen
+/+ 1 4i c.423+1G>A r.377_423del p.Cys127Lysfs*2 - pathogenic g.38617011G>A g.38324810G>A - - SPRED1_000081 - PubMed: Brems 2007 - - Germline - - - - - Ludwine Messiaen
+/+ 1 4i c.423+5G>A r.378_423+1del p.Cys127Glnfs*10 - pathogenic g.38617015G>A g.38324814G>A - - SPRED1_000125 novel Messiaen UAB, unpublished novel mutation - - Germline - - - - - Ludwine Messiaen
-/. 1 4i c.423+52C>A r.(=) p.(=) - benign g.38617062C>A g.38324861C>A - - SPRED1_000174 - - - rs12595839 Germline - - - - - Andreas Laner
-/. 1 - c.424-98T>C r.(=) p.(=) - benign g.38631840T>C - - - SPRED1_000226 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 5 4i c.424-18G>A r.(=) p.(=) - benign g.38631920G>A g.38339719G>A SPRED1(NM_152594.2):c.424-18G>A, SPRED1(NM_152594.3):c.424-18G>A - SPRED1_000172 VKGL data sharing initiative Nederland - - rs7179118 CLASSIFICATION record, Germline - - - - - Andreas Laner, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Nijmegen, VKGL-NL_AMC
-?/-? 1 4i c.424-14G>A r.(?) p.(?) - likely benign g.38631924G>A g.38339723G>A - - SPRED1_000126 novel Messiaen UAB, unpublished novel mutation - - De novo - - - - - Ludwine Messiaen
-/. 3 - c.424-8C>A r.(=) p.(=) - benign g.38631930C>A g.38339729C>A SPRED1(NM_152594.2):c.424-8C>A, SPRED1(NM_152594.3):c.424-8C>A - SPRED1_000191 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen, VKGL-NL_AMC
-?/-? 1 5 c.426A>G r.(?) p.(Ala142Ala) - likely benign g.38631940A>G g.38339739A>G - - SPRED1_000127 novel Messiaen UAB, unpublished novel mutation - - De novo - - - - - Ludwine Messiaen
-/-, -?/. 4 5 c.446G>A r.(?), r.446g>a p.(Ser149Asn), p.Ser149Asn - benign, likely benign g.38631960G>A g.38339759G>A - - SPRED1_000032, SPRED1_000208 VKGL data sharing initiative Nederland, 1 more item PubMed: Brems 2007 - - CLASSIFICATION record, Unknown - - - - - Ludwine Messiaen, VKGL-NL_Nijmegen
+/+ 1 5 c.460_463dup r.(?) p.(His155Argfs*13) - pathogenic g.38631974_38631977dup g.38339773_38339776dup - - SPRED1_000033 - PubMed: Laycock-van Spyk 2011 - - Germline - - - - - Ludwine Messiaen
Legend   How to query   « First ‹ Prev     1 2     Next › Last »