All variants in the STAT3 gene

Information The variants shown are described using the NM_139276.2 transcript reference sequence.

122 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »



AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







?/. - c.202T>C r.(?) p.(Tyr68His) - VUS g.40498658A>G - - - STAT3_000068 - PubMed: Luo 2021, Journal: Luo 2021 - - Germline - - - - - Liu Wenbing
-?/. - c.373C>G r.(?) p.(Gln125Glu) - likely benign g.40491427G>C g.42339409G>C STAT3(NM_003150.3):c.373C>G (p.(Gln125Glu)) - STAT3_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.405C>T r.(?) p.(Ala135=) - likely benign g.40491395G>A - STAT3(NM_139276.2):c.405C>T (p.A135=) - STAT3_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.405C>T r.(?) p.(Ala135=) - likely benign g.40491395G>A - STAT3(NM_139276.2):c.405C>T (p.A135=) - STAT3_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.433G>C r.(?) p.(Glu145Gln) - VUS g.40491367C>G - - - STAT3_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.493G>A r.(?) p.(Val165Ile) - likely benign g.40490806C>T - STAT3(NM_003150.3):c.493G>A (p.(Val165Ile)) - STAT3_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.551-37_551-18del r.(=) p.(=) - likely benign g.40489939_40489958del g.42337921_42337940del STAT3(NM_139276.2):c.551-37_551-18delATTCCCTCAGGTCAAGGAGT - STAT3_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.551-37_551-18del r.(=) p.(=) - benign g.40489939_40489958del - STAT3(NM_139276.2):c.551-37_551-18delATTCCCTCAGGTCAAGGAGT - STAT3_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. - c.551-4G>A r.spl? p.? - likely benign g.40489879C>T g.42337861C>T STAT3(NM_139276.2):c.551-4G>A - STAT3_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.627G>A r.(?) p.(Ala209=) - likely benign g.40489799C>T g.42337781C>T STAT3(NM_139276.2):c.627G>A (p.A209=) - STAT3_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.704_705del r.(?) p.(Leu235HisfsTer7) - pathogenic g.40489548_40489549del g.42337530_42337531del STAT3(NM_139276.2):c.704_705delTC (p.L235Hfs*7) - STAT3_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.711C>T r.(?) p.(Asp237=) - benign g.40489539G>A g.42337521G>A STAT3(NM_139276.2):c.711C>T (p.D237=) - STAT3_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.746T>C r.(?) p.(Ile249Thr) - VUS g.40489504A>G - STAT3(NM_139276.3):c.746T>C (p.I249T) - STAT3_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. - c.890C>T r.(?) p.(Pro297Leu) - VUS g.40485975G>A g.42333957G>A - - STAT3_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1009C>G r.(?) p.(Leu337Val) - likely benign g.40485731G>C - STAT3(NM_003150.3):c.1009C>G (p.(Leu337Val)) - STAT3_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 10 c.1032G>C r.(?) p.(Gln344His) ACMG pathogenic g.40485708C>G g.42333690C>G - - - gain of function variant PubMed: Stray-Pedersen 2017 - - Germline - - - - - Johan den Dunnen
-?/. - c.1049+7C>T r.(=) p.(=) - likely benign g.40485684G>A - STAT3(NM_003150.3):c.1049+7C>T (p.(=)) - STAT3_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. - c.1079A>G r.(?) p.(Tyr360Cys) - likely pathogenic g.40483520T>C g.42331502T>C STAT3(NM_139276.2):c.1079A>G (p.Y360C) - STAT3_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1081C>G r.(?) p.(Gln361Glu) - VUS g.40483518G>C - - - STAT3_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. - c.1110-2A>G r.spl? p.? - pathogenic g.40481796T>C g.42329778T>C - - STAT3_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.1139+3A>G r.spl? p.? - VUS g.40481762T>C g.42329744T>C STAT3(NM_139276.2):c.1139+3A>G - STAT3_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1143C>G r.(?) p.(Ser381=) - likely benign g.40481662G>C g.42329644G>C STAT3(NM_139276.2):c.1143C>G (p.S381=) - STAT3_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1143C>G r.(?) p.(Ser381=) - likely benign g.40481662G>C g.42329644G>C STAT3(NM_139276.2):c.1143C>G (p.S381=) - STAT3_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.1144C>T r.(?) p.(Arg382Trp) - pathogenic g.40481661G>A g.42329643G>A - - STAT3_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. - c.1145G>A r.(?) p.(Arg382Gln) - pathogenic g.40481660C>T g.42329642C>T - - STAT3_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. - c.1166C>T r.(?) p.(Thr389Ile) - pathogenic g.40481639G>A - STAT3(NM_139276.3):c.1166C>T (p.T389I) - STAT3_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
./. - c.1181T>C r.(?) p.(Met394Thr) - likely pathogenic g.40481624A>G g.42329606A>G NM_139276.2(STAT3):c.1181T>C p.(Met394Thr) - STAT3_000030 variant could not be associated with disease phenotype PubMed: Vogelaar 2017, Journal: Vogelaar 2017 - - Germline - - - - - Marjolijn JL Ligtenberg
-/. - c.1233+43C>G r.(=) p.(=) - benign g.40481529G>C g.42329511G>C - - STAT3_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1234-18C>G r.(=) p.(=) - likely benign g.40481493G>C g.42329475G>C STAT3(NM_139276.2):c.1234-18C>G - STAT3_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1237C>T r.(?) p.(Leu413=) - likely benign g.40481472G>A - STAT3(NM_139276.2):c.1237C>T (p.L413=) - STAT3_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 14 c.1243G>A r.(?) p.(Glu415Lys) ACMG pathogenic g.40481466C>T g.42329448C>T - - - gain of function variant PubMed: Stray-Pedersen 2017 - - Germline yes - - - - Johan den Dunnen
-?/. - c.1263G>A r.(?) p.(Gly421=) - likely benign g.40481446C>T - STAT3(NM_139276.2):c.1263G>A (p.G421=) - STAT3_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 15 c.1309C>T r.(?) p.(His437Tyr) ACMG pathogenic g.40478190G>A g.42326172G>A - - - - PubMed: Stray-Pedersen 2017 - - Germline - - - - - Johan den Dunnen
-?/. - c.1329C>T r.(?) p.(Thr443=) - likely benign g.40478170G>A g.42326152G>A STAT3(NM_139276.2):c.1329C>T (p.T443=) - STAT3_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1329C>T r.(?) p.(Thr443=) - likely benign g.40478170G>A g.42326152G>A STAT3(NM_139276.2):c.1329C>T (p.T443=) - STAT3_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1361T>C r.(?) p.(Leu454Pro) - VUS g.40478138A>G g.42326120A>G STAT3(NM_003150.3):c.1361T>C (p.(Leu454Pro)), STAT3(NM_139276.2):c.1361T>C (p.L454P) - STAT3_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.1361T>C r.(?) p.(Leu454Pro) - VUS g.40478138A>G g.42326120A>G STAT3(NM_003150.3):c.1361T>C (p.(Leu454Pro)), STAT3(NM_139276.2):c.1361T>C (p.L454P) - STAT3_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.1381G>C r.(?) p.(Val461Leu) - benign g.40477064C>G g.42325046C>G STAT3(NM_139276.2):c.1381G>C (p.V461L) - STAT3_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. - c.1385T>C r.(?) p.(Val462Ala) - VUS g.40477060A>G g.42325042A>G STAT3(NM_139276.2):c.1385T>C (p.V462A) - STAT3_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1427C>G r.(?) p.(Ser476Cys) - VUS g.40477018G>C g.42325000G>C - - STAT3_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1600+6C>T r.(=) p.(=) - likely benign g.40476723G>A - STAT3(NM_139276.2):c.1600+6C>T - STAT3_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1601-8dup r.(=) p.(=) - likely benign g.40475653dup g.42323635dup STAT3(NM_139276.2):c.1601-8dupT - STAT3_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.1832G>A r.(?) p.(Ser611Asn) - pathogenic g.40475078C>T g.42323060C>T - - STAT3_000023 - PubMed: Holland 2007 - - Germline - - - - - Jelena Čalyševa
?/. - c.1842C>A r.(?) p.(Ser614Arg) - VUS g.40475068G>T g.42323050G>T - - STAT3_000022 - PubMed: Jerez 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1842C>A r.(?) p.(Ser614Arg) - VUS g.40475068G>T g.42323050G>T - - STAT3_000022 - PubMed: Jerez 2012 - - Germline - - - - - Johan den Dunnen
?/. - c.1852G>C r.(?) p.(Gly618Arg) - VUS g.40475058C>G g.42323040C>G - - STAT3_000021 - PubMed: Jerez 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1852G>C r.(?) p.(Gly618Arg) - VUS g.40475058C>G g.42323040C>G - - STAT3_000021 - PubMed: Jerez 2012 - - Germline - - - - - Johan den Dunnen
?/. - c.1858A>G r.(?) p.(Thr620Ala) - VUS g.40475052T>C g.42323034T>C - - STAT3_000020 - PubMed: Renner 2008 - - Germline - - - - - Jelena Čalyševa
?/. - c.1858A>G r.(?) p.(Thr620Ala) - VUS g.40475052T>C g.42323034T>C - - STAT3_000020 - PubMed: Renner 2008 - - Germline - - - - - Johan den Dunnen
+/. - c.1861T>G r.(?) p.(Phe621Val) - pathogenic g.40475049A>C g.42323031A>C - - STAT3_000019 - PubMed: Holland 2007 - - Germline - - - - - Jelena Čalyševa
+/. - c.1865C>T r.(?) p.(Thr622Ile) - pathogenic g.40475045G>A g.42323027G>A - - STAT3_000018 - PubMed: Holland 2007 - - De novo - - - - - Jelena Čalyševa
?/. - c.1907C>T r.(?) p.(Ser636Phe) - VUS g.40474494G>A g.42322476G>A - - STAT3_000017 - PubMed: Renner 2008 - - Germline - - - - - Jelena Čalyševa
?/. - c.1907C>T r.(?) p.(Ser636Phe) - VUS g.40474494G>A g.42322476G>A - - STAT3_000017 - PubMed: Renner 2008 - - Germline - - - - - Johan den Dunnen
+/. - c.1909G>A r.(?) p.(Val637Met) - pathogenic g.40474492C>T g.42322474C>T - - STAT3_000015 - PubMed: Holland 2007 - - Germline - - - - - Jelena Čalyševa
+/. - c.1909G>A r.(?) p.(Val637Met) - pathogenic g.40474492C>T g.42322474C>T STAT3(NM_139276.2):c.1909G>A (p.V637M) - STAT3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.1909G>C r.(?) p.(Val637Leu) - pathogenic g.40474492C>G - - - STAT3_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. - c.1909G>T r.(?) p.(Val637Leu) - pathogenic g.40474492C>A g.42322474C>A - - STAT3_000016 - PubMed: Holland 2007 - - Germline - - - - - Jelena Čalyševa
+?/. - c.1910T>C r.(?) p.(Val637Ala) - likely pathogenic g.40474491A>G g.42322473A>G - - STAT3_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.1913A>G r.(?) p.(Glu638Gly) - VUS g.40474488T>C g.42322470T>C - - STAT3_000014 - PubMed: Renner 2008 - - Germline - - - - - Jelena Čalyševa
?/. - c.1913A>G r.(?) p.(Glu638Gly) - VUS g.40474488T>C g.42322470T>C - - STAT3_000014 - PubMed: Renner 2008 - - Germline - - - - - Johan den Dunnen
+/. - c.1915C>G r.(?) p.(Pro639Ala) - pathogenic g.40474486G>C g.42322468G>C - - STAT3_000013 - PubMed: Holland 2007 - - Germline - - - - - Jelena Čalyševa
?/. - c.1919A>T r.(?) p.(Tyr640Phe) - VUS g.40474482T>A g.42322464T>A - - STAT3_000012 - PubMed: Koskela 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1919A>T r.(?) p.(Tyr640Phe) - VUS g.40474482T>A g.42322464T>A - - STAT3_000012 - PubMed: Pilati 2011 - - Germline - - - - - Jelena Čalyševa
?/. - c.1919A>T r.(?) p.(Tyr640Phe) - VUS g.40474482T>A g.42322464T>A - - STAT3_000012 - PubMed: Jerez 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1919A>T r.(?) p.(Tyr640Phe) - VUS g.40474482T>A g.42322464T>A - - STAT3_000012 - PubMed: Jerez 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1919A>T r.(?) p.(Tyr640Phe) - VUS g.40474482T>A g.42322464T>A - - STAT3_000012 - PubMed: Koskela 2012 - - Germline - - - - - Johan den Dunnen
?/. - c.1919A>T r.(?) p.(Tyr640Phe) - VUS g.40474482T>A g.42322464T>A - - STAT3_000012 - PubMed: Pilati 2011 - - Germline - - - - - Johan den Dunnen
?/. - c.1919A>T r.(?) p.(Tyr640Phe) - VUS g.40474482T>A g.42322464T>A - - STAT3_000012 - PubMed: Jerez 2012 - - Germline - - - - - Johan den Dunnen
?/. - c.1919A>T r.(?) p.(Tyr640Phe) - VUS g.40474482T>A g.42322464T>A - - STAT3_000012 - PubMed: Jerez 2012 - - Germline - - - - - Johan den Dunnen
+/. - c.1931_1933del r.(?) p.(Gln644del) - pathogenic g.40474474_40474476del g.42322456_42322458del - - STAT3_000011 - PubMed: Holland 2007 - - Germline - - - - - Jelena Čalyševa
?/. - c.1938C>G r.(?) p.(Asn646Lys) - VUS g.40474463G>C g.42322445G>C - - STAT3_000010 - PubMed: Flanagan 2014 - - De novo - - - - - Jelena Čalyševa
?/. - c.1938C>G r.(?) p.(Asn646Lys) - VUS g.40474463G>C g.42322445G>C - - STAT3_000010 - PubMed: Flanagan 2014 - - Germline - - - - - Johan den Dunnen
+/. - c.1939A>G r.(?) p.(Asn647Asp) - pathogenic g.40474462T>C g.42322444T>C - - STAT3_000009 - PubMed: Holland 2007 - - Germline - - - - - Jelena Čalyševa
?/. - c.1940A>T r.(?) p.(Asn647Ile) - VUS g.40474461T>A g.42322443T>A - - STAT3_000008 - PubMed: Koskela 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1940A>T r.(?) p.(Asn647Ile) - VUS g.40474461T>A g.42322443T>A - - STAT3_000008 - PubMed: Jerez 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1940A>T r.(?) p.(Asn647Ile) - VUS g.40474461T>A g.42322443T>A - - STAT3_000008 - PubMed: Jerez 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1940A>T r.(?) p.(Asn647Ile) - VUS g.40474461T>A g.42322443T>A - - STAT3_000008 - PubMed: Koskela 2012 - - Germline - - - - - Johan den Dunnen
?/. - c.1940A>T r.(?) p.(Asn647Ile) - VUS g.40474461T>A g.42322443T>A - - STAT3_000008 - PubMed: Jerez 2012 - - Germline - - - - - Johan den Dunnen
?/. - c.1940A>T r.(?) p.(Asn647Ile) - VUS g.40474461T>A g.42322443T>A - - STAT3_000008 - PubMed: Jerez 2012 - - Germline - - - - - Johan den Dunnen
+/. - c.1954G>A r.(?) p.(Glu652Lys) - pathogenic g.40474447C>T g.42322429C>T - - STAT3_000007 - PubMed: Holland 2007 - - Germline - - - - - Jelena Čalyševa
?/. - c.1969_1970insTTT r.(?) p.(Gly656_Tyr657insPhe) - VUS g.40474432_40474433insAAA g.42322414_42322415insAAA - - STAT3_000006 - PubMed: Pilati 2011 - - Germline - - - - - Jelena Čalyševa
?/. - c.1969_1970insTTT r.(?) p.(Gly656_Tyr657insPhe) - VUS g.40474432_40474433insAAA g.42322414_42322415insAAA - - STAT3_000006 - PubMed: Pilati 2011 - - Germline - - - - - Johan den Dunnen
?/. - c.1969_1980dup r.(?) p.(Tyr657_Met660dup) - VUS g.40474421_40474432dup g.42322403_42322414dup - - STAT3_000028 - PubMed: Pilati 2011 - - Somatic - - - - - Jelena Čalyševa
?/. - c.1969_1980dup r.(?) p.(Tyr657_Met660dup) - VUS g.40474421_40474432dup g.42322403_42322414dup - - STAT3_000028 - PubMed: Pilati 2011 - - Germline - - - - - Johan den Dunnen
?/. 21 c.1970A>C r.(?) p.(Tyr657Ser) - VUS g.40474431T>G g.42322413T>G - - STAT3_000004 - PubMed: Liu 2011 - - Germline - - - - - Jelena Čalyševa
?/. 21 c.1970A>C r.(?) p.(Tyr657Ser) - VUS g.40474431T>G g.42322413T>G - - STAT3_000004 - PubMed: Liu 2011 - - Germline - - - - - Johan den Dunnen
+/. - c.1970A>G r.(?) p.(Tyr657Cys) - pathogenic g.40474431T>C g.42322413T>C - - STAT3_000005 - PubMed: Holland 2007 - - Germline - - - - - Jelena Čalyševa
?/. - c.1971_1973dup r.(?) p.(Tyr657_Lys658insAsn) - VUS g.40474429_40474431dup g.42322411_42322413dup 1971_1972insTAT - STAT3_000003 - PubMed: Koskela 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1972A>T; c.1974G>T r.(?) p.(Lys658Tyr) - VUS g.40474429T>A; g.40474429C>A - - - STAT3_000029 - PubMed: Pilati 2011 - - Germline - - - - - Johan den Dunnen
?/. - c.1972_1974delinsTAT r.(?) p.(Lys658Tyr) - VUS g.40474427_40474429delinsATA g.42322409_42322411delinsATA [1972A>T;1974G>T] - STAT3_000060 - PubMed: Pilati 2011 - - Somatic - - - - - Jelena Čalyševa
?/. - c.1974G>C r.(?) p.(Lys658Asn) - VUS g.40474427C>G g.42322409C>G - - STAT3_000002 - PubMed: Flanagan 2014 - - De novo - - - - - Jelena Čalyševa
?/. - c.1974G>C r.(?) p.(Lys658Asn) - VUS g.40474427C>G g.42322409C>G - - STAT3_000002 - PubMed: Flanagan 2014 - - Germline - - - - - Johan den Dunnen
?/. - c.1974G>T r.(?) p.(Lys658Asn) - VUS g.40474427C>A g.42322409C>A - - STAT3_000001 - - - - Germline - - - - - Jelena Čalyševa
?/. - c.1974G>T r.(?) p.(Lys658Asn) - VUS g.40474427C>A g.42322409C>A - - STAT3_000001 - PubMed: Jerez 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1974G>T r.(?) p.(Lys658Asn) - VUS g.40474427C>A g.42322409C>A - - STAT3_000001 - PubMed: Jerez 2012 - - Germline - - - - - Johan den Dunnen
?/. - c.1981G>A r.(?) p.(Asp661Asn) - VUS g.40474420C>T g.42322402C>T - - STAT3_000027 - PubMed: Jerez 2012 - - Germline - - - - - Jelena Čalyševa
?/. - c.1981G>A r.(?) p.(Asp661Asn) - VUS g.40474420C>T g.42322402C>T - - STAT3_000027 - PubMed: Jerez 2012 - - Germline - - - - - Johan den Dunnen
?/. 21 c.1981G>C r.(?) p.(Asp661His) - VUS g.40474420C>G g.42322402C>G - - STAT3_000026 - PubMed: Koskela 2012 - - Germline - - - - - Jelena Čalyševa
?/. 21 c.1981G>C r.(?) p.(Asp661His) - VUS g.40474420C>G g.42322402C>G - - STAT3_000026 - PubMed: Koskela 2012 - - Germline - - - - - Johan den Dunnen
?/. 21 c.1981G>T r.(?) p.(Asp661Tyr) - VUS g.40474420C>A g.42322402C>A - - STAT3_000025 - PubMed: Koskela 2012 - - Germline - - - - - Jelena Čalyševa
Legend   How to query   « First ‹ Prev     1 2     Next › Last »