Unique variants in the SUPT3H gene

Information The variants shown are described using the NM_181356.2 transcript reference sequence.

47 entries on 1 page. Showing entries 1 - 47.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 2 - c.-169655C>T r.(?) p.(=) - likely benign g.45515007G>A g.45547270G>A RUNX2(NM_001015051.3):c.1465G>A (p.(Gly489Ser)), RUNX2(NM_001024630.4):c.1531G>A (p.G511S) - SUPT3H_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen
?/. 1 - c.-169595T>C r.(?) p.(=) - VUS g.45514947A>G - RUNX2(NM_001024630.3):c.1471A>G (p.(Asn491Asp)) - SUPT3H_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-169585C>A r.(?) p.(=) - VUS g.45514937G>T g.45547200G>T RUNX2(NM_001024630.3):c.1461G>T (p.L487F) - SUPT3H_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-169551G>A r.(?) p.(=) - VUS g.45514903C>T - RUNX2(NM_001024630.3):c.1427C>T (p.(Thr476Ile)) - SUPT3H_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-169311G>T r.(?) p.(=) - VUS g.45514663C>A - RUNX2(NM_001024630.4):c.1187C>A (p.(Ala396Asp)) - SUPT3H_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-169298T>A r.(?) p.(=) - VUS g.45514650A>T - RUNX2(NM_001024630.4):c.1174A>T (p.(Met392Leu)) - SUPT3H_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.-169295G>A r.(?) p.(=) - pathogenic g.45514647C>T - RUNX2(NM_001024630.3):c.1171C>T (p.R391*) - SUPT3H_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.-169211C>T r.(?) p.(=) - likely pathogenic g.45514563G>A g.45546826G>A - - SUPT3H_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 1 - c.-167684A>G r.(?) p.(=) - benign g.45513036T>C g.45545299T>C RUNX2(NM_001024630.4):c.1087+17T>C - RUNX2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.-167644G>A r.(?) p.(=) - likely benign g.45512996C>T - RUNX2(NM_001024630.3):c.1064C>T (p.(Thr355Ile)) - SUPT3H_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-134838C>T r.(?) p.(=) - likely benign g.45480190G>A g.45512453G>A RUNX2(NM_001024630.4):c.1021+46G>A - RUNX2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.-134773A>T r.(?) p.(=) - VUS g.45480125T>A - RUNX2(NM_001024630.4):c.1002T>A (p.(Asp334Glu)) - SUPT3H_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-134703G>A r.(?) p.(=) - likely benign g.45480055C>T - RUNX2(NM_001024630.4):c.932C>T (p.T311M) - SUPT3H_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.-134658G>A r.(?) p.(=) - likely benign g.45480010C>T - RUNX2(NM_001024630.4):c.887C>T (p.P296L) - SUPT3H_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.-134648A>G r.(?) p.(=) - VUS g.45480000T>C - RUNX2(NM_001024630.4):c.877T>C (p.(Ser293Pro)) - SUPT3H_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-114504C>T r.(?) p.(=) - VUS g.45459856G>A g.45492119G>A RUNX2(NM_001024630.4):c.859+5G>A - SUPT3H_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/. 1 - c.-114499C>T r.(?) p.(=) - likely pathogenic g.45459851G>A - - - SUPT3H_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-114439G>A r.(?) p.(=) - likely benign g.45459791C>T - RUNX2(NM_001024630.4):c.799C>T (p.(Arg267Trp)) - SUPT3H_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.-60438A>T r.(?) p.(=) - pathogenic g.45405790T>A - RUNX2(NM_001024630.3):c.685+2T>A (p.?) - SUPT3H_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 2 - c.-60425C>T r.(?) p.(=) - pathogenic g.45405777G>A g.45438040G>A RUNX2(NM_001024630.4):c.674G>A (p.R225Q) - RUNX2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
+/. 1 - c.-60424G>A r.(?) p.(=) - pathogenic g.45405776C>T - RUNX2(NM_001024630.3):c.673C>T (p.R225W) - SUPT3H_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.-60410G>A r.(?) p.(=) - pathogenic g.45405762C>T - RUNX2(NM_001024630.4):c.659C>T (p.T220I) - SUPT3H_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 1 - c.-60376G>A r.(?) p.(=) - pathogenic g.45405728C>T g.45437991C>T - - SUPT3H_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-60323A>G r.(?) p.(=) - likely benign g.45405675T>C - RUNX2(NM_001024630.4):c.581-9T>C - SUPT3H_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 1 - c.-54402C>T r.(?) p.(=) - pathogenic g.45399754G>A - - - SUPT3H_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.-54384A>G r.(?) p.(=) - pathogenic g.45399736T>C - - - SUPT3H_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.-54347T>C r.(?) p.(=) - VUS g.45399699A>G - RUNX2(NM_001024630.4):c.523A>G (p.(Met175Val)) - SUPT3H_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.-54260C>T r.(?) p.(=) - pathogenic g.45399612G>A - - - SUPT3H_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 1 - c.-45381C>G r.(?) p.(=) - benign g.45390733G>C g.45422996G>C RUNX2(NM_001024630.4):c.423+39G>C - SUPT3H_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.-45287C>T r.(?) p.(=) - pathogenic g.45390639G>A g.45422902G>A RUNX2(NM_001024630.4):c.368G>A (p.C123Y) - RUNX2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+?/. 1 - c.-45265T>C r.(?) p.(=) - likely pathogenic g.45390617A>G g.45422880A>G RUNX2(NM_001024630.4):c.346A>G (p.T116A) - RUNX2_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 - c.-45238_-45237del r.(?) p.(=) - pathogenic g.45390590_45390591del - RUNX2(NM_001369405.1):c.277_278delGC (p.A93Rfs*53) - SUPT3H_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. 1 - c.-45168_-45157dup r.(?) p.(=) - VUS g.45390520_45390531dup - RUNX2(NM_001024630.4):c.249_260dup (p.(Ala86_Ala89dup)) - SUPT3H_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.-45159C>T r.(?) p.(=) - benign g.45390511G>A g.45422774G>A RUNX2(NM_001024630.4):c.240G>A (p.A80=) - RUNX2_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.-45156_-45151dup r.(?) p.(=) - VUS g.45390514_45390519dup - RUNX2(NM_001024630.4):c.243_248dup (p.(Ala88_Ala89dup)) - SUPT3H_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/., -?/. 2 - c.-45152_-45135del r.(?) p.(=) - benign, likely benign g.45390514_45390531del g.45422777_45422794del 1 more item - RUNX2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht
-?/. 1 - c.-45114_-45082del r.(?) p.(=) - likely benign g.45390445_45390477del g.45422708_45422740del RUNX2(NM_001015051.3):c.163_195del (p.(Gln61_Gln71del)) - SUPT3H_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-45099_-45094dup r.(?) p.(=) - likely benign g.45390460_45390465dup - RUNX2(NM_001024630.4):c.189_194dup (p.(Gln70_Gln71dup)) - SUPT3H_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-45099_-45079del r.(?) p.(=) - likely benign g.45390464_45390484del - RUNX2(NM_001024630.4):c.193_213delCAACAGCAGCAGCAGCAGCAG (p.Q65_Q71del) - SUPT3H_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.-45099_-45079dup r.(?) p.(=) - likely benign g.45390464_45390484dup - RUNX2(NM_001024630.4):c.193_213dup (p.(Gln65_Gln71dup)) - SUPT3H_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-45096_-45094del r.(?) p.(=) - likely benign g.45390463_45390465del - RUNX2(NM_001024630.3):c.192_194delGCA (p.Q71del) - SUPT3H_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.-45093_-45082dup r.(?) p.(=) - likely benign g.45390445_45390456dup - RUNX2(NM_001024630.4):c.174_185dupACAGCAGCAGCA (p.Q68_Q71dup) - SUPT3H_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.-45091G>C r.(?) p.(=) - likely benign g.45390443C>G - RUNX2(NM_001024630.3):c.172C>G (p.(Gln58Glu)) - SUPT3H_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-45090C>A r.(?) p.(=) - likely benign g.45390442G>T - RUNX2(NM_001024630.3):c.171G>T (p.(Gln57His)) - SUPT3H_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-45074_-45063del r.(?) p.(=) - VUS g.45390430_45390441del - RUNX2(NM_001015051.3):c.144_155del (p.(Gln68_Gln71del)) - SUPT3H_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-44980G>T r.(?) p.(=) - VUS g.45390332C>A - RUNX2(NM_001024630.4):c.61C>A (p.(Pro21Thr)) - SUPT3H_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-51-5914A>G r.(=) p.(=) - VUS g.45296618T>C g.45328881T>C SUPT3H(NM_181356.3):c.-51-5914A>G - SUPT3H_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.