Unique variants in gene TBC1D24

Information The variants shown are described using the transcript reference sequence.

115 entries on 2 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2     Next › Last »




AscendingDNA change (cDNA)     


RNA change     


DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







?/. 1 - c.-3491G>A VUS r.(?) p.(=) g.2521796G>A - NTN3(NM_006181.2):c.94G>A (p.(Asp32Asn)) - NTN3_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-3440_-3387del VUS r.(?) p.(=) g.2521847_2521900del - NTN3(NM_006181.2):c.142_195del (p.(Leu49_Ala66del)) - NTN3_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-2849_-2830del VUS r.(?) p.(=) g.2522438_2522457del - NTN3(NM_006181.2):c.736_755del (p.(Ala246ArgfsTer32)) - NTN3_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-2825_-2818del VUS r.(?) p.(=) g.2522462_2522469del - NTN3(NM_006181.2):c.760_767del (p.(Arg254ValfsTer28)) - NTN3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-2814_-2805del VUS r.(?) p.(=) g.2522473_2522482del - NTN3(NM_006181.2):c.771_780del (p.(Cys257TrpfsTer13)) - NTN3_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-2801_-2772del VUS r.(?) p.(=) g.2522486_2522515del - NTN3(NM_006181.2):c.783_812del (p.(Ser262_His271del)) - NTN3_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.-1500_-1489del VUS r.(?) p.(=) g.2523787_2523798del - NTN3(NM_006181.2):c.1414_1425del (p.(Arg473_Ala476del)) - NTN3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-78G>A likely benign r.(?) p.(=) g.2546072G>A - TBC1D24(NM_001199107.1):c.-78G>A - TBC1D24_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.-7C>T likely benign r.(?) p.(=) g.2546143C>T - TBC1D24(NM_001199107.1):c.-7C>T - TBC1D24_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.22T>C likely benign r.(?) p.(Cys8Arg) g.2546171T>C - - - TBC1D24_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/? 2 2 c.58C>T - r.(?) p.(Gln20*) g.2546207C>T g.2496206C>T - - TBC1D24_000019 - PubMed: Campeau et al - - Germline - - pcampeau - pcampeau Philippe Campeau
?/. 1 - c.74A>G VUS r.(?) p.(Lys25Arg) g.2546223A>G - TBC1D24(NM_001199107.1):c.74A>G (p.K25R) - TBC1D24_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 7 - c.116C>T - r.(?) p.(Ala39Val) g.2546265C>T - - - TBC1D24_000070 - - - - Somatic yes - - - - Jing Zhang
?/., ?/? 2 2 c.118C>T VUS r.(?) p.(Arg40Cys) g.2546267C>T g.2496266C>T - - TBC1D24_000008 VKGL data sharing initiative Nederland PubMed: Campeau et al - - CLASSIFICATION record, Germline yes - pcampeau - - VKGL-NL, Philippe Campeau
+?/. 2 - c.119G>A - r.(?) p.(Arg40His) g.2546268G>A - - - TBC1D24_000071 - - - - Somatic yes - - - - Jing Zhang
?/? 1 2 c.119G>T - r.(?) p.(Arg40Leu) g.2546268G>T g.2496267G>T - - TBC1D24_000012 - PubMed: Campeau et al - - Germline - - pcampeau - - Philippe Campeau
+?/. 1 - c.139A>G - r.(?) p.(Ser47Gly) g.2546288A>G - - - TBC1D24_000072 - - - - Somatic yes - - - - Jing Zhang
+?/. 1 - c.151C>T - r.(?) p.(Arg51Trp) g.2546300C>T - - - TBC1D24_000073 - - - - Somatic yes - - - - Jing Zhang
./., ?/., -?/. 7 - c.169C>T VUS, likely benign r.(?) p.(Arg57Cys) g.2546318C>T g.2496317C>T TBC1D24(NM_001199107.1):c.169C>T (p.R57C, p.(Arg57Cys)) - TBC1D24_000024 VKGL data sharing initiative Nederland PubMed: Bobbili 2018, Journal: Bobbili 2018 - rs202162520 Germline, CLASSIFICATION record - 1/567 controls, 2/194 cases RE - - - Dheeraj Bobbili, VKGL-NL_Rotterdam, VKGL-NL_Leiden, VKGL-NL_Utrecht, VKGL-NL_Groningen
./., ?/. 2 - c.178C>T VUS r.(?) p.(Arg60Trp) g.2546327C>T g.2496326C>T TBC1D24(NM_001199107.1):c.178C>T (p.R60W) - TBC1D24_000025 VKGL data sharing initiative Nederland PubMed: Bobbili 2018, Journal: Bobbili 2018 - rs373914077 Germline, CLASSIFICATION record - 1/567 controls - - - Dheeraj Bobbili, VKGL-NL
-?/. 1 - c.179G>A likely benign r.(?) p.(Arg60Gln) g.2546328G>A - TBC1D24(NM_001199107.1):c.179G>A (p.R60Q) - TBC1D24_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.192C>T likely benign r.(?) p.(=) g.2546341C>T - TBC1D24(NM_001199107.1):c.192C>T (p.C64=) - TBC1D24_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/., +/. 2 2 c.194G>T - r.(?) p.(Arg65Leu) g.2546343G>T g.2496342G>T - - TBC1D24_000023 - - ClinVar-000225038.1 rs878853232 Germline yes 0/220 chromosomes - - - Nada Danial-Farran, Zippi Brownstein
?/. 1 - c.197C>T VUS r.(?) p.(Thr66Met) g.2546346C>T - - - TBC1D24_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 3 - c.204G>A likely benign r.(?) p.(=) g.2546353G>A - TBC1D24(NM_001199107.1):c.204G>A (p.T68=) - TBC1D24_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/. 1 - c.207T>C likely benign r.(?) p.(=) g.2546356T>C - TBC1D24(NM_001199107.1):c.207T>C (p.P69=) - TBC1D24_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/? 1 2 c.208G>T - r.(?) p.(Asp70Tyr) g.2546357G>T g.2496356G>T - - TBC1D24_000015 - PubMed: Rehman et al., 2014 - - Germline - - - - - Philippe Campeau
-?/. 1 - c.225C>T likely benign r.(?) p.(=) g.2546374C>T - TBC1D24(NM_001199107.1):c.225C>T (p.S75=) - TBC1D24_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 1 - c.229_240del - r.(?) p.(Ile81_Lys84del) g.2546378_2546389del - - - TBC1D24_000074 - - - - Somatic yes - - - - Jing Zhang
+?/. 10 - c.241_252del - r.(?) p.(Ile81_Lys84del) g.2546390_2546401del - - - TBC1D24_000075 - - - - Somatic yes - - - - Jing Zhang
?/. 1 - c.294C>A VUS r.(?) p.(Asn98Lys) g.2546443C>A - TBC1D24(NM_001199107.1):c.294C>A (p.(Asn98Lys)) - TBC1D24_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
./. 1 - c.313T>C - r.(?) p.(Cys105Arg) g.2546462T>C g.2496461T>C - - TBC1D24_000021 - - - - Unknown ? - - - - Philippe Campeau
./. 1 - c.325C>T - r.(?) p.(Arg109Cys) g.2546474C>T g.2496473C>T - - TBC1D24_000026 - PubMed: Bobbili 2018, Journal: Bobbili 2018 - rs372337277 Germline - 1/567 controls - - - Dheeraj Bobbili
?/? 1 2 c.328G>A - r.(?) p.(Gly110Ser) g.2546477G>A g.2496476G>A - - TBC1D24_000013 - PubMed: Campeau et al - - Germline - - pcampeau - - Philippe Campeau
./. 1 - c.344G>T - r.(?) p.(Arg115Leu) g.2546493G>T g.2496492G>T - - TBC1D24_000027 - PubMed: Bobbili 2018, Journal: Bobbili 2018 - - Germline - 1/567 controls - - - Dheeraj Bobbili
-?/. 1 - c.384C>T likely benign r.(?) p.(=) g.2546533C>T - TBC1D24(NM_001199107.1):c.384C>T (p.I128=) - TBC1D24_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 2 - c.404C>T - r.(?) p.(Pro135Leu) g.2546553C>T - - - TBC1D24_000076 - - - - Somatic yes - - - - Jing Zhang
?/. 1 - c.409G>A VUS r.(?) p.(Val137Met) g.2546558G>A - TBC1D24(NM_001199107.1):c.409G>A (p.V137M) - TBC1D24_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.418C>G VUS r.(?) p.(Leu140Val) g.2546567C>G - TBC1D24(NM_001199107.1):c.418C>G (p.L140V) - TBC1D24_000094 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 1 - c.431A>G - r.(?) p.(Tyr144Cys) g.2546580A>G - - - TBC1D24_000077 - - - - Somatic yes - - - - Jing Zhang
-?/. 1 - c.438C>T likely benign r.(?) p.(=) g.2546587C>T - TBC1D24(NM_001199107.1):c.438C>T (p.I146=) - TBC1D24_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/? 1 2 c.439G>C - r.(?) p.(Asp147His) g.2546588G>C g.2496587G>C - - TBC1D24_000004 - PubMed: Falace A et al. 2010 - - Germline - - - - - Philippe Campeau
+?/. 1 - c.442G>A - r.(?) p.(Glu148Lys) g.2546591G>A - - - TBC1D24_000078 - - - - Somatic yes - - - - Jing Zhang
-?/. 1 - c.447C>T likely benign r.(?) p.(=) g.2546596C>T - TBC1D24(NM_001199107.1):c.447C>T (p.A149=) - TBC1D24_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/., +?/. 2 - c.457G>A VUS, likely pathogenic r.(?) p.(Glu153Lys) g.2546606G>A - TBC1D24(NM_001199107.1):c.457G>A (p.(Glu153Lys)) - TBC1D24_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Nijmegen
+?/. 1 - c.457G>T - r.(?) p.(Glu153*) g.2546606G>T - - - TBC1D24_000079 - - - - Somatic yes - - - - Jing Zhang
+?/? 1 2 c.468C>A - r.(?) p.(Cys156*) g.2546617C>A g.2496616C>A - - TBC1D24_000002 - - - - Unknown - - - - - Laurent Villard
+?/? 2 2 c.533C>T likely pathogenic (dominant) r.(?) p.(Ser178Leu) g.2546682C>T g.2496681C>T - - TBC1D24_000017 - PubMed: Zhang 2014, PubMed: Azaiez 2014 - - Germline yes - - - - Tao Yang, Hela Azaiez
-?/. 1 - c.546G>A likely benign r.(?) p.(=) g.2546695G>A - TBC1D24(NM_001199107.1):c.546G>A (p.T182=) - TBC1D24_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/. 2 - c.619C>T disease causing r.(?) p.(Gln207*) g.2546768C>T - c.619C>T - TBC1D24_000080 - - - - Somatic yes - - - - Jing Zhang
?/. 1 - c.622_639del VUS r.(?) p.(Val208_Gln213del) g.2546771_2546788del - TBC1D24(NM_001199107.1):c.622_639delGTCTATGCGGACTGGCAG (p.V208_Q213del) - TBC1D24_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
./., -?/., ?/., -/. 7 - c.641G>A likely benign, VUS, benign r.(?) p.(Arg214His) g.2546790G>A g.2496789G>A TBC1D24(NM_001199107.1):c.641G>A (p.R214H) - TBC1D24_000018 VKGL data sharing initiative Nederland PubMed: Bobbili 2018, Journal: Bobbili 2018 - rs200324356 Germline, CLASSIFICATION record - 4/567 controls - - - Dheeraj Bobbili, VKGL-NL_Utrecht, VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
+?/. 1 - c.679C>T - r.(?) p.(Arg227Trp) g.2546828C>T - - - TBC1D24_000081 - - - - Somatic yes - - - - Jing Zhang
+?/? 1 2 c.686T>C - r.(?) p.(Phe229Ser) g.2546835T>C g.2496834T>C - - TBC1D24_000001 - - - - Unknown - - - - - Laurent Villard
-?/. 1 - c.702G>A likely benign r.(?) p.(=) g.2546851G>A - TBC1D24(NM_001199107.1):c.702G>A (p.V234=) - TBC1D24_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/? 7 2 c.724C>T - r.(?) p.(Arg242Cys) g.2546873C>T g.2496872C>T - - TBC1D24_000007 - PubMed: Campeau et al - - Germline - - pcampeau - - Philippe Campeau
+?/. 1 - c.725G>A - r.(?) p.(Arg242His) g.2546874G>A - - - TBC1D24_000082 - - - - Somatic yes - - - - Jing Zhang
?/. 1 - c.734T>C VUS r.(?) p.(Leu245Pro) g.2546883T>C - - - TBC1D24_000097 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/? 1 2 c.751T>C - r.(?) p.(Phe251Leu) g.2546900T>C g.2496899T>C - - TBC1D24_000003 - PubMed: Corbett MA et al, 2010 - - Germline yes - - - - Philippe Campeau
?/., -?/. 2 - c.785C>T VUS, likely benign r.(?) p.(Ser262Leu) g.2546934C>T - TBC1D24(NM_001199107.1):c.785C>T (p.S262L) - TBC1D24_000098 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/. 1 - c.821G>A likely benign r.(?) p.(Arg274Lys) g.2546970G>A - TBC1D24(NM_001199107.1):c.821G>A (p.R274K) - TBC1D24_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/., ?/. 3 - c.866C>T VUS r.(?) p.(Ala289Val) g.2547015C>T - TBC1D24(NM_001199107.1):c.866C>T (p.A289V) - TBC1D24_000041 VKGL data sharing initiative Nederland - - - Somatic, CLASSIFICATION record yes - - - - Jing Zhang, VKGL-NL
?/? 1 2 c.878G>C - r.(?) p.(Arg293Pro) g.2547027G>C g.2497026G>C - - TBC1D24_000016 - PubMed: Rehman et al., 2014 - - Germline yes - - - - Philippe Campeau
-/., -?/. 3 - c.885C>G benign, likely benign r.(?) p.(Phe295Leu) g.2547034C>G - TBC1D24(NM_001199107.1):c.885C>G (p.F295L) - TBC1D24_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/. 1 - c.965+7C>T likely benign r.(=) p.(=) g.2547121C>T - TBC1D24(NM_001199107.1):c.965+7C>T - TBC1D24_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.965+10C>T likely benign r.(=) p.(=) g.2547124C>T - TBC1D24(NM_001199107.1):c.965+10C>T - TBC1D24_000099 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.965+11G>A likely benign r.(=) p.(=) g.2547125G>A - TBC1D24(NM_001199107.1):c.965+11G>A - TBC1D24_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.965+40G>A likely benign r.(=) p.(=) g.2547154G>A - TBC1D24(NM_001199107.1):c.965+40G>A - TBC1D24_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/? 1 3 c.969_970delGT - r.(?) p.(Ser324Thrfs*3) g.2547714_2547715delGT g.2497713_2497714delGT - - TBC1D24_000006 - PubMed: Guven A et al. 2013 - - Germline yes - - - - Philippe Campeau
-?/. 1 - c.983+75T>G likely benign r.(=) p.(=) g.2547803T>G - TBC1D24(NM_001199107.1):c.983+75T>G - TBC1D24_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.983+95G>A likely benign r.(=) p.(=) g.2547823G>A - TBC1D24(NM_001199107.1):c.983+95G>A - TBC1D24_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.983+139C>T benign r.(=) p.(=) g.2547867C>T - TBC1D24(NM_001199107.1):c.983+139C>T - TBC1D24_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/? 1 4 c.999G>T - r.(?) p.(Leu333Phe) g.2548254G>T g.2498253G>T - - TBC1D24_000014 - PubMed: Campeau et al - - Germline - - pcampeau - - Philippe Campeau
-?/. 2 - c.1002C>T likely benign r.(?) p.(=) g.2548257C>T - TBC1D24(NM_001199107.1):c.1002C>T (p.A334=) - TBC1D24_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
+/., ?/. 3 - c.1008del pathogenic, VUS r.(?) p.(His336Glnfs*12) g.2548263del - 1 more item - TBC1D24_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen, VKGL-NL_Leiden
?/? 2 4 c.1008delT - r.(?) p.(His336Glnfs*12) g.2548263delT g.2498262delT - - TBC1D24_000009 - PubMed: Campeau et al - - Germline yes - pcampeau - - Philippe Campeau
-?/. 1 - c.1026G>A likely benign r.(?) p.(=) g.2548281G>A - TBC1D24(NM_001199107.1):c.1026G>A (p.S342=) - TBC1D24_000100 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1079G>A VUS r.(?) p.(Arg360His) g.2548334G>A - - - TBC1D24_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
./. 1 - c.1079G>T - r.(?) p.(Arg360Leu) g.2548334G>T g.2498333G>T - - TBC1D24_000022 - - - - Germline yes - - - - Philippe Campeau
?/. 1 - c.1084G>A VUS r.(?) p.(Ala362Thr) g.2548339G>A - TBC1D24(NM_001199107.1):c.1084G>A (p.A362T) - TBC1D24_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+?/., ./. 2 - c.1093C>T likely pathogenic r.(?) p.(Gln365*) g.2548348C>T g.2498347C>T TBC1D24(NM_001199107.1):c.1093C>T (p.Q365*) - TBC1D24_000028 VKGL data sharing initiative Nederland, stopgain variant PubMed: Bobbili 2018, Journal: Bobbili 2018 - - CLASSIFICATION record, Germline - 1/567 controls - - - VKGL-NL, Dheeraj Bobbili
-?/. 1 - c.1125C>T likely benign r.(?) p.(=) g.2548380C>T - TBC1D24(NM_001199107.1):c.1125C>T (p.H375=) - TBC1D24_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 2 - c.1143-6C>T benign r.(=) p.(=) g.2549352C>T - TBC1D24(NM_001199107.1):c.1143-6C>T - TBC1D24_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Rotterdam
+?/. 2 - c.1153C>T - r.(?) p.(Gln385*) g.2549368C>T - - - TBC1D24_000083 - - - - Somatic yes - - - - Jing Zhang
+?/. 1 - c.1170G>T likely pathogenic r.(?) p.(Glu390Asp) g.2549385G>T - TBC1D24(NM_001199107.1):c.1170G>T (p.E390D) - TBC1D24_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/., -?/. 2 - c.1196C>T VUS, likely benign r.(?) p.(Thr399Met) g.2549411C>T - TBC1D24(NM_001199107.1):c.1196C>T (p.T399M) - TBC1D24_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
?/? 1 5 c.1206+5G>A - r.spl p.? g.2549426G>A g.2499425G>A - - TBC1D24_000010 - PubMed: Campeau et al - - Germline - - pcampeau - - Philippe Campeau
-?/. 1 - c.1206+64_1206+85del likely benign r.(=) p.(=) g.2549485_2549506del - TBC1D24(NM_001199107.1):c.1206+64_1206+85delCCAGGGCTGGCTCTGATGGGCT - TBC1D24_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1207-48C>T likely benign r.(=) p.(=) g.2549788C>T - TBC1D24(NM_001199107.1):c.1207-48C>T - TBC1D24_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1244G>A VUS r.(?) p.(Arg415Lys) g.2549873G>A - TBC1D24(NM_001199107.1):c.1244G>A (p.R415K) - TBC1D24_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.1248del pathogenic r.(?) p.(Asn416Lysfs*31) g.2549877del - TBC1D24(NM_001199107.1):c.1248delT (p.N416Kfs*31) - TBC1D24_000104 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1303-29C>T likely benign r.(=) p.(=) g.2550240C>T - TBC1D24(NM_001199107.1):c.1303-29C>T - TBC1D24_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1314G>T VUS r.(?) p.(Glu438Asp) g.2550280G>T - TBC1D24(NM_001199107.1):c.1314G>T (p.E438D) - TBC1D24_000114 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1321C>T VUS r.(?) p.(Arg441Cys) g.2550287C>T - TBC1D24(NM_001199107.1):c.1321C>T (p.R441C) - TBC1D24_000105 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 2 - c.1326C>T likely benign r.(?) p.(=) g.2550292C>T - TBC1D24(NM_001199107.1):c.1326C>T (p.Y442=) - TBC1D24_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Rotterdam
-?/. 1 - c.1367C>T likely benign r.(?) p.(Pro456Leu) g.2550333C>T - TBC1D24(NM_001199107.1):c.1367C>T (p.P456L) - TBC1D24_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1411G>A VUS r.(?) p.(Ala471Thr) g.2550377G>A - TBC1D24(NM_001199107.1):c.1411G>A (p.A471T) - TBC1D24_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 - c.1427C>A VUS r.(?) p.(Ala476Asp) g.2550393C>A - TBC1D24(NM_001199107.1):c.1427C>A (p.A476D) - TBC1D24_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 2 - c.1440G>A benign r.(?) p.(=) g.2550406G>A - TBC1D24(NM_001199107.1):c.1440G>A (p.S480=) - TBC1D24_000106 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
./. 1 - c.1460dup - r.(?) p.(His487Glnfs*71) g.2550426dup g.2500425dup - - TBC1D24_000020 - - - - Unknown ? - - - - Philippe Campeau
Legend   « First ‹ Prev     1 2     Next › Last »