Unique variants in the TBC1D24 gene

Information The variants shown are described using the transcript reference sequence.

135 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »




AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







?/. 1 - c.-3491G>A r.(?) p.(=) - VUS g.2521796G>A g.2471795G>A NTN3(NM_006181.2):c.94G>A (p.(Asp32Asn)) - NTN3_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-3440_-3387del r.(?) p.(=) - VUS g.2521847_2521900del g.2471846_2471899del NTN3(NM_006181.2):c.142_195del (p.(Leu49_Ala66del)) - NTN3_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-2849_-2830del r.(?) p.(=) - VUS g.2522438_2522457del g.2472437_2472456del NTN3(NM_006181.2):c.736_755del (p.(Ala246ArgfsTer32)) - NTN3_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-2825_-2818del r.(?) p.(=) - VUS g.2522462_2522469del g.2472461_2472468del NTN3(NM_006181.2):c.760_767del (p.(Arg254ValfsTer28)) - NTN3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-2814_-2805del r.(?) p.(=) - VUS g.2522473_2522482del g.2472472_2472481del NTN3(NM_006181.2):c.771_780del (p.(Cys257TrpfsTer13)) - NTN3_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-2801_-2772del r.(?) p.(=) - VUS g.2522486_2522515del g.2472485_2472514del NTN3(NM_006181.2):c.783_812del (p.(Ser262_His271del)) - NTN3_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-1500_-1489del r.(?) p.(=) - VUS g.2523787_2523798del g.2473786_2473797del NTN3(NM_006181.2):c.1414_1425del (p.(Arg473_Ala476del)) - NTN3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-78G>A r.(?) p.(=) - likely benign g.2546072G>A g.2496071G>A TBC1D24(NM_001199107.2):c.-78G>A - TBC1D24_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 2 - c.-7C>T r.(?) p.(=) - likely benign g.2546143C>T g.2496142C>T TBC1D24(NM_001199107.2):c.-7C>T - TBC1D24_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen
-?/. 1 - c.22T>C r.(?) p.(Cys8Arg) - likely benign g.2546171T>C g.2496170T>C - - TBC1D24_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/? 2 2 c.58C>T r.(?) p.(Gln20*) - VUS g.2546207C>T g.2496206C>T - - TBC1D24_000019 - PubMed: Campeau et al - - Germline - - pcampeau - pcampeau Philippe Campeau
?/. 1 - c.74A>G r.(?) p.(Lys25Arg) - VUS g.2546223A>G g.2496222A>G TBC1D24(NM_001199107.1):c.74A>G (p.K25R) - TBC1D24_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 7 - c.116C>T r.(?) p.(Ala39Val) - likely pathogenic g.2546265C>T g.2496264C>T - - TBC1D24_000070 - - - - Somatic yes - - - - Jing Zhang
?/., ?/? 2 2 c.118C>T r.(?) p.(Arg40Cys) - VUS g.2546267C>T g.2496266C>T - - TBC1D24_000008 VKGL data sharing initiative Nederland PubMed: Campeau et al - - CLASSIFICATION record, Germline yes - pcampeau - - Philippe Campeau, VKGL-NL_Nijmegen
+/., +?/. 3 - c.119G>A r.(?) p.(Arg40His) - likely pathogenic, pathogenic (recessive) g.2546268G>A g.2496267G>A - - TBC1D24_000071 - PubMed: Hong 2020 - - Germline, Somatic yes - - - - Johan den Dunnen, Jing Zhang
?/? 1 2 c.119G>T r.(?) p.(Arg40Leu) - VUS g.2546268G>T g.2496267G>T - - TBC1D24_000012 - PubMed: Campeau et al - - Germline - - pcampeau - - Philippe Campeau
+?/. 1 - c.139A>G r.(?) p.(Ser47Gly) - likely pathogenic g.2546288A>G g.2496287A>G - - TBC1D24_000072 - - - - Somatic yes - - - - Jing Zhang
+?/. 1 - c.151C>T r.(?) p.(Arg51Trp) - likely pathogenic g.2546300C>T g.2496299C>T - - TBC1D24_000073 - - - - Somatic yes - - - - Jing Zhang
-?/., ./., ?/. 7 - c.169C>T r.(?) p.(Arg57Cys) - likely benign, VUS g.2546318C>T g.2496317C>T 1 more item - TBC1D24_000024 VKGL data sharing initiative Nederland PubMed: Bobbili 2018, Journal: Bobbili 2018 - rs202162520 CLASSIFICATION record, Germline - 1/567 controls, 2/194 cases RE - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, Dheeraj Bobbili, VKGL-NL_Groningen, VKGL-NL_Utrecht
./., ?/. 3 - c.178C>T r.(?) p.(Arg60Trp) - VUS g.2546327C>T g.2496326C>T TBC1D24(NM_001199107.1):c.178C>T (p.R60W), TBC1D24(NM_001199107.2):c.178C>T (p.R60W) - TBC1D24_000025 VKGL data sharing initiative Nederland PubMed: Bobbili 2018, Journal: Bobbili 2018 - rs373914077 CLASSIFICATION record, Germline - 1/567 controls - - - VKGL-NL_Rotterdam, Dheeraj Bobbili, VKGL-NL_Groningen
-?/. 1 - c.179G>A r.(?) p.(Arg60Gln) - likely benign g.2546328G>A g.2496327G>A TBC1D24(NM_001199107.1):c.179G>A (p.R60Q) - TBC1D24_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.192C>T r.(?) p.(Cys64=) - likely benign g.2546341C>T g.2496340C>T TBC1D24(NM_001199107.2):c.192C>T (p.C64=) - TBC1D24_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+?/. 1 - c.193C>T r.(?) p.(Arg65Cys) - likely pathogenic g.2546342C>T - - - TBC1D24_000132 - - - rs750421791 Unknown - - - - - MobiDetails
+/., +?/. 2 2 c.194G>T r.(?) p.(Arg65Leu) - likely pathogenic, pathogenic g.2546343G>T g.2496342G>T - - TBC1D24_000023 - - ClinVar-000225038.1 rs878853232 Germline yes 0/220 chromosomes - - - Zippi Brownstein, Nada Danial-Farran
?/. 1 - c.197C>T r.(?) p.(Thr66Met) - VUS g.2546346C>T g.2496345C>T - - TBC1D24_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 3 - c.204G>A r.(?) p.(Thr68=) - likely benign g.2546353G>A g.2496352G>A TBC1D24(NM_001199107.1):c.204G>A (p.T68=), TBC1D24(NM_001199107.2):c.204G>A (p.T68=) - TBC1D24_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht
-?/. 1 - c.207T>C r.(?) p.(Pro69=) - likely benign g.2546356T>C g.2496355T>C TBC1D24(NM_001199107.1):c.207T>C (p.P69=) - TBC1D24_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? 1 2 c.208G>T r.(?) p.(Asp70Tyr) - VUS g.2546357G>T g.2496356G>T - - TBC1D24_000015 - PubMed: Rehman et al., 2014 - - Germline - - - - - Philippe Campeau
-?/. 1 - c.225C>T r.(?) p.(Ser75=) - likely benign g.2546374C>T g.2496373C>T TBC1D24(NM_001199107.1):c.225C>T (p.S75=) - TBC1D24_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.232G>A r.(?) p.(Val78Met) - VUS g.2546381G>A - TBC1D24(NM_001199107.1):c.232G>A (p.V78M) - TBC1D24_000121 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., +?/. 12 - c.241_252del r.(?) p.(Ile81_Lys84del) - likely pathogenic, pathogenic (recessive) g.2546390_2546401del g.2496389_2496400del - - TBC1D24_000074, TBC1D24_000075 - PubMed: Hong 2020 - - Germline, Somatic yes - - - - Johan den Dunnen, Jing Zhang
?/. 1 - c.294C>A r.(?) p.(Asn98Lys) - VUS g.2546443C>A g.2496442C>A TBC1D24(NM_001199107.1):c.294C>A (p.(Asn98Lys)) - TBC1D24_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
./. 1 - c.313T>C r.(?) p.(Cys105Arg) - - g.2546462T>C g.2496461T>C - - TBC1D24_000021 - - - - Unknown ? - - - - Philippe Campeau
?/. 1 - c.317T>C r.(?) p.(Leu106Pro) - VUS g.2546466T>C - TBC1D24(NM_001199107.1):c.317T>C (p.L106P) - TBC1D24_000122 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
./., ?/. 2 - c.325C>T r.(?) p.(Arg109Cys) - VUS g.2546474C>T g.2496473C>T TBC1D24(NM_001199107.2):c.325C>T (p.R109C) - TBC1D24_000026 VKGL data sharing initiative Nederland PubMed: Bobbili 2018, Journal: Bobbili 2018 - rs372337277 CLASSIFICATION record, Germline - 1/567 controls - - - Dheeraj Bobbili, VKGL-NL_Groningen
?/? 1 2 c.328G>A r.(?) p.(Gly110Ser) - VUS g.2546477G>A g.2496476G>A - - TBC1D24_000013 - PubMed: Campeau et al - - Germline - - pcampeau - - Philippe Campeau
./. 1 - c.344G>T r.(?) p.(Arg115Leu) - VUS g.2546493G>T g.2496492G>T - - TBC1D24_000027 - PubMed: Bobbili 2018, Journal: Bobbili 2018 - - Germline - 1/567 controls - - - Dheeraj Bobbili
-?/. 1 - c.384C>T r.(?) p.(Ile128=) - likely benign g.2546533C>T g.2496532C>T TBC1D24(NM_001199107.1):c.384C>T (p.I128=) - TBC1D24_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 2 - c.404C>T r.(?) p.(Pro135Leu) - likely pathogenic g.2546553C>T g.2496552C>T - - TBC1D24_000076 - - - - Somatic yes - - - - Jing Zhang
?/. 1 - c.409G>A r.(?) p.(Val137Met) - VUS g.2546558G>A g.2496557G>A TBC1D24(NM_001199107.2):c.409G>A (p.V137M) - TBC1D24_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.418C>G r.(?) p.(Leu140Val) - VUS g.2546567C>G g.2496566C>G TBC1D24(NM_001199107.1):c.418C>G (p.L140V) - TBC1D24_000094 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.431A>G r.(?) p.(Tyr144Cys) - likely pathogenic g.2546580A>G g.2496579A>G - - TBC1D24_000077 - - - - Somatic yes - - - - Jing Zhang
-?/. 1 - c.438C>T r.(?) p.(Ile146=) - likely benign g.2546587C>T g.2496586C>T TBC1D24(NM_001199107.1):c.438C>T (p.I146=) - TBC1D24_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? 1 2 c.439G>C r.(?) p.(Asp147His) - VUS g.2546588G>C g.2496587G>C - - TBC1D24_000004 - PubMed: Falace A et al. 2010 - - Germline - - - - - Philippe Campeau
-?/. 1 - c.441C>T r.(?) p.(Asp147=) - likely benign g.2546590C>T - TBC1D24(NM_001199107.1):c.441C>T (p.D147=) - TBC1D24_000134 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.442G>A r.(?) p.(Glu148Lys) - likely pathogenic g.2546591G>A g.2496590G>A - - TBC1D24_000078 - - - - Somatic yes - - - - Jing Zhang
-?/. 1 - c.447C>T r.(?) p.(Ala149=) - likely benign g.2546596C>T g.2496595C>T TBC1D24(NM_001199107.1):c.447C>T (p.A149=) - TBC1D24_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/., ?/. 3 - c.457G>A r.(?) p.(Glu153Lys) - likely pathogenic, VUS g.2546606G>A g.2496605G>A TBC1D24(NM_001199107.1):c.457G>A (p.E153K, p.(Glu153Lys)) - TBC1D24_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
+?/. 1 - c.457G>T r.(?) p.(Glu153*) - likely pathogenic g.2546606G>T g.2496605G>T - - TBC1D24_000079 - - - - Somatic yes - - - - Jing Zhang
+?/? 1 2 c.468C>A r.(?) p.(Cys156*) - likely pathogenic g.2546617C>A g.2496616C>A - - TBC1D24_000002 - - - - Unknown - - - - - Laurent Villard
?/. 1 - c.493G>A r.(?) p.(Gly165Ser) - VUS g.2546642G>A - TBC1D24(NM_001199107.1):c.493G>A (p.G165S) - TBC1D24_000135 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/., +?/? 3 2 c.533C>T r.(?) p.(Ser178Leu) - likely pathogenic (dominant) g.2546682C>T g.2496681C>T - - TBC1D24_000017 - PubMed: Azaiez 2014, PubMed: Zhang 2014 - - Germline yes - - - - Hela Azaiez, Tao Yang, Dominika Oziębło
-?/. 1 - c.546G>A r.(?) p.(Thr182=) - likely benign g.2546695G>A g.2496694G>A TBC1D24(NM_001199107.1):c.546G>A (p.T182=) - TBC1D24_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 2 c.553G>A r.(?) p.(Asp185Asn) - likely pathogenic (dominant) g.2546702G>A g.2496701G>A - - TBC1D24_000126 - - - - Germline yes - - - - Dominika Oziębło
?/. 1 - c.601G>A r.(?) p.(Val201Met) - VUS g.2546750G>A - TBC1D24(NM_001199107.1):c.601G>A (p.V201M) - TBC1D24_000130 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.605C>T r.(?) p.(Ser202Leu) - VUS g.2546754C>T - - - TBC1D24_000129 - - - rs796053400 Unknown - - - - - MobiDetails
+?/. 2 - c.619C>T r.(?) p.(Gln207*) - likely pathogenic, pathogenic g.2546768C>T g.2496767C>T c.619C>T - TBC1D24_000080 - - - - Somatic yes - - - - Jing Zhang
?/. 1 - c.622_639del r.(?) p.(Val208_Gln213del) - VUS g.2546771_2546788del g.2496770_2496787del TBC1D24(NM_001199107.1):c.622_639delGTCTATGCGGACTGGCAG (p.V208_Q213del) - TBC1D24_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., +?/., ./. 6 2 c.641G>A r.(?) p.(Arg214His) - likely pathogenic (recessive), pathogenic, VUS g.2546790G>A g.2496789G>A c.641G>A - TBC1D24_000018 - PubMed: Bobbili 2018, Journal: Bobbili 2018, PubMed: _Audo-2012 - rs200324356 Germline, Unknown - 4/567 controls - - - Dheeraj Bobbili, Alejandro Brea-Fernández
+?/. 1 - c.679C>T r.(?) p.(Arg227Trp) - likely pathogenic g.2546828C>T g.2496827C>T - - TBC1D24_000081 - - - - Somatic yes - - - - Jing Zhang
?/. 1 - c.680G>A r.(?) p.(Arg227Gln) - VUS g.2546829G>A - TBC1D24(NM_001199107.1):c.680G>A (p.R227Q) - TBC1D24_000123 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.683T>A r.(?) p.(Val228Asp) - VUS g.2546832T>A - - - TBC1D24_000133 - - - rs778090075 Unknown - - - - - MobiDetails
+?/? 1 2 c.686T>C r.(?) p.(Phe229Ser) - likely pathogenic g.2546835T>C g.2496834T>C - - TBC1D24_000001 - - - - Unknown - - - - - Laurent Villard
-?/. 1 - c.702G>A r.(?) p.(Val234=) - likely benign g.2546851G>A g.2496850G>A TBC1D24(NM_001199107.1):c.702G>A (p.V234=) - TBC1D24_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? 7 2 c.724C>T r.(?) p.(Arg242Cys) - likely pathogenic, VUS g.2546873C>T g.2496872C>T - - TBC1D24_000007 - PubMed: Campeau et al - - Germline - - pcampeau - - Philippe Campeau
+?/. 1 - c.725G>A r.(?) p.(Arg242His) - likely pathogenic g.2546874G>A g.2496873G>A - - TBC1D24_000082 - - - - Somatic yes - - - - Jing Zhang
?/. 1 - c.734T>C r.(?) p.(Leu245Pro) - VUS g.2546883T>C g.2496882T>C - - TBC1D24_000097 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/? 1 2 c.751T>C r.(?) p.(Phe251Leu) - pathogenic g.2546900T>C g.2496899T>C - - TBC1D24_000003 - PubMed: Corbett MA et al, 2010 - - Germline yes - - - - Philippe Campeau
-?/., ?/. 2 - c.785C>T r.(?) p.(Ser262Leu) - likely benign, VUS g.2546934C>T g.2496933C>T TBC1D24(NM_001199107.1):c.785C>T (p.S262L), TBC1D24(NM_001199107.2):c.785C>T (p.S262L) - TBC1D24_000098 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
+?/. 1 - c.809G>A r.(?) p.(Arg270His) - likely pathogenic g.2546958G>A - TBC1D24(NM_001199107.1):c.809G>A (p.R270H) - TBC1D24_000131 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.821G>A r.(?) p.(Arg274Lys) - likely benign g.2546970G>A g.2496969G>A TBC1D24(NM_001199107.2):c.821G>A (p.R274K) - TBC1D24_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+?/., ?/. 3 - c.866C>T r.(?) p.(Ala289Val) - likely pathogenic, VUS g.2547015C>T g.2497014C>T TBC1D24(NM_001199107.1):c.866C>T (p.A289V) - TBC1D24_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Somatic yes - - - - VKGL-NL_Rotterdam, Jing Zhang
?/. 1 - c.878G>A r.(?) p.(Arg293His) - VUS g.2547027G>A g.2497026G>A TBC1D24(NM_001199107.1):c.878G>A (p.R293H) - TBC1D24_000117 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? 1 2 c.878G>C r.(?) p.(Arg293Pro) - VUS g.2547027G>C g.2497026G>C - - TBC1D24_000016 - PubMed: Rehman et al., 2014 - - Germline yes - - - - Philippe Campeau
-/., -?/. 3 - c.885C>G r.(?) p.(Phe295Leu) - benign, likely benign g.2547034C>G g.2497033C>G TBC1D24(NM_001199107.1):c.885C>G (p.F295L), TBC1D24(NM_001199107.2):c.885C>G (p.F295L) - TBC1D24_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht
-?/. 1 - c.965+7C>T r.(=) p.(=) - likely benign g.2547121C>T g.2497120C>T TBC1D24(NM_001199107.2):c.965+7C>T - TBC1D24_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.965+10C>T r.(=) p.(=) - likely benign g.2547124C>T g.2497123C>T TBC1D24(NM_001199107.1):c.965+10C>T - TBC1D24_000099 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.965+11G>A r.(=) p.(=) - likely benign g.2547125G>A g.2497124G>A TBC1D24(NM_001199107.2):c.965+11G>A - TBC1D24_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.965+40G>A r.(=) p.(=) - likely benign g.2547154G>A g.2497153G>A TBC1D24(NM_001199107.2):c.965+40G>A - TBC1D24_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/? 1 3 c.969_970del r.(?) p.(Ser324Thrfs*3) - pathogenic g.2547714_2547715del g.2497713_2497714del - - TBC1D24_000006 - PubMed: Guven A et al. 2013 - - Germline yes - - - - Philippe Campeau
-?/. 1 - c.983+75T>G r.(=) p.(=) - likely benign g.2547803T>G g.2497802T>G TBC1D24(NM_001199107.2):c.983+75T>G - TBC1D24_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.983+95G>A r.(=) p.(=) - likely benign g.2547823G>A g.2497822G>A TBC1D24(NM_001199107.2):c.983+95G>A - TBC1D24_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 1 - c.983+139C>T r.(=) p.(=) - benign g.2547867C>T g.2497866C>T TBC1D24(NM_001199107.2):c.983+139C>T - TBC1D24_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/? 1 4 c.999G>T r.(?) p.(Leu333Phe) - VUS g.2548254G>T g.2498253G>T - - TBC1D24_000014 - PubMed: Campeau et al - - Germline - - pcampeau - - Philippe Campeau
-?/. 2 - c.1002C>T r.(?) p.(Ala334=) - likely benign g.2548257C>T g.2498256C>T TBC1D24(NM_001199107.1):c.1002C>T (p.A334=), TBC1D24(NM_001199107.2):c.1002C>T (p.A334=) - TBC1D24_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
+/., ?/., ?/? 5 4 c.1008del r.(?) p.(His336Glnfs*12), p.(His336GlnfsTer12) - pathogenic, VUS g.2548263del g.2498262del 1 more item - TBC1D24_000009, TBC1D24_000049 VKGL data sharing initiative Nederland PubMed: Campeau et al - - CLASSIFICATION record, Germline yes - pcampeau - - Philippe Campeau, VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
?/. 1 - c.1015A>G r.(?) p.(Asn339Asp) - VUS g.2548270A>G - TBC1D24(NM_001199107.1):c.1015A>G (p.N339D) - TBC1D24_000118 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1026G>A r.(?) p.(Ser342=) - likely benign g.2548281G>A g.2498280G>A TBC1D24(NM_001199107.2):c.1026G>A (p.S342=) - TBC1D24_000100 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.1039G>A r.(?) p.(Val347Met) - VUS g.2548294G>A - - - TBC1D24_000125 - - - rs371031447 Unknown - - - - - MobiDetails
?/. 1 - c.1079G>A r.(?) p.(Arg360His) - VUS g.2548334G>A g.2498333G>A - - TBC1D24_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
./. 1 - c.1079G>T r.(?) p.(Arg360Leu) - likely pathogenic g.2548334G>T g.2498333G>T - - TBC1D24_000022 - - - - Germline yes - - - - Philippe Campeau
?/. 1 - c.1084G>A r.(?) p.(Ala362Thr) - VUS g.2548339G>A g.2498338G>A TBC1D24(NM_001199107.1):c.1084G>A (p.A362T) - TBC1D24_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/., ./. 2 - c.1093C>T r.(?) p.(Gln365*), p.(Gln365Ter) - likely pathogenic, VUS g.2548348C>T g.2498347C>T TBC1D24(NM_001199107.2):c.1093C>T (p.Q365*) - TBC1D24_000028 stopgain variant, VKGL data sharing initiative Nederland PubMed: Bobbili 2018, Journal: Bobbili 2018 - - CLASSIFICATION record, Germline - 1/567 controls - - - Dheeraj Bobbili, VKGL-NL_Utrecht
-?/. 1 - c.1125C>T r.(?) p.(His375=) - likely benign g.2548380C>T g.2498379C>T TBC1D24(NM_001199107.1):c.1125C>T (p.H375=) - TBC1D24_000101 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 2 - c.1143-6C>T r.(=) p.(=) - benign g.2549352C>T g.2499351C>T TBC1D24(NM_001199107.1):c.1143-6C>T, TBC1D24(NM_001199107.2):c.1143-6C>T - TBC1D24_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
+?/. 2 - c.1153C>T r.(?) p.(Gln385*) - likely pathogenic g.2549368C>T g.2499367C>T - - TBC1D24_000083 - - - - Somatic yes - - - - Jing Zhang
+?/. 1 - c.1170G>T r.(?) p.(Glu390Asp) - likely pathogenic g.2549385G>T g.2499384G>T TBC1D24(NM_001199107.2):c.1170G>T (p.E390D) - TBC1D24_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/., ?/. 2 - c.1196C>T r.(?) p.(Thr399Met) - likely benign, VUS g.2549411C>T g.2499410C>T TBC1D24(NM_001199107.1):c.1196C>T (p.T399M), TBC1D24(NM_001199107.2):c.1196C>T (p.T399M) - TBC1D24_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
?/? 1 5 c.1206+5G>A r.spl p.? - likely pathogenic g.2549426G>A g.2499425G>A - - TBC1D24_000010 - PubMed: Campeau et al - - Germline - - pcampeau - - Philippe Campeau
-?/. 1 - c.1206+64_1206+85del r.(=) p.(=) - likely benign g.2549485_2549506del g.2499484_2499505del TBC1D24(NM_001199107.2):c.1206+64_1206+85delCCAGGGCTGGCTCTGATGGGCT - TBC1D24_000102 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
Legend   How to query   « First ‹ Prev     1 2     Next › Last »