Unique variants in the TBP gene

Information The variants shown are described using the transcript reference sequence.

35 entries on 1 page. Showing entries 1 - 35.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-/. 1 - c.-7+2789G>A r.(=) p.(=) - benign g.170866340G>A g.170557252G>A TBP(NM_003194.5):c.54+169G>A - TBP_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.120G>A r.(?) p.(Gln40=) - likely benign g.170871004G>A g.170561916G>A TBP(NM_003194.4):c.180G>A (p.Q60=) - TBP_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.150G>A r.(?) p.(Gln50=) - likely benign g.170871034G>A g.170561946G>A TBP(NM_003194.4):c.210G>A (p.Q70=) - TBP_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.153_155del r.(?) p.(Gln75del) - benign g.170871037_170871039del g.170561949_170561951del TBP(NM_003194.4):c.213_215delGCA (p.Q95del) - TBP_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.153_155dup r.(?) p.(Gln75dup) - benign g.170871037_170871039dup g.170561949_170561951dup TBP(NM_003194.5):c.213_215dupGCA (p.Q95dup) - TBP_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 2 - c.156A>G r.(?) p.(Gln52=) - likely benign g.170871040A>G g.170561952A>G TBP(NM_003194.5):c.216A>G (p.Q72=) - TBP_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
-/. 1 - c.156_157insG r.(?) p.(Gln53AlafsTer105) - benign g.170871040_170871041insG g.170561952_170561953insG TBP(NM_003194.4):c.216_217insG (p.Q73Afs*105) - TBP_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 2 - c.156_158del r.(?) p.(Gln75del) - benign g.170871040_170871042del g.170561952_170561954del TBP(NM_003194.4):c.216_218delACA (p.Q95del), TBP(NM_003194.5):c.216_218delACA (p.Q95del) - TBP_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/. 1 - c.162A>G r.(?) p.(Gln54=) - likely benign g.170871046A>G g.170561958A>G TBP(NM_003194.5):c.222A>G (p.Q74=) - TBP_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.165G>A r.(?) p.(Gln55=) - likely benign g.170871049G>A g.170561961G>A TBP(NM_003194.5):c.225G>A (p.Q75=) - TBP_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/., -?/. 3 - c.167_168insACA r.(?) p.(Gln75dup) - benign, likely benign g.170871051_170871052insACA g.170561963_170561964insACA TBP(NM_003194.4):c.227_228insACA (p.Q95dup), TBP(NM_003194.5):c.227_228insACA (p.Q95dup) - TBP_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht
-/. 1 - c.168G>A r.(?) p.(Gln56=) - benign g.170871052G>A g.170561964G>A TBP(NM_003194.5):c.228G>A (p.Q76=) - TBP_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - c.168_169del r.(?) p.(Gln57AlafsTer100) - likely benign g.170871052_170871053del g.170561964_170561965del TBP(NM_003194.5):c.228_229delGC (p.Q77Afs*100) - TBP_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/., -?/. 3 - c.171del r.(?) p.(Gln57HisfsTer67) - benign, likely benign g.170871055del g.170561967del 1 more item - TBP_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht
-?/. 1 - c.171G>A r.(?) p.(Gln57=) - likely benign g.170871055G>A g.170561967G>A TBP(NM_003194.5):c.231G>A (p.Q77=) - TBP_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 2 - c.171_174del r.(?) p.(Gln57HisfsTer66) - benign g.170871055_170871058del g.170561967_170561970del 1 more item - TBP_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-/. 1 - c.171_177del r.(?) p.(Gln57HisfsTer65) - benign g.170871055_170871061del g.170561967_170561973del TBP(NM_003194.5):c.231_237delGCAGCAG (p.Q77Hfs*65) - TBP_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 2 - c.171_180del r.(?) p.(Gln57HisfsTer64) - benign g.170871055_170871064del g.170561967_170561976del 1 more item - TBP_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-/., -?/. 2 - c.171_183del r.(?) p.(Gln57HisfsTer63) - benign, likely benign g.170871055_170871067del g.170561967_170561979del 1 more item - TBP_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/. 2 - c.171_186del r.(?) p.(Gln57HisfsTer62) - likely benign g.170871055_170871070del g.170561967_170561982del TBP(NM_003194.5):c.231_246delGCAGCAGCAGCAGCAG (p.Q77Hfs*62) - TBP_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
-?/. 1 - c.171_189del r.(?) p.(Gln57HisfsTer61) - likely benign g.170871055_170871073del g.170561967_170561985del TBP(NM_003194.5):c.231_249delGCAGCAGCAGCAGCAGCAG (p.Q77Hfs*61) - TBP_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 2 - c.171_192del r.(?) p.(Gln57HisfsTer60) - benign g.170871055_170871076del g.170561967_170561988del 1 more item - TBP_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-/. 1 - c.171_198del r.(?) p.(Gln57HisfsTer58) - benign g.170871055_170871082del - TBP(NM_003194.4):c.231_258delGCAGCAGCAGCAGCAGCAGCAGCAGCAG (p.Q77Hfs*58) - TBP_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.173_174insACAGCAACA r.(?) p.(Gln73_Gln75dup) - likely benign g.170871057_170871058insACAGCAACA - TBP(NM_003194.5):c.233_234insACAGCAACA (p.Q93_Q95dup) - TBP_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.200A>G r.(?) p.(Gln67Arg) - likely benign g.170871084A>G - TBP(NM_003194.4):c.260A>G (p.Q87R) - TBP_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/., ?/. 2 - c.216_221del r.(?) p.(Gln74_Gln75del) - benign, VUS g.170871100_170871105del g.170562012_170562017del 1 more item - TBP_000007, TBP_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen
-/. 1 - c.216_221dup r.(?) p.(Gln74_Gln75dup) - benign g.170871100_170871105dup - TBP(NM_003194.5):c.276_281dupGCAGCA (p.Q94_Q95dup) - TBP_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 2 - c.219_221del r.(?) p.(Gln75del) - benign g.170871103_170871105del g.170562015_170562017del TBP(NM_003194.4):c.279_281delGCA (p.Q95del), TBP(NM_003194.5):c.279_281delGCA (p.Q95del) - TBP_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-/. 1 - c.219_221dup r.(?) p.(Gln75dup) - benign g.170871103_170871105dup g.170562015_170562017dup TBP(NM_003194.4):c.279_281dupGCA (p.Q95dup) - TBP_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.292G>A r.(?) p.(Ala98Thr) - likely benign g.170871176G>A - TBP(NM_003194.4):c.352G>A (p.A118T) - TBP_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.438-3C>T r.spl? p.? - likely benign g.170873630C>T - TBP(NM_003194.4):c.498-3C>T - TBP_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.510C>T r.(?) p.(Ala170=) - likely benign g.170873705C>T g.170564617C>T TBP(NM_003194.4):c.570C>T (p.A190=) - TBP_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.511G>C r.(?) p.(Glu171Gln) - VUS g.170873706G>C g.170564618G>C TBP(NM_001172085.1):c.511G>C (p.(Glu171Gln)) - TBP_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.526-6T>C r.(=) p.(=) - likely benign g.170876000T>C - TBP(NM_003194.4):c.586-6T>C - TBP_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.744A>G r.(?) p.(Ile248Met) - VUS g.170878826A>G g.170569738A>G TBP(NM_003194.4):c.804A>G (p.I268M) - TBP_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query