Unique variants in the TMX2-CTNND1 gene

Information The variants shown are described using the NR_037646.1 transcript reference sequence.

69 entries on 1 page. Showing entries 1 - 69.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 1 - n.238G>C r.(?) - - likely benign g.57480232G>C g.57712760G>C TMX2(NM_015959.4):c.142G>C (p.G48R) - C11orf31_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - n.260A>C r.(?) - - pathogenic g.57480254A>C g.57712782A>C TMX2(NM_015959.4):c.164A>C (p.D55A) - TMX2_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 3 - n.276C>G r.(?) - - likely benign, VUS g.57480270C>G g.57712798C>G TMX2(NM_001347890.1):c.180C>G (p.D60E), TMX2(NM_015959.4):c.180C>G (p.D60E, p.(Asp60Glu)) - C11orf31_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_VUmc
-?/., ?/. 2 - n.285+11762C>T r.(?) - - likely benign, VUS g.57492041C>T - TMX2(NM_001347891.1):c.196C>T (p.R66C), TMX2(NM_001347891.2):c.196C>T (p.(Arg66Cys)) - C11orf31_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
?/. 1 - n.346+238_346+239del r.(?) - - VUS g.57505378_57505379del - TMX2(NM_015959.4):c.251-7_251-6del - C11orf31_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - n.346+712dup r.(?) - - pathogenic g.57505852dup g.57738380dup TMX2(NM_015959.4):c.391dupC (p.L131Pfs*6) - C11orf31_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - n.346+739T>C r.(?) - - VUS g.57505879T>C g.57738407T>C TMX2(NM_001144012.2):c.304T>C (p.(Tyr102His)) - TMX2-CTNND1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - n.346+1360T>C r.(?) - - likely benign g.57506500T>C - TMX2(NM_001347895.1):c.321T>C (p.D107=) - C11orf31_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - n.346+1366_346+1386del r.(?) - - VUS g.57506506_57506526del - TMX2(NM_015959.3):c.609_614+15delTACGCGGTATGTAAAGACCTG (p.(Ser203_Thr204del)) - TMX2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - n.346+1378A>G r.(?) - - likely benign g.57506518A>G g.57739046A>G TMX2(NM_015959.4):c.614+7A>G - C11orf31_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - n.346+2561dup r.(?) - - VUS g.57507701dup - TMX2(NM_015959.3):c.875dupA (p.(Asn292fs)) - C11orf31_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - n.346+2562C>G r.(?) - - VUS g.57507702C>G - TMX2(NM_015959.3):c.876C>G (p.(Asn292Lys)) - C11orf31_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - n.346+4289A>G r.(=) - - VUS g.57509429A>G g.57741957A>G - - C11orf31_000001 - - - - Germline - - - - - Yu Sun
-?/. 1 - n.466-8C>G r.(?) - - likely benign g.57558849C>G g.57791377C>G CTNND1(NM_001085458.1):c.-94-8C>G - C11orf31_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - n.583G>C r.(?) - - likely benign g.57558974G>C g.57791502G>C CTNND1(NM_001085458.1):c.24G>C (p.S8=) - C11orf31_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - n.601C>T r.(?) - - likely benign g.57558992C>T g.57791520C>T CTNND1(NM_001085458.1):c.42C>T (p.A14=), CTNND1(NM_001085458.2):c.42C>T (p.A14=) - C11orf31_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/. 1 - n.659C>G r.(?) - - likely benign g.57559050C>G g.57791578C>G CTNND1(NM_001085458.1):c.100C>G (p.R34G) - C11orf31_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 2 - n.761C>T r.(?) - - likely benign, VUS g.57561488C>T - CTNND1(NM_001085458.1):c.202C>T (p.R68W), CTNND1(NM_001085458.2):c.202C>T (p.R68W) - C11orf31_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-/. 1 - n.816A>G r.(?) - - benign g.57561543A>G g.57794071A>G CTNND1(NM_001085458.1):c.257A>G (p.N86S) - C11orf31_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - n.817C>T r.(?) - - likely benign g.57561544C>T g.57794072C>T CTNND1(NM_001085458.1):c.258C>T (p.N86=) - C11orf31_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - n.858C>T r.(?) - - likely benign g.57563080C>T g.57795608C>T CTNND1(NM_001085458.1):c.299C>T (p.(Pro100Leu)) - C11orf31_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - n.896A>C r.(?) - - likely benign g.57563118A>C - CTNND1(NM_001085458.2):c.337A>C (p.(Thr113Pro)) - C11orf31_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - n.914G>C r.(?) - - VUS g.57563136G>C - CTNND1(NM_001085458.2):c.355G>C (p.G119R) - C11orf31_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - n.1018A>G r.(?) - - likely benign g.57563967A>G - CTNND1(NM_001085458.1):c.459A>G (p.V153=) - C11orf31_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - n.1124G>A r.(?) - - VUS g.57564073G>A - - - C11orf31_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - n.1177C>G r.(?) - - VUS g.57564126C>G - CTNND1(NM_001085458.1):c.618C>G (p.(Phe206Leu)) - C11orf31_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - n.1193G>A r.(?) - - likely benign g.57564142G>A - CTNND1(NM_001085458.1):c.634G>A (p.(Gly212Ser)) - C11orf31_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - n.1218G>A r.(?) - - likely benign g.57564167G>A - CTNND1(NM_001085458.2):c.659G>A (p.G220D) - C11orf31_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/. 1 - n.1343C>T r.(?) - - likely pathogenic g.57564292C>T - CTNND1(NM_001085458.1):c.784C>T (p.(Gln262*)) - C11orf31_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - n.1377A>G r.(?) - - likely benign g.57564326A>G - CTNND1(NM_001085458.1):c.818A>G (p.(His273Arg)) - C11orf31_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - n.1379C>T r.(?) - - VUS g.57564328C>T - CTNND1(NM_001085458.2):c.820C>T (p.(Arg274Cys)) - C11orf31_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - n.1416A>G r.(?) - - likely benign g.57564365A>G - CTNND1(NM_001085458.1):c.857A>G (p.(Gln286Arg)) - C11orf31_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - n.1431A>G r.(?) - - VUS g.57564380A>G g.57796908A>G CTNND1(NM_001085458.1):c.872A>G (p.Y291C) - C11orf31_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - n.1490C>T r.(?) - - likely benign g.57564439C>T - CTNND1(NM_001085458.1):c.931C>T (p.(Pro311Ser)) - C11orf31_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - n.1508C>T r.(?) - - VUS g.57564457C>T - CTNND1(NM_001085458.2):c.949C>T (p.R317C) - C11orf31_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - n.1749A>G r.(?) - - VUS g.57569438A>G - CTNND1(NM_001085458.2):c.1190A>G (p.N397S) - C11orf31_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - n.1768C>T r.(?) - - likely benign g.57569457C>T - CTNND1(NM_001085458.1):c.1209C>T (p.D403=) - C11orf31_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., ./. 6 - n.1931C>T r.(?) - - pathogenic g.57569620C>T g.57802148C>T CTNND1(NM_001085458.1):c.1372C>T (p.R458*) - CTNND1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record, Germline - - - - - Sanne Savelberg, VKGL-NL_Rotterdam
-?/. 1 - n.1978C>T r.(?) - - likely benign g.57569667C>T - CTNND1(NM_001085458.1):c.1419C>T (p.T473=) - C11orf31_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - n.1983C>T r.(?) - - VUS g.57571096C>T g.57803624C>T CTNND1(NM_001085458.1):c.1424C>T (p.T475I) - C11orf31_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - n.2096A>G r.(?) - - likely benign g.57571209A>G g.57803737A>G CTNND1(NM_001085458.1):c.1537A>G (p.N513D), CTNND1(NM_001085458.2):c.1537A>G (p.N513D) - C11orf31_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/. 1 - n.2114C>T r.(?) - - likely benign g.57571227C>T - CTNND1(NM_001085458.2):c.1555C>T (p.(Arg519Cys)) - C11orf31_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - n.2130A>T r.(?) - - likely benign g.57571243A>T - CTNND1(NM_001085458.2):c.1571A>T (p.(Glu524Val)) - C11orf31_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - n.2133C>T r.(?) - - VUS g.57571246C>T - CTNND1(NM_001085458.2):c.1574C>T (p.S525L) - C11orf31_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
./. 2 - n.2154G>A r.(?) - - pathogenic g.57571267G>A g.57803795G>A - - CTNND1_000002 - - - - De novo, Germline - - - - - Sanne Savelberg
-?/. 1 - n.2281+7G>T r.(?) - - likely benign g.57572259G>T - CTNND1(NM_001085458.1):c.1722+7G>T - C11orf31_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - n.2309C>T r.(?) - - VUS g.57573381C>T - CTNND1(NM_001085458.1):c.1750C>T (p.(Arg584Trp)) - C11orf31_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - n.2321_2325del r.(?) - - pathogenic g.57573393_57573397del - CTNND1(NM_001085458.2):c.1762_1766delTATCA (p.Y588Sfs*38) - C11orf31_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - n.2382C>G r.(?) - - likely benign g.57573454C>G - CTNND1(NM_001085458.1):c.1823C>G (p.A608G) - C11orf31_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - n.2396C>T r.(?) - - likely benign g.57573468C>T - CTNND1(NM_001085458.2):c.1837C>T (p.P613S) - C11orf31_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - n.2453+10_2453+11insA r.(?) - - likely benign g.57573960_57573961insA g.57806488_57806489insA CTNND1(NM_001085458.1):c.1894+10_1894+11insA - C11orf31_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 2 - n.2508C>T r.(?) - - VUS g.57574441C>T g.57806969C>T CTNND1(NM_001085458.1):c.1949C>T (p.T650M), CTNND1(NM_001085458.2):c.1949C>T (p.T650M) - TMX2-CTNND1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
+?/. 1 - n.2572dup r.(?) - - likely pathogenic g.57575686dup - CTNND1(NM_001085458.1):c.2013dupT (p.(Leu672fs)) - C11orf31_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - n.2640G>C r.(?) - - VUS g.57575754G>C - CTNND1(NM_001085458.2):c.2081G>C (p.(Gly694Ala)) - C11orf31_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - n.2666C>T r.(?) - - VUS g.57575877C>T g.57808405C>T CTNND1(NM_001085458.2):c.2107C>T (p.R703C) - TMX2-CTNND1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - n.2718C>A r.(?) - - VUS g.57575929C>A - CTNND1(NM_001085458.1):c.2159C>A (p.T720N) - C11orf31_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - n.2732C>T r.(?) - - likely benign g.57575943C>T - CTNND1(NM_001085458.2):c.2173C>T (p.R725W) - C11orf31_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - n.2848G>A r.(?) - - likely benign g.57576792G>A - CTNND1(NM_001085458.1):c.2289G>A (p.Q763=) - C11orf31_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - n.2908C>T r.(?) - - likely benign g.57576852C>T - CTNND1(NM_001085458.1):c.2349C>T (p.N783=) - C11orf31_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 3 - n.2994+6C>G r.(?) - - likely benign g.57576944C>G g.57809472C>G CTNND1(NM_001085458.1):c.2435+6C>G, CTNND1(NM_001085458.2):c.2435+6C>G - C11orf31_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/., ?/. 2 - n.3033T>C r.(?) - - likely benign, VUS g.57577619T>C g.57810147T>C CTNND1(NM_001085458.1):c.2474T>C (p.V825A, p.(Val825Ala)) - TMX2-CTNND1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
./. 1 - n.3048G>A r.(?) - - pathogenic g.57577634G>A g.57810162G>A - - CTNND1_000003 - - - - De novo - - - - - Sanne Savelberg
-?/. 1 - n.3110-7C>T r.(?) - - likely benign g.57578864C>T - CTNND1(NM_001085458.2):c.2551-7C>T - C11orf31_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 2 - n.3182C>T r.(?) - - likely benign g.57578943C>T - CTNND1(NM_001085458.1):c.2623C>T (p.R875W), CTNND1(NM_001085458.2):c.2623C>T (p.R875W) - C11orf31_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/. 1 - n.3190A>G r.(?) - - likely benign g.57578951A>G g.57811479A>G CTNND1(NM_001085458.1):c.2631A>G (p.Q877=) - C11orf31_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - n.3197+16G>A r.(?) - - likely benign g.57578974G>A - CTNND1(NM_001085458.2):c.2638+16G>A - C11orf31_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - n.3233A>G r.(?) - - likely benign g.57581818A>G - CTNND1(NM_001085458.2):c.2674A>G (p.N892D) - C11orf31_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 1 - n.3261-7dup r.(?) - - likely benign g.57582859dup - CTNND1(NM_001085458.2):c.2702-7dup - C11orf31_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - n.3273C>A r.(?) - - likely benign g.57582878C>A - CTNND1(NM_001085458.1):c.2714C>A (p.S905Y) - C11orf31_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.